THÔNG TIN TÀI LIỆU
Vietnam Journal o f Biotechnoỉogy 20(2): 245-252, 2022 A S S E S S M E N T O F T H E G E N E T IC C H A N G E S O F T H E A T T E N U A T E D H A N V E T 1.V N S T R A IN C O M P A R E D W IT H O R IG IN A L V IR U L E N T 02H Y S T R A IN O F T H E P O R C IN E R E P R O D U C T IV E A N D R E S P IR A T O R Y SY N D R O M E V IR U S Nguyên Thi Nga1, Ha Thi Thu2, Nguyên Thi Hoa2, Vu Thi Hien2, Nguyên Thu Trang3, Nguyên Thanh Ba3, Tran Van Khanh3, Nguyên Huu Vu3, Dong Van Quyen2, To Long Thanh4, Dinh Duy Khang2H 1Ịnstitute o f Science and Technology, Mỉnỉstry o f Public Security, 47 Pharn Van Dong Road, Cau Giay District, Hanoi, Vietnam :ỊnstituteofBiotechnology, Vietnam Academy o f Science and Technology, 18 Hoang Quoc VietRoad, Cau Giay District, Hanoi, Vietnam }Hanvet Pharmaceutỉcal Co., Ltd, 88 Truông Chinh Road, Dong Da District, Hanoi, Vietnam 4National Center fo r Veterỉnary Diagnostics, MARD's Department o f Animal Health, 15/78 Giai Phong Road, Dong Da District, Hanoi, Vietnam To whom correspondence should be addressed E-mail: khangdd.ibt@gmail.com Received: 01.11.2021 Accepted: 21.01.2022 SUMMARY The attenuated porcine reproductive and respiratory syndrome virus (PRRSV) strain Hanvetl was developed by Hanvet Pharmaceutical Co., Ltd by inoculating the vimlent strain 02HYon Marc145 cells for 80 generations and used to produce PRRS vaccine In this study, we published the results o f sequencing, analyzing and comparing the genome o f the attenuated PRRSV strain Hanvetl.vn compared with the original pathogenic strain 02HY The genomes o f strains Hanvetl.vn and 02HY have reading frames, coding for non-structural and structural proteins: N SPla, N SPlb, GP2, GP3, GP4, GP5, MP, NP After sequencing and translating into proteins, the gene sequence o f each open reading trame (ORF) o f strain Hanvetl.vn was compared with the sequence o f pathogenic strain 02HY to tĩnd nucleotide and amino acid changes The results showed that the Hanvetl pathogenic strain genome (Genbank Accession KU842720) when compared with the pathogenìc strain 02HY genome (Submission2490633) had89 nucleotide mutations that changed 51 amino acids in ORFs and proteins, respectively Particularly, ORF6 encoding for the M protein is completely unchanged The size o f each reading trame is also exactly the same It showed that there were no insertion and deletion (Indel) mutations in the ORFs o f the attenuated strain after 80 generations o f inoculation There was a change in the genome that made the sừain Hanvetl.vn become attenuated, but the gene encoding for the GP5 protein that induces the production o f neutralizing antibodies only changed two nucleotides at position 471 (A->G), causing the TCA codon to tum into a TCG codon This is a silent mutation and both codons code for the amino acid Serine (S) The second mutation at position 587 (A->T) causes Glutamine (Q) to transíorm into Leucine (L) However, this modiíĩcation does not belong to the GP5 antigenic epitopes In clonclusion, after 80 passages, despite changes occurred in genes o f Hanvetl.vn strain for becoming an attenuated strain, the GP5 protein o f the attenuated strain did not change its antigenic amino acids Keywords: Hanvetl.vn attenuated strain, 02HY virulent steain, genome sequence, nucleotide and amino acid changes, GP5 antigen epitope 245 Nguyên Thi Nga et al INTRODUCTION Porcine Respiratory and Reproductive Syndrome (PRRS) is a contagious disease in pigs of all ages The disease caused by PRRSV has a complicated course, difficult to control, and witha high morbidity rate The emergence of highly virulent PRRSV sừains in China in 20062007 caused a series of PRRSV outbreaks in Asia (Tian et ai; 2007) The PRRS epidemic has killed millions of pigs since 2006 (Zhou, Yang, 2010) Highly pathogenic strains of PRRSV have also caused outbreaks in other countries in the Asian region The íírst case o f PRRS appeared in Vietnam in early 2007 (Feng et al; 2008; Metwallyet al; 2010) then spread to other Southeast Asian countries such as Laos, Philippines, Cambodia etc (Jantafongeí ai; 2010; Ni et al; 2012; Tomimbeneeí al; 2015) In Vietnam, from 2007 untilnow, PRRS has occurred in many provinces and cities throughout the country, causing heavy losses to the livestock industry (Pham Van Son, 2018) There have been many vaccines produced for disease prevention, including the attenuated PRRS vaccine that is being prioritized for development and use in China and Vietnam because of its superior protection compared to other kinds of vaccines In Vietnam, in order to prevent diseases, many integrated measures have been directed by the Ministry of Agriculture and Rural Development, in which the use of vaccines is the top priority There were two strains to be attenuated for the use as vaccines including the attenuated PRRSV strain Hanvetl.vn by the Hanvet Pharmaceutical Company Limited and the KTYPRRS-06 strain by the Vietnam National University of Agriculture (Trinh DinhThaue? al; 2018), respectively The attenuated PRRSV strain Hanvetl.vn used in the production of PRRS vaccine by the Hanvet Pharmaceutical Company Limited was created by 80 generations of continuous subculture on Marc-145 cells In this paper, we present the results of sequencing, analysis and comparison of changes in the genome betvveenthe attenuated virus strain 246 Hanvetl.vn and the original pathogenic strain 02HY in order to evaluate the genetic changes related to the virulence and immunogenicity of the vaccine MATERIALS AND METHODS Materials The attenuated vaccine strain Hanvetl.vn and the virulent strain 02HY are provided by Hanvet Pharmaceutical Company Limited cDNA synthesis kit: SuperSciptTM FirstStrDNA Synthesis System for RT-PCR (Invitrogen) Cloning Kit: TA cloning Kit (Invitrogen) Gene sequencing kit: BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) High purity Chemicals used in molecular biology research are provided by companies such as Sigma, Merck, Invitrogen, include: Taq DNA polymerase, Yeast extract, Tryptone, Agar, Amp (Ampicillin), X-gal, EDTA (Ethylenediaminetetraacetic acid), SDS (Sodium dodecyl sulphate), Chlorịrm, Trizol, Sodium acetate, Ethanol, NaCl, Tris-HCl, NaOH, TAE (Tris-Acetic acidEthylenediaminetetraacetic acid) Methods Genetic sequences of North American PRRSV genotypes circulating in Vietnam and the region with numbers FJ393456, FJ393457, FJ393458, FJ393459, FJ394029 and attenuated vaccine strain RespPRRS were used to design primer pairs to amplity the whole genomes of Hanvetl.vn and 02HY viruses Using GeneDoc 2.7 software to compare and design primer pairs for gene amplitìcation Ampliíication and cloning of 15 gene segments belonging to the attenuated strain Hanvetl.vn and pathogenic strain 02HY were caưied out as described previously (Nguyên Thi Nga et al; 2018) The sequencing reaction of clones was períbrmed using the BigDye™ Terminator v3.1 Cycle Sequencing Kit from Applied Biosystems, using two forward and reverse primers M13F and M13R Automated sequencing on the ABI 3100 System and Vietnam Journal o f Biotechnology 20(2): 245-252, 2022 sequence analysis using BioEdit and DNA Star software were carried out Comparison of ORFs and proteins for mutations was períịrmed by the PC/Gene software program Protein epitopes were analyzed using the Predicting Antigenic Peptides software ịhttp://imed.med ucm es/Tools/antigenic.pl) RESULTS AND DISCUSSION RESULTS Ampliíication and cloning of genesegments of the PRRSV genome After extraction of total RNA ữom infected viral fluid of the Marc-145 cells, RNA was converted to cDNA using Invitrogen's SuperSciptTMFirst-StrDNA Synthesis kit cDNA was used as template strand to ampliíy gene segments of PRRSV attenuated Hanvetl.vn and virulent strain 02HY by PCR with 15 speciíic primer pairs designed so that the ampliííed gene íragments have verlapping regions for easily reassembled into a complete genome To facilitate the storage and sequencing of genes, after purification, the PCR Products were ligated to pCR2.1 cloning vector, transformed into E coli cells with Top F' strain The recombinant plasmids cariying amplifíed gene ữagments from the PRRSV genome were screened and examined by cutting with the restriction enzyme EcoBl The gene fragment from the recombinant plasmid was separated from the vector with the same size as the PCR product ligated to the cloning vector (Nguyên Thi Nga et al., 2018) Sequencing and analyzing the genome of the attenuated strain H anvetl.vn and the pathogenic strain 02HY Recombinant plasmidsinserted with PCR Products were puriTied and sequenced using an automated gene sequencer (ABI 3100) The resulting data were processed and analyzed using DNAStar and GeneDoc software After sequencing, assembly and annotation, we obtained the attenuated Hanvetl genome with reading frames, encoding for proteins (GenBank accession number: KU842720) Similarly, strain 02FIY also has reading frames, coding for proteins (Submission: 2490633) The length of each reading írame of the attenuated strain ITanvetl.vn iscompletely unchanged compared to the original pathogenic strain 02HY The number o f nucleotides and amino acids of each reading írame of the attenuated strain Hanvetl.vn and pathogenic strain 02HY are shown in Table The results in Table showed that there were no deletion and insertion (Indel) mutations in the open reading frames of strain Hanvetl.vn after 80 generations of inoculation Table Number of nucleotides and amino acids of each reading trame of the attenuated strain Hanvetl and the virulent parent strain 02HY Number of nucleotides in each ORF Number of amino acids in each protein ORF1a ORF1b ORF2 ORF3 ORF4 ORF5 ORF6 ORF7 Hanvetl 7418 4377 768 765 534 600 522 372 02HY 7418 4377 768 765 534 600 522 372 NSP1a NSP1b GP2 GP3 GP4 GP5 MP NP 2473 1459 256 254 178 200 174 123 2473 1459 256 254 178 200 174 123 Hanvetl 02HY Genomic changes in the H anvetl.vn strain compared with pathogenic 02HY strain The changes in nucleotide sequences and amino acid sequences in each ORF/protein of the attenuated strains of Hanvetl.vn compared to its virulent strain 02HY are shown in Tables and 3, respectively 247 Nguyên Thi Nga et aỉ The attenuated strain Hanvetl.vn had 89 point mutations in all reading írames that made the changes in 51 amino acids Among 89 pointmutations there were missense mutations (leading to change of amino acid they encode for) and silent mutations (no change of amino acid) as seen in the attenuated strain Hanvetl.vn >T) had made a change from Glutamine (Q) to Leucine (L) (Figs and 2) Table shows epitope amino acids in the epitopicstrecht in the GP5 polypeptide of the attenuated Hanvetl.vn sừain The amino acid change at position 196 (L196Q) occuưed in this attenuated strain was outside the GP5 antigen epitope region (Table 4) Thus, it can be concluded, after 80 passages, although the genes of Hanvetl.vn strain have some changes to become attenuated compared to the pathogenic 02HY strain during the attenuation, butthe GP5 epitope amino acids responsible for the production of neutralizing antibodies were not aữected No nonsense mutations causing stop codons were found ORF5 encoding for the GP5 protein containing neutralizing antibody-producing epitopes had two-nucleotide changes at position 471 (A->G) and 587 (A->T) The change o f TCA to TCG (A->G) is a silent mutation causing no change of amino acid Serine (S) The muation(AHA M V _O K F5_N ÂTGTTGGGGAAGTGCTTGACCGCGTGCTGTTGCTCGCGATTGCTTTTTTT ™5Q I Mu I n u m m 11! I u m 1MH 11 m i MM I i n MH n I 02H Y _O R F5_N ATG TTGGGG AAGTG CTTG ACCGCGTG CTG TTGCTCGCG ATTGCTTTTTTT -5 11ANV_0RI-'S_N G T G G T G T A T C G T G C C G T ĨC T À T C T T G C T G T G C T C G rC A A C G C C A G C G A C A -1 0 I u 11 u M í m m M I i I n 111 ũ!Ií n I m H 1 ! ị I ỉ I i 11 K Y 0RF5 N G 7G G TG TA TC G TG C C G TTC TA TC TTG C TG TG C TC G TC A A C G C C A G C G A C A -iồo HANV’ DRF5 N A C A A C A G C T C rC A T A T T C A G T T G A T tT A T A A C T T G A C G C T A T G T G A G C T G “ 150 ! i : u M u III ĩ 1i 11111 m 11 h 111m m n u III i 1111II 02KY_O RF$_N A C A A C A G C T C T C A T A T C A G T T G A T T T A T A A C T T G A C G C T A T G T G A G C T G -1 HAMV_ORF5_N Ằ A T G G C A C A G À T T G G C T G G C A C A A A À T T T T G A C T G G G C Ằ G rG G A ữ A C T T T -2 0 u u I M u I M M lí u i ỉ u u m M I I I M H! II IM M H i 11 Ũ2HY_ORF5_N AATGGCACAGATTGGCTGGCACAAAATTTTGAỦTGGGCAGTGGAGACTTT -2 0 ORF5 N TG 7C A TC TTC C CC G TG TTG A C TC A CA TTG TTTC C TA TG O G G C A C TCA CC A -2 HAM V 1I i I i H I ! ỉ í H H I H m I M I 1! M I MM ỉ m Mm Ị i I 1í ị ! Ũ2HYjORFS N rG T C A T C T T C C C C G T G T T G A C T C A C A T T G T T T C C T A T G G G G C A C T C A C C A -2 HAHV_0RF5_N C C A G C C A 7T T C C T T G A C A C A G T T G 6T C T G G C C A C T G T G T C C A C C G C C G G A -3 0 m i u u II m i I i m I m u Mi m n u i m M1 H M1 M í Q2KY_ORF5_N C G A G C C A T T T C C T T G A C A C A G T T G G rC T G G C C A C T G T G T C C A C C S C C G G A -3 0 ỈỈA&IV_jDRF5 N tA T T A T C A C G Ổ G C G G T A T G T C T T G A G T A G C A T T T A C G C A Ổ T C tG T G C T C T -3 H u i I MMI i i ỉ ! H 1IM H I II H MI III II í M 1I n Mm u 2KY_QRF5_N rA T T A rC A C G G G C G G T A T G T C T T G A G T A G C A T T T A C G C A G rC T G T G C T C T -3 HAM^/I(0 R F N GGCTGCGCTGA TTTGCTTTGTCATTAGGCTTGCGAÃGAACTGCATGTCCT -4 00 02 KY ORF$ N G G C T G C G C T G A T T T G C T rrG T C A T T A G G C T T G C G M G A A C rG C A T G T C C T “ 400 G G C G C rA C T C T T G T A C C A G Ằ ĨẪ T A C C A A C T rC C T T C T G G A C A C T A A G G G C -4 m u m i MI 1m m m HAHV_0RF5_N - 11III m ! M 1111 Mm Ị í m 11 Hì m 11 m ĩ u MH m IIM u u M u m m Mì u n li M Ũ2HY_ORF5Jf - G G C G C T A C T C T T G T A C C Ầ G A T A Ĩ A C C A A C T r C C T T C T G G A C A C l 'A A G G G C -4 471 H A W _O R F5_N - A G A C T C T A T C e T T G G C G G T C G C C C G rC A T T G T G G A G A A A A G G G G T A A G G T I Ũ 2K Y O R f5 _ N HANV J3 R F N I M M ! I ị M 1i M í M I Ị I 1I í M I M I I1 M m M IM “ 500 11 M M I - AGACTCTATCGTTGGCGGTCACCCGTCATTGTGGA GAAAA GGGG TAAGG t -5 0 - TGA GGTCGAAG GTCACCTGATCGACCTCAẴGAGẰGTTGTGCTTGATGGTT -5 m Mỉ I M I I I M II 11 ỉ I II M MH MI I MI M MMI Mn MM 02HYJDRF6_N - T G A G G T C G A A G G T C A C C T G A T C G A C C T C M G A G A G rT G T G C T T G A T G G T T ~55p “ CCG CG GCA ACCCCTTTAACCAGAGTTTCAGCGGAACTATGGGGTCGTCTC ~< S ũQ - C C G C G G C A A C C C C T T T A A C C A G A G T rT C A G C G G M C A A T G G G G T C G T C T C sạ? IH MH m m MIM i MM Mm M! M MI I M1I II I III M 02B Y ORF5 N -ê ũ O Figure Comparison of the nucleotide sequence of the ORF5 gene of the attenuated strain Hanvetl with that of the 02HY strain The attenuated strain Hanvetl.vn appeared with point mutations at positions 471 and 587 248 Vietnam Journal o f Biotechnology 20(2): 245-252, 2022 Table Number of nucleotides and amino acids changed in each ORF of the Hanvetl attenuated strain compared with the 02HY pathogenic parent strain Number of nucleotides chanaes in each Q ppa ORF1a ORF1b ORF2 ORF3 ORF4 ORF5 ORF6 ORF7 Total - Number of amino acids changes in each protein NSP1a NSP1b GP2 GP3 GP4 GP5 MP NP Total 25 11 1 51 45 23 4 2 8g Table Identilý of nucleotide and amino acid sequences of hlanvetlvn attenuated strain compared with 02HY pathogenic strain Nucleotideidentity in the two strains ORF1a ORF1b ORF2 ORF3 ORF4 ORF5 ORF6 ORF7 99.39 99.47 98.83 99.48 99.26 99.67 100.00 99.46 Amino acid identity NSP1a NSP1b GP2 GP3 GP4 GP5 MP NP in the two strains 98.99 99.25 97.66 98.82 97.75 99.50 100.00 99.19 HÃNV_ORF5_ P - MLGK'CLTftCCCSRI,I,FI,WCI¥PFYI,AVLV|.lASDIWSSHIQlIYWI.'rLCEI, - m 1111 i l i 11) 11111 m 11 í M I I 1111 m I M í ? I I I i í I I I 11 HY_ORF5_P - MLGKCLTACCCsRLLFLWCIVPFYXiAVLVNASDI® s tí l ũ l l ĩĩỉiTLC EIi - HANV_ORF5_P - NG) causing the TCA codon to tum into TCG This is a silent mutation and both codons code for the amino acid Serine (S) The mutation at position 587 (A>T) causes Glutamine (Q) to tum into Leucine (L) However, this modiíication does not belong to the GP5 antigenic epitopes Thus, it can be said that, after 80 passages in Marc-145 cell line, 250 although the genes of strain Hanvetl.vn have changed to become an attenuated strain, the gene encoding GP5 protein has not change the immunogenicity - GP5 is an essential protein playing an important role in stimulating the immune response to generate PRRSVneutralizing antibodies (Popescu et al., 2017) Therịre, the conservation of the antigenicity of the GP5 protein the attenuated strain Hanvetl.vn compared with the original pathogenic strain 02HY is decisive for the eíĩectiveness of the vaccine In addition to the attenuated strain generated by the Hanvet Pharmaceutical Company Limited, the another attenuated strain named KTY-PRRS-06 has also been recently succeeded by the Vietnam National University of Agriculture using the serial passages for 90 generations on Marc-145 cell line The attenuated strain causes cytophathic effect (CPE) 12 hours aíter iníection and completely damage the cells after 48 hours The attenuated strain KTY-PRRS-06 is not pathogenic when administered to pigs and induces a speciíĩc antibody response against PRRSV The authors compared the ORF5 sequence of the attenuated strain KTY-PRRS-06 with the pathogenic strain and found 13 different positions in the nucleotide sequence and different positions in the amino acid sequence (Trinh DinhThaueí al., 2018) Thus, the attenuated strain KTY-PRRS-06 after 90 generations of inoculation on the Marc-145 cells appeared more point mutations than the attenuated strain Hanvetl.vn In the work by Trinh DinhThau et al (2018), the authors did not analyze each mutation in the ORF5 gene and did not clariíy whether these mutations affect the ability to produce PRRSV-neutralizing antibodies belonging to the epitopes Allende et al., 2000 sequenced and analyzed the variation in the genome of the attenuated RespPRRS strain used in PRRS vaccine production and compared with the virulent parent strain 16244B The attenuated strain RespPRRS was created by subculture of 25 generations on MA-104 cells at 35-37°C, then 20 generations in the same cell line but at l°c The Vietnam Journal o f Biotechnology 20(2): 245-252, 2022 results shovved that there were no Indel mutations in the genome and discovered 212 point mutations in the whole genome Thus, through 55 generations of inoculation on M A-104 cells vvith 25 generations at 35-37°C and 20 generations at ° c , the authors created an attenuated strain with a higher number of point mutations compared with our study (212 mutations compared with 89 mutations in our study) The authors also identiíĩed the changes of amino acids located on proteins N spip, Nsp2, NsplO, ORF2, ORF3, ORF5, ORF6 and suggested that the modiíications of these amino acids may provide the molecular bases for the observed attenuated phenotype CONCLUSSION In this study, the genome of the attenuated PRRSV sừain Hanvetl.vn was sequenced, analyzed and compared with the genome of the parental pathogenic strain 02HY to find out the eenetic variation of the attenuated strain Hanvetl.vn after passages onMarc-145 cells The results showed that the genomes of strains Hanvetl.vn and 02HY have reading írames, coding for non-structural and structural proteins: NSPla, NSPlb, GP2, GP3, GP4, GP5, MP, NP After sequencing and translating into proteins, the gene sequence of each open reading frame (ORF) of strain Hanvetl was compared with the sequence o f pathogenic strain 02HY to find nucleotide and amino acid changes The results showed that, after 80 generations of inoculation, in the genome o f strain Hanvetl.vn, there were 89 nucleotide mutations that changed 51 amino acids in seven open reading írames and seven proteins respectively Remarkably, ORF6 encoding for the M protein is completely unchanged The size of each reading frame is also exactly the same It showed that there were no insertion and deletion (Indel) mutations in the open reading frames (ORFs) of the attenuated strain aíter 80 generations of inoculation There was a change in the genome that made the strain Hanvetl.vn become attenuated, but the gene encoding the GP5 protein that induces the production of the neutralizing antibodies only changed two nucleotides at position 471 (A>G)is a silent mutation causing no change in amino acid Serine (S) The mutation at position 587 (A->T) changed Glutamine (Q) to Leucine (L), but this Leucine amino acid change is outside of the GP5 antigenic epitopes It is concluded, after 80 passages, the Hanvetl.vn strain have changed at some sites compared to the pathogenic strain to become an attenuated strain, but the gene encoding GP5 protein responsible for production of the neutralizing antibodies has not been altered Acknowledgments: The work was carried out with ịìnanciaỉ support within the framework o f the research project o f the Institute o f Bỉotechnoỉogy, Vietnam Academy o f Science and Technology REFERENCES Allende R, Kutish GF, LaegreidW, LuZ, Lewis TL, Rock DL, FriesenJ, Galeota JA, Doster AR, Osorio FA (2000)Mutations in the genome o f porcine reproductive and respiratory syndrome virus responsible for the attenuation phenotype Arch G'ro/145:l 149-1161 Feng Y, Zhao T, Nguyên T, Inui K, Ma Y, Nguyên TH, Nguyên v c , Liu D ,B u i QA, To LT,Wang c , Tian K, Gao GF (2008) Porcine reproductive and respiratory syndrome virus variants, Vietnam and China, 2007 Emerg Infect Dis 14:1774-1776 Jantafong T, Sangtong p, Saenglub w , Mungkundar c , Romlamduan N, Lekchareonsuk c , Lekcharoensuk p (2015) Genetic diversity o f porcine reproductive and respiratory syndrome virus in Thailand and Southeast Asia from 2008 to 2013 VetMicrobioỉnô: 229-238 Metvvally s, Mohamed F, Faaberg K, Burrage T, Prarat M, Moran K, Bracht A, Mayr G, Beminger M, Koster L, To TL, Nguyên VL, Reising M, Landgraf J, Cox Lubroth J, Carrillo c (2010) Pathogenicity and molecular characterization o f emerging porcine reproductive and respiratory syndrome viras in Vietnam in 2007 TransboundEmerg Dis 57: 315329 251 Nguyên Thi Nga et al Nguyên TN, Ha TT, Nguyên TH, Vu TH, Tran Thi TH, Tran VK, Nguyên TB, Nguyên HV, Dong VQ, To LT, Dinh DK (2018) Sequencing and analysis for complete genome o f attenuated Hanvetl strain use for vaccine production against porcine reproductive and respiratory syndrome Vieừiam JBiotech 16: 51-57 Trinh DT, Nguyên TL, Nguyên BH, Nguyên HN, Le Huynh TP, Nguyên VT, Nguyên VT, Pham NT, Pham HN, Huynh Thi ML, Nguyên TH (2018) Study on attenuated porcine reproductive and respiratory syndrome virus from highly pathogenic virus strain J ofVet Sci25: 5-16 N i J, Yang s, Bounlom D, Yu X, Zhou z, Song J, Khamphouth V, Vatthana T, Tian K (2012) Emergence and pathogenicity o f highly pathogenic Porcinereproductive and respiratory syndrome virus in Vientiane, Lao People's Democratic Republic J Vet Diagn Invest 24: 349-354 Tian K, Yu X, Zhao T, Leng Y, Cao z , Wang c, Hu Y, Chen X, Hu D, Tian X, Liu D, Zhang s, Deng X, Ding Y, Yang L, Zhang Y, Xiao H, Qiao M, Wang B, Hou L, Wang X, Yang X, Kang L, Sun M, Jin p, Wang s, Kitamura Y, Yan J, Gao GL (2007) Emergence o f fatal PRRSV variants: unparalleled outbreaks o f atypical PRRS in China and molecular dissection o f the unique hallmark PLoS One 2:e526 Popescu LN, Trible BR, Chen N, RowlandRR (2017) GP5 o f porcine reproductive and respiratory syndrome virus (PRRSV) as a target for homologous and broadly neutralizing antibodies Vet Microbiol 209:90-96 Pham v s (2018) Research on creating master seed virus and trial production o f inactivated vaccines against reproductive and respiratory syndrome in pigs from virus isolates in Vietnam PhD dissertation Vietnam National University o f Agriculture 252 Tomimbene B, Lrossard JP, Chhim V, Som s, Guitian J, Drew TW (2015) Emergence o f highly pathogenic porcine reproductive and respiratory syndrome (HPPRRS) in medium-scale swine farms in southeastem Cambodia Prev VetMed 118: 93-103 Zhou L, Yang H (2010) Porcine reproductive and respiratory syndrome in China Virua Res 154: 31-37 ... Comparison of the nucleotide sequence of the ORF5 gene of the attenuated strain Hanvetl with that of the 02HY strain The attenuated strain Hanvetl .vn appeared with point mutations at positions 471 and. .. results of sequencing, analysis and comparison of changes in the genome betvveenthe attenuated virus strain 246 Hanvetl .vn and the original pathogenic strain 02HY in order to evaluate the genetic changes. .. Hanvetl 02HY Genomic changes in the H anvetl .vn strain compared with pathogenic 02HY strain The changes in nucleotide sequences and amino acid sequences in each ORF/protein of the attenuated strains
Ngày đăng: 26/12/2022, 23:25
Xem thêm: