Báo cáo khoa học: Actin mutations in hypertrophic and dilated cardiomyopathy cause inefficient protein folding and perturbed filament formation pdf

Actin mutations in hypertrophic and dilated cardiomyopathy cause inefficient protein folding and perturbed filament formation Søren Vang 1 , Thomas J. Corydon 2 , Anders D. Børglum 2 , Melissa D. Scott 3 , Judith Frydman 3 , Jens Mogensen 4 , Niels Gregersen 1 and Peter Bross 1 1 Research Unit for Molecular Medicine, Aarhus University Hospital and Faculty of Health Sciences, Denmark 2 Institute of Human Genetics, University of Aarhus, Denmark 3 Department of Biological Sciences and BioX Program, Stanford University, CA, USA 4 Department of Cardiology, Aarhus University Hospital, Denmark Hypertrophic cardiomyopathy (HCM) is inherited by autosomal dominant transmission with a prevalence of approximately 1 : 500. The condition is defined by the presence of unexplained myocardial hypertrophy and myocardial histology is characterized by myocyte dis- array [1]. HCM may be caused by missense mutations in any one of eight known sarcomeric genes. These genes encode proteins of the cardiac sarcomere, com- ponents of thick and thin filaments with contractile, structural or regulatory functions (thick filament: MYH7, MYL3, MYL2, MYBPC3; thin filament: ACTC, TNNT2, TNNI3, TPM1 [2]). It has been hypo- thesized that the mutant protein (poisonous peptide) causes a dominant negative inhibition of the protein produced from the normal allele, impairing the sarco- meric contractile performance [3]. This is thought to eventually lead to a compensatory hypertrophy of the heart [4]. A few mutations in the MYBPC3 gene are believed to give rise to haplo-insufficiency [5]. Dilated cardiomyopathy (DCM) is the most com- mon cause of heart failure and cardiac transplantation in the young. DCM is usually transmitted in a domin- Keywords a-cardiac actin; chaperone; dilated cardiomyopathy; hypertrophic cardiomyopathy; protein folding Correspondence S. Vang, Research Unit for Molecular Medicine, Aarhus University Hospital, Skejby Sygehus, Brendstrupgaardsvej, DK-8200 A ˚ rhus N, Denmark Fax: +45 89496018 Tel: +45 89495150 E-mail: vang@ki.au.dk (Received 12 January 2005, revised 24 February 2005, accepted 25 February 2005) doi:10.1111/j.1742-4658.2005.04630.x Hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) are the most common hereditary cardiac conditions. Both are frequent causes of sudden death and are often associated with an adverse disease course. Alpha-cardiac actin is one of the disease genes where different mis- sense mutations have been found to cause either HCM or DCM. We have tested the hypothesis that the protein-folding pathway plays a role in dis- ease development for two actin variants associated with DCM and six asso- ciated with HCM. Based on a cell-free coupled translation assay the actin variants could be graded by their tendency to associate with the chaperonin TCP-1 ring complex ⁄ chaperonin containing TCP-1 (TRiC ⁄ CCT) as well as their propensity to acquire their native conformation. Some variant pro- teins are completely stalled in a complex with TRiC and fail to fold into mature globular actin and some appear to fold as efficiently as the wild- type protein. A fraction of the translated polypeptide became ubiquitinated and detergent insoluble. Variant actin proteins overexpressed in mamma- lian cell lines fail to incorporate into actin filaments in a manner correla- ting with the degree of misfolding observed in the cell-free assay; ranging from incorporation comparable to wild-type actin to little or no incorpor- ation. We propose that effects of mutations on folding and fiber assembly may play a role in the molecular disease mechanism. Abbreviations ACTC, a-cardiac actin gene; CCT, chaperonin containing TCP-1; DCM, dilated cardiomyopathy; DMSO, dimethylsulfoxide; HCM, hypertrophic cardiomyopathy; TRiC, TCP-1 ring complex; VLCAD, very-long chain acyl-CoA dehydrogenase. FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2037 ant fashion; however, recessive, X-linked and mito- chondrial inheritances have also been reported. More than 20 disease genes have been reported so far, enco- ding a wide variety of proteins expressed in cardiac myocytes [6]. Recently DCM mutations in several sar- comeric genes have been identified [2]. The a-cardiac actin gene (ACTC) was the first gene identified to harbor both HCM and DCM mutations, with six mutations leading to HCM and two mutations leading to DCM (Fig. 1) [7–10]. Based on both the clinical findings in the patients carrying the different actin mutations and the putative protein–protein inter- actions deduced from the X-ray structures, the pre- vailing hypothesis proposes that while actin mutant variants are incorporated into thin filaments in both cases, in HCM an altered structure of the region inter- acting with myosin impairs force generation, whereas in DCM disturbance of the interactions with proteins of the Z-disk impair force transmission from the sarco- mere to the surrounding syncytium [7,9,11]. Clinical diversity or ‘phenotypic heterogeneity’ is a hallmark of HCM and implies that factors other than the underlying major gene defect modify the impact of the mutant gene at the cellular and clinical level. An increasing interest in the modulating factors that result in the lack of correlation between genotype and pheno- type has evolved in recent years [12,13]. These modify- ing factors may be genetic, in which case a second gene may regulate the expression of the primary defect differently in different patients. The variation may also be due to environmental factors such as age, diet, exer- cise, pharmaceutical agents and the efficiency of the cellular protein folding machinery. The protein folding machinery of the cell is known to respond to cellular stress and changes in physico- chemical conditions [14]. The mechanism by which chaperones influence other cellular processes include increasing de novo folding efficiency, assisting refold- ing of proteins denatured by stress, and modulating the balance between folding and degradation of mis- folded proteins [15,16]. It is the quality control func- tion of chaperones that we are most interested in, because molecular chaperones and proteases may act in conjunction to determine the fate of the variant protein [17–19]. Three pathological scenarios can be pictured. Firstly, decreasing the negative dominance of a poisonous peptide, thereby suppressing the sever- ity of the disease; secondly, complete or nearly complete degradation of the mutant allele product resulting in haploinsufficiency as the disease mechan- ism; and thirdly, the inability to eliminate misfolded proteins leading to accumulation of cell toxic aggre- gates. In all three cases degradation and folding path- ways of the gene products are likely to be important factors. Studies from several groups indicate that multiple chaperone complexes work to assist the folding of actin [20–23]. During actin synthesis, prefoldin binds and stabilizes the incompletely folded nascent polypep- tide and releases it for further folding to the cytosolic chaperonin, referred to as TCP-1 ring complex (TRiC) or chaperonin containing TCP-1 (CCT). It has previ- ously been shown that variations in a-skeletal actin impair folding and polymerization [24], and that actin variants that are unable to fold are degraded by the ubiquitin-proteasome pathway [20]. This study has investigated the folding and stability of variant a-cardiac actins leading to HCM and DCM. Using a cell-free system of coupled in vitro transcrip- tion ⁄ translation, we have studied the folding of the actin variant proteins and their different interaction affinities for chaperones. We have also used immunostaining and confocal laser scanning microscopy of transfected cells to study the ability of the variant actin protein to incor- porate into filaments in the cytoskeleton. Results Some mutant actin proteins display perturbed interaction kinetics with the TRiC chaperonin leading to delayed folding The folding pathway of wild-type and mutant actin polypeptides was studied using a cell-free transcrip- Met 305 Arg 312 Ala 331 Ala 295 Pro 164 Glu 361 Glu 99 Tyr 166 Fig. 1. Missense variations in the actin structure. Ribbon represen- tation of the actin monomer based on the crystal structure of rabbit b-actin (PDB accession number 1ATN). The residues mutated in HCM are colored in blue and the residues mutated in DCM are white. Figure prepared with the MOLMOL program [44]. Amino acid substitutions shown in bold lead to DCM. Misfolding of actin variants in cardiomyopathies S. Vang et al. 2038 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS tion ⁄ translation system. Full length wild-type actin and eight variant actin cDNA constructs containing disease-causing mutations were transcribed and trans- lated in the presence of [ 35 S]methionine at 37 °C (Table 1). Samples were taken at different time points up to 60 min and analyzed by both SDS ⁄ PAGE and native PAGE. Separation by SDS ⁄ PAGE and visual- ization by phosphorimaging showed a single band of 42 kDa with similar intensity for all actin variants, indicating homogeneous production of the nascent polypeptide for all constructs (not shown). In this and other experiments, we observed the transcription ⁄ translation system to have a maximum activity at t ¼ 0–20 min. In the initial experiment cDNAs encoding Rattus norvegicus wild-type, human wild-type, six HCM-caus- ing, and two DCM-causing a-cardiac actin mutations were expressed (Fig. 1). The rat actin has the same sequence at the protein level but minor changes at the DNA level, and thereby served as an alternative wild- type control. The native PAGE analysis showed that the actin polypeptides are mainly found in three com- plexes: one distinct band with slow mobility, a fainter band with intermediate mobility, and a diffuse, rapidly migrating band (Fig. 2A). This pattern of complex for- mation over time varied between wild-type and mutant actin polypeptides. Of all the mutants, the Arg312His actin had the largest percentage of the protein retained in the slowly migrating complex. This retention did not reduce over time, as seen for wild-type actin as a consequence of the reduced protein production rate. Furthermore, the rapidly migrating smear was almost absent in samples containing Arg312His actin. This phenomenon was temperature sensitive and less pro- nounced at 30 °C (not shown) than at 37 °C, a trait often seen with proteins with a defective folding path- way [25]. Previous studies have shown that the TRiC chapero- nin binds actin in a high molecular mass complex, and is involved in its biogenesis [21,22]. The slowly migra- ting band was shown through immunoblotting of native PAGE gels to comigrate with the TCP-1 subunit of TRiC (Fig. 2B, left). Additionally, anti-(TCP-1) IgG was able to immunoprecipitate actin from reticulocyte lysate reactions in contrast to a negative control anti- body raised against very-long chain acyl-CoA dehy- drogenase (VLCAD) (Fig. 2B, right). The reticulocyte extracts contain a large amount of hemoglobin, which forms nonspecific interactions with radioactive material and migrates as the intermediate band (Fig. 2C,D). The broad, rapidly migrating smear corresponds to the folded actin monomer. This was confirmed upon addi- tion of 2 lg DNase I to a pulse-chase reaction of wild- type actin, followed by analysis of the mobility shift of this band by native PAGE and radiography (Fig. 2C). DNase I binds the actin monomer and condenses the smear to a distinct band of characteristic mobility. The smear was totally absent in the Arg312His actin lanes and therefore no actin–DNase I band appeared after addition of DNase I (not shown). Phosphorimager scanning of the TRiC band as a fraction of the whole lane in Fig. 2A gave a measure of the percentage of actin bound to TRiC at different time points. This shows the Arg312His and Glu99Lys variant proteins to have a sevenfold and threefold increased relative amount of actin–TRiC complex, respectively, when compared to wild-type after 60 min of translation at 37 °C (not shown). The results indicate that these mutant proteins have diffi- culty folding to assume their native form and remain TRiC-bound. Actin molecules that fail to reach a native state upon release from TRiC may rebind for a second round of folding, possibly by interaction with other chaperones as a transitional transferring step [20,26]. Pulse-chase labeling experiments with initial biosyn- thesis of [ 35 S]actin at 37 °C for 30 min and subse- quent termination of translation with cycloheximide emphasized the difference in the folding kinetics between wild-type and the Arg312His variant Table 1. Primers used for the mutagenesis of the a-cardiac actin (ACTC) gene. The mutated bases are highlighted in bold. Mutation Oligonucleotide Phenotype Reference Glu99Lys CTCCGTGTTGCTCCC AAGGAGCACCCCACCCTG HCM [10] Pro164Ala GTAACTCACAATGTC GCCATCTATGAGGGCTAC HCM [10] Tyr166Cys CAATGTCCCCATCT GCGAGGGCTACGCTTTGC HCM [8] Ala295Ser CGCAAGGACCTGTAT TCCAACAATGTCTTATC HCM [7] Met305Leu CTGGAGGCACCACT CTGTACCCTGGTATTGC HCM [8] Ala331Pro GATTAAGATTATT CCCCCCCCTGAGCGTAAATAC HCM [10] Arg312His CTGGTATTGCTGATC ACATGCAGAAGGAAATC DCM [9] Glu361Gly GTGGATTAGCAAGCAAG GCTACGATGAGGCAGG DCM [9] S. Vang et al. Misfolding of actin variants in cardiomyopathies FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2039 (Fig. 2D). Reticulocyte lysate contains 20 lm hemin, which is required for translation initiation in this sys- tem. Hemin has inhibitory effects on the ubiquitin- proteasome degradation system [27] and was therefore removed by a desalting step prior to the chase period to asses the proteolytic capabilities of the extract. Samples were taken at different time points and transferred to native loading buffer in the presence of EDTA to inhibit the TRiC ATPase, and kept on ice until separation by native PAGE. At t ¼ 0 after the protein synthesis termination, the ratio between TRiC-bound actin and monomeric actin is approxi- Wild Type Rat Wild type Glu99Lys Met305Leu Ala331Pro Ala295Ser Arg312His Tyr166Cys Pro164Ala Glu361Gly TRiC Hb N-actin 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 A P TRiC VLCAD IP SPS TRiC RIB B Wild Type Arg312His 0 TRiC N-actin 1 80 120 90 60 120 90 60 30 15 2 40 30 15 0 240 18 0 D C Hb * Min. Min. Wild Type N-actin Actin-DNaseI complex Hb 024024 Hours +++ 2µg DNase I Fig. 2. Some actin mutations have reduced folding efficiency and prolonged chaperone interaction. In vitro protein biosynthesis carried out using coupled transcription ⁄ translation systems. Wild-type and mutant full length cDNA in the pcDNA3.1 vector and radioactive labeling was performed using 10 lCi ÆlL )1 [ 35 S]methionine. (A) The transcription ⁄ translation reactions were incubated at 37 °C and put on ice in a native loading buffer containing 5 m M EDTA at the times indicated, until separation by native PAGE on 4–15% gel and visualization by radiography. (B) Following in vitro translation of wild-type cDNA for 30 min protein synthesis was stopped with cycloheximide at a final concentration of 150 lgÆmL )1 and processed by native PAGE. One gel was processed by radiography (R) and one was visualized by immunoblotting (IB) with TRiC antibodies. Additionally, the sample was precipitated by Sepharose beads coupled to either antibodies against TRiC or VLCAD for 1 h. The washed pellet (P) or supernatant (S) was analyzed by SDS ⁄ PAGE and radiography. (C) In vitro translation of wild-type cDNA for 30 min followed by termination of protein synthesis using cycloheximide. DNase I (2 lL) was added to each sample and incubated at 37 °C for the times indicated before separation by native PAGE and analyzed by radiography. (D) Experimental pulse chase conditions as in (C). Samples were incubated 0–240 min at 37 °C and analyzed by native PAGE and autoradiography. An unidentified band is indicated by an asterisk. N-actin, native actin; Hb, hemoglobin; R, radiography; IB, immunoblot; IP, immunoprecipitation. Amino acid substitutions shown in bold lead to DCM. Misfolding of actin variants in cardiomyopathies S. Vang et al. 2040 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS mately sevenfold higher for Arg312His actin com- pared to wild-type. The strong Arg312His actin–TRiC complex band persists for up to two hours. This can be explained by a tight actin–TRiC complex or by a dynamic dissociation ⁄ reassociation equilibrium shifted towards formation of complex. In addition, a new actin-containing band of unknown nature is now visi- ble in the wild-type lanes, denoted by an asterisk in Fig. 2D. Impaired folding leads to decreased formation of compact native actin structures To assess the fraction of folded to unfolded actin, the wild-type and mutant actins were subjected to a mild protease treatment. The cDNAs were expressed in vitro incorporating [ 35 S]Met for 30 min followed by termin- ation of protein translation with cycloheximide. The labeled protein products were treated with protein- ase K, separated by SDS ⁄ PAGE and analyzed by phosphorimaging. Actin in its native monomer confor- mation has a compact, protease-resistant structure [20] and when subjected to mild digestion with protein- ase K it is cleaved at the peptide bond between Met47 and Gly48, producing a globular C-terminal 35 kDa fragment [28]. The array of mutant proteins tested exhibited different resistance to the digestion, all pro- ducing the 35 kDa fragment and some being further degraded. This suggests that the variant actins Glu99Lys, Pro164Ala, Met305Leu, Arg312His, and Glu361Gly are stalled in a partly folded conformation having reduced resistance to proteolytic degradation (Fig. 3A, upper panel). We also assessed the fraction of folded to unfolded actin by measuring the fraction of folded actin mono- mer. Only full length and correctly folded actin can form a high affinity complex with DNase I [20]. By immobilizing DNase I on Sepharose beads, folded actin can be pulled down from solution and quantified by SDS ⁄ PAGE [20]. The assay was performed on the samples mentioned above, and again the variants Glu99Lys, Pro164Ala, Met305Leu, Arg312His and Glu361Gly was shown to be strongly impaired in reaching the native conformation (Fig. 3A, lower panel). There was a clear correlation between the assay of protease resistance and the assay of actin folding (Fig. 3B), indicating that the fraction of variant actin that is not able to reach its native structure has a loose structure and is accessible to nonspecific proteases. The variants not impaired in these assays appeared to fold even better than the wild-type actin. The reason for this is unknown. Variant actin aggregates in a ubiquitin-dependent manner Unfolded or misfolded proteins are often recognized and eliminated by the quality control system [18,19]. In the cytosol, substrates are marked by covalent modification with multiubiquitin chains, followed by degradation by the proteasome to protect the cell from exposed hydrophobic polypeptide segments [29]. To test whether the misfolded variant actins are processed by the proteasome, in vitro pulse-chase assays were performed for the wild-type and Arg312His mutant protein. Wild-type and variant actin were expressed in vitro at 37 °C for 30 min. At 30 min, subsequent translation was terminated by the addition of cyclohexi- mide. Degradation was measured in the presence of the proteasome inhibitor MG132, methylated ubiqu- itin, EDTA or dimethylsulfoxide (DMSO) during the chase period (Fig. 4). Samples were taken at 0, 2 and 4 h and kept on ice until electrophoretic analysis. At 4 h, a sample was centrifuged at 16 000 g for 20 min and washed in 1% (v ⁄ v) Triton X-100 to detect the formation of detergent-insoluble aggregates. All sam- ples were boiled in SDS loading buffer and separated by SDS ⁄ PAGE followed by quantification by phos- phorimaging (Fig. 4). Wild-type actin was stable dur- ing the four hour chase period, and produced only a small amount of SDS soluble aggregate and no detect- able high molecular mass ubiquitinated actin. How- ever, the amount of soluble Arg312His actin decreased over time and after four hours only approximately 25% remained. After 4 h, a large fraction of SDS sol- uble actin and high molecular mass ubiquitinated actin was detected in the Triton X-100 insoluble pellet. Concordantly, treatment with the specific proteasome inhibitor MG132 did not have any effect on either the wild-type or the Arg312His actin. This indicates that following polyubiquitination, the protein aggregates and cannot be degraded by the proteasome. Incubation with methylated ubiquitin inhibited the formation of high molecular mass ubiquitin conjugates. Methylated ubiquitin can be efficiently ligated to protein sub- strates, but terminates elongation of polyubiquitin chains because its reactive lysine residue is blocked [30]. Ubiquitination can be completely blocked by treatment with EDTA. The E1 catalyzed activation of ubiquitin is Mg 2+ - and ATP-dependent and is there- fore blocked by the addition of EDTA [29]. By inhibit- ing ubiquitin conjugation either partly or completely, the formation of Triton X-100 insoluble aggregates was also inhibited, suggesting the aggregation to be ubiquitin-dependent. Results of the quantification of full length actin in the SDS ⁄ PAGE are shown in S. Vang et al. Misfolding of actin variants in cardiomyopathies FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2041 Fig. 4B,C. Quantification of all radioactive material having higher molecular mass than actin, and thus rep- resenting ubiquitin conjugates, is shown in Fig. 4D. Some actin variants show perturbed filament formation We investigated the ability of the mutant proteins to form filamentous actin in cell culture. To test the sub- cellular localization of mutant actins and their ability to polymerize, we expressed full length wild-type and mutant actin using the mammalian expression vector pcDNA3.1 ⁄ Myc-His A, producing a C-terminally c-Myc-tagged chimeric protein. The tagged versions of the actin variants behaved like the untagged versions when tested in the in vitro system (data not shown). Transfected HEK-293 or COS-7 cells were stained with primary antibodies against c-Myc prior to labeling with green fluorescent secondary antibodies and costained with Texas Red fluorescent phalloidin, a standard mar- ker for filamentous actin. The in situ immunostaining was visualized by confocal laser scanning microscopy Proteinase K Before treatment After treatment DNase I Glu361Gl y Arg312His Ala331Prp Met305Leu Ala295Ser Tyr166Cys Pro164Ala Glu99Lys Wild Type Glu361Gly Arg312His Ala331Prp Met305Leu Ala295Ser Tyr166Cys Pro164Ala Glu99Lys Wild Ty pe Wild type Glu99Lys Pro164Ala Tyr166Cys Ala295Ser Met 305Ly s A l a 331Pro Arg312His Glu361Gly Relative to wild type 0,0 0,5 1,0 1,5 2,0 2,5 3,0 DNase I rescued Proteinase K digested A B Fig. 3. Some actin variations lead to a non-native loose protein structure. In vitro translation for 30 min at 37 °C followed by termination of protein synthesis using 150 lgÆmL )1 cycloheximide. (A) Resistance to protease treatment was assessed by digestion with 20 lgÆmL )1 pro- teinase K for 15 min at 20 °C and inhibition by 10 m M PMSF for 10 min on ice. Actin binding to DNase I was measured by incubation with Sepharose beads coupled to DNase I for 1 h at 4 °C followed by stringent washing and elution of actin by SDS loading buffer containing 40% (v ⁄ v) formamide. (B) The samples were analyzed by SDS ⁄ PAGE and quantified by phosphorimager scanning. Each sample was normal- ized to its respective untreated sample and relative difference to the wild-type was calculated. Error bars indicate standard deviations. Amino acid substitutions shown in bold lead to DCM. Misfolding of actin variants in cardiomyopathies S. Vang et al. 2042 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS SDS gel 024 0PP24 024 0PP24024 0PP24 P P024 024 Wild Type Arg312His Wild Type Arg312HisWild Type Arg312His Wild Type Arg312His DMSO Met-UbMG132 EDTA A B Full length actin Wild type Hours 43210 0,0 0,2 0,4 0,6 0,8 1,0 1,2 Full length actin Arg312His Hours 0,0 0,2 0,4 0,6 43210 0,8 1,0 1,2 CD Wild Type Arg312His Wild Type Arg312His Wild Type Arg312His Wild Type Arg312His Ubiquitinated actin 0 10 20 30 40 DMSO MG132 Met-Ub EDTA Pellet fraction Wild Type Arg312His Wild Type Arg312His Wild Type Arg312His Wild Type Arg312His DMSO MG132 Met-Ub EDTA 0 5 10 15 20 Fig. 4. Insoluble misfolded actin accumulates in a ubiquitin dependant manner. In vitro translation for 30 min followed by termination of pro- tein synthesis using cycloheximide at a final concentration of 150 lgÆmL )1 . Samples taken at 0, 2 and 4 h after termination were briefly spun at 16 000 g dissolved in SDS buffer on ice until gel separation. Samples at 4 h were spun at 16 000 g for 20 min, washed in 1% Triton X- 100 and dissolved in SDS buffer. All samples were analyzed by SDS ⁄ PAGE and quantified by phosphorimager scanning. (A) Autoradiogram of SDS ⁄ PAGE gel containing wild-type and Arg312His actin with DMSO (0.1% v ⁄ v; vehicle control), the proteasome inhibitor MG132 (25 l M), Met-Ub (1 mg mL )1 ), and EDTA (8 mM). The numbers are the chase period in hours and P is the pelleted non-Triton X-100 soluble fraction at t ¼ 4 h. (B) Quantified phosphorimager scanning of the full length soluble actin band calculated relative to t ¼ 0 values. DMSO (d), MG132 (s), Met-Ub (,) and EDTA (.). (C) Bar representation of Triton X-100 insoluble actin aggregates relative to wild-type DMSO val- ues. Only the 42 kDa actin band was scanned and the wild-type DMSO fraction was set to 1. (D) Scanning of high molecular mass ubiquiti- nated actin relative to the wild-type DMSO soluble sample at 4 h. Ubiquitinated actin was defined as the scanning of all radioactive material running slower than 42 kDa in the SDS gel. Triton X-100 soluble samples (unfilled bars) and Triton X-100 insoluble samples (filled bars). S. Vang et al. Misfolding of actin variants in cardiomyopathies FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2043 and images were processed using Adobe photoshop. Because neither HEK-293 cells nor COS-7 cells are muscle cells, and do not contain sarcomeres, one can question the physiological relevance of actin expression in these cells. However, as wild-type a -cardiac actin is capable of incorporating into cytoskeletal actin fibers, they may mimic the development of HCM and DCM at a sufficient level to distinguish and grade the actin variants. The red fluorescent phalloidin stained the actin fila- ments, composed of either endogenous actin only or a combination of endogenous and exogenous actin. In the cell lines used, this gave rise to a discrete staining of the outer cell boundaries and only to a lesser extent the actin cables in the cytosol (Fig. 5). The c-Myc tar- geted green fluorescence stained the actin coded by the transfected actin cDNA only – both as part of the actin filament and as nonincorporated actin molecules. By merging the red and green signal, the intracellular localization of mutated actin as well as its ability to be incorporated in actin filaments could be evaluated. c-Myc-tagged wild-type actin mostly colocalized with phalloidin-stained actin filaments, indicating correct processing and filament formation of tagged actin. The Tyr166Cys, Ala295Ser and Ala331Pro mutant actin proteins colocalized with actin filaments similar to the wild-type with a clear c-Myc staining in the cell cyto- skeleton but also some diffuse staining juxtaposed to the nucleus. The Glu99Lys, Pro164Ala, Met305Leu, Arg312His and Glu361Gly mutant proteins were distri- buted evenly throughout the cytosol with no apparent colocalization with the phalloidin stained actin. These findings are in agreement with the in vitro results above, showing that variant actins, which are impaired in folding and have an increased tendency to become insoluble, also fail to be incorporated in filaments. It is even noticeable that variants having a less severe fold- ing deficiency in vitro like the Met305Leu actin also have slightly better filament incorporation in vivo. Culturing cells transfected with wild-type or mutant actin with the proteasomal inhibitor MG132 overnight before fixation caused neither any further accumula- tion of actin in the cytosol, nor any formation of aggregates, as judged by the immunofluorescence ana- lysis (data not shown). Fig. 5. Only correctly folded actin proteins can incorporate into fibers. COS-7 cells transiently transfected with c-Myc tagged actin wild-type and mutant variants and stained for nuclei (Hoechst 33258, blue), filamentous actin (phalloidin, red) and transfected actin (c-Myc antibodies, green) followed by confocal laser scanning microscopy. Colocalization of filamentous actin and transfected actin lead to yellow color. Plus and minus symbols indicate colocali- zation with the cell cytoskeleton. Mock transfected cells showed no cross reactivities from the c-Myc antibody. Transfection with a vector expressing the green fluorescent protein (GFP) served as a positive control for the transfection procedure giving a transfection frequency of approximately 60%. Amino acid substitutions in bold type face lead to DCM. The results are representative of three sep- arate experiments. Misfolding of actin variants in cardiomyopathies S. Vang et al. 2044 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS Discussion Mutations in the a-cardiac actin gene may lead to re- modeling of the heart and cause either HCM or DCM. The prevailing hypothesis states that the mutated gene product can be incorporated into actin fibers and exerts a negative effect on the gene product from the normal allele [3]. However, an initial requirement for fiber incorporation is proper folding to a native-like actin structure maintained by the protein quality con- trol system. In addition to a stable structure, the actin variant must still be able to bind its many regulatory binding proteins for proper polymerization [23]. Sev- eral examples exist of disease-related missense varia- tions leading to incomplete folding with a variety of consequences for the cell. To test these events, we expressed the wild-type and eight actin variant proteins in an in vitro translation system using rabbit reticulo- cyte extracts. Using this system, we found a subset of the mutant proteins to have altered chaperone inter- action kinetics, as visualized on native nondenaturing PAGE. The most severe folding-defective variant pro- tein and the one with the highest tendency to remain in complex with the TRiC chaperonin was Arg312His actin, which is found in one patient with DCM. For this mutant, the amount of soluble TRiC-bound actin decreased over time. This suggests that actin folding is an iterative process in which each cycle of binding and release from the chaperonin can fold a subset of the mutant actin proteins; however, with reduced efficiency compared to the wild-type (Fig. 2C). The fraction of unfolded mutant protein was assessed by performing two types of folding assays. First, a mild digestion with proteinase K, which pro- duces a 34 kDa C-terminal fragment. There are drastic differences in the protease susceptibility of different mutant actins, suggesting different degrees of folding. A common trait is the size of the product, indicating the eventual formation of a wild-type-like structure. The second assay involves binding of native actin by DNase I conjugated beads. Through this assay we saw that folded, full length wild-type, but not specific mutants of actin, bind to DNase I. Both assays taken together indicate that some mutants have an impaired folding pathway. Our results show that all actin mutants can be folded to the mature form, but with widely varying efficiency (Fig. 3). Increased turnover of mutant proteins is character- ized in several hereditary diseases, exemplified by the elimination of missense variations in phenylalanine hydroxylase leading to phenylketonuria and short- chain acyl-CoA dehydrogenase (SCAD) missense vari- ant proteins, leading to SCAD deficiency [25,31,32], as well as deficiencies in other metabolic and tumor sup- pressor genes [33–36]. These conditions are inherited by autosomal recessive transmission whereby misfolded polypeptides are eliminated, leading to loss of function and disease development. In cardiomyopathies caused by mutations in the ACTC gene, the elimination of the actin variant proteins before their incorporation into fibers could either function as a positive modulator and reduce the severity of the clinical phenotype, or as a negative modulator to increase a haploinsufficiency effect. A different pathology could arise from failure to degrade misfolded actin variants and accumulation of cell-toxic aggregates as seen in desmin-related cardio- myopathy [37]. Indeed, the presence of filament oligo- mers, the cytotoxic precursor of aggresomes, has been identified in cardiomyocytes from both DCM and HCM patients [38]. The genetic characterization for these cardiomyocytes is, however, not accounted for. During various cell stress situations, the protein qual- ity control system may fail in processing the misfolded proteins leading to further increase in accumulation. Recent studies have shown that TRiC interacts with a number of non-native proteins containing b-sheets, including the von Hippel-Lindau tumor suppressor protein [34] and the WD (tryptophan-aspartate) repeat proteins [39]. A broader specificity towards b-sheet containing proteins suggests that TRiC may suppress aggregation of polyglutamine containing proteins in neurodegenerative diseases [40]. It is possible that the ability of TRiC to prevent aggregation of actin vari- ants plays a role in the development of the disease, and may underlie differences in the expression of a dis- ease phenotype in different patients having the same actin mutation. In contrast to the fate of the above-mentioned and many other misfolded proteins, the misfolded Arg312His actin is not degraded by the ubiquitin-pro- teasome system; at least not within the time scope and experimental conditions in this study. Arg312His actin rather accumulates in a Triton X-100 insoluble fraction. Inhibition of the ligation of ubiquitin monomers to actin (either partly or completely) increased the percentage of actin found in the soluble fraction. This suggests that polyubiquitinated but not unmodified actin mutants are prone to become detergent-insoluble and aggregate. This is consistent with examples of colocalization of ubiquitin and aggregates in cells [41]. Extending the experiment to all eight mutants showed a correlation between the degrees of misfolding as judged by the pro- teinase K resistance and DNase I binding assay, and tendencies to form detergent-insoluble fractions (data not shown). Calculating the theoretical change in aggre- gation rate as a consequence of the mutations using the S. Vang et al. Misfolding of actin variants in cardiomyopathies FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2045 method described by Chiti et al. [42] gives aggregation rates corresponding to the experimentally observed aggregation tendency. The variant actins that are impaired in folding and showed tendencies to become insoluble in detergent in our analyses give an increased calculated aggregation rate, with the Arg312His having the highest rate increase (data not shown). This correla- tion suggests a similarity between the actin-containing aggregates and the ones found in amyloid deposits in neurodegenerative diseases, rather than amorphous unstructured aggregates [42]. Examination of mutant actin in intact cells reveals a correlation between the degree of protein misfolding and impairment of incorporation into filaments. This suggests that diminished ability to form filaments is caused by folding impairment. The nonfilamentous mutant actin proteins appear diffuse throughout the cytosol, apparently without being degraded by the ubiquitin proteasome system, as treatment with the potent proteasomal inhibitor MG132 did not result in increased accumulation of misfolded actin (not shown). The inability of misfolded actin monomers to form filaments raises the question whether the negative dom- inance of the disease is evolving from the filaments with incorporated variant actin proteins as previously suggested [7–10] or from negative effects of misfolded actin molecules in the cytosol. Genetic heterogeneity and different environmental factors may modify the residual folding efficiency of the mutant proteins, and thereby exert modulation on the clinical expression. To further define such modifying factors, inbred rodent models with controlled genetic and environmental backgrounds will be imperative. A recent HCM study showed no specific phenotype associated with ACTC mutations [8]. Reviewing the clinical data, there seems, interestingly, to be a correla- tion between the severity of the disease and the ability of the variant actin to incorporate into filaments. In patients carrying mutations giving rise to actin proteins capable of incorporating into fibers (Tyr166Cys, Ala295Ser, and Ala331Pro), only five out of 19 were symptomatic, whereas eight out of nine were sympto- matic when the actin protein had reduced ability to incorporate (Glu99Lys, Pro164Ala and Met305Leu; P < 0.005, Fisher’s Exact test). This may arise from the reduced amount of actin filament (haploinsuffi- ciency), or from stressful cellular situations resulting from the accumulation of misfolded and ⁄ or aggregated actin protein. Based on data from this study and the fact that toxic oligomers previously have been described in HCM [38], the latter seems to be the most likely. These findings, however, must be interpreted with caution because of the small number of patients. In general, distinct mutations in sarcomeric proteins cause either dilated or hypertrophic cardiomyopathy; no mutation can lead to both DCM and HCM, disre- garding end stage dilation in HCM. This suggests that the mutations initiate different series of events that remodel the heart. We show that both DCM-causing ACTC mutations encode actin variants with inefficient folding and perturbed filament formation, whereas only half of the HCM-causing ACTC mutations (three out of six) encode actin proteins that appear misfolded by the criteria employed here. It is therefore tempting to speculate that the inability to form myofilaments and ⁄ or the accumulation of aggregates as a result of protein misfolding could be one of the cellular patho- logical effects of a mutation that influence the direc- tion of cardiac remodeling towards either HCM or DCM. Previous mouse models and myotube assays have been used to study the effect of sarcomeric varia- tions; however, the causal molecular mechanisms underlying these effects have never before been stud- ied. The effect of impaired protein folding precedes the potential effect of the malfunctioning variant protein. The presence of misfolded proteins may influence the cellular stress level and impair the Ca 2+ sensitivity of the myocyte. The finding that protein misfolding and the influence from the protein quality control system may have effects on clinical progression of DCM and HCM is a para- digm shift for these types of cardiomyopathies. Research into this new avenue may give a basis to design novel therapeutic strategies and new categories of model systems like those pursued in amyloidosis diseases inclu- ding Alzheimer’s and Parkinson’s disease [17]. Experimental procedures Plasmids The complete ACTC cDNA sequence was obtained using the IMAGE clone CM147-m7 as template in a PCR reac- tion using Pfu Turbo polymerase from Stratagene (La Jolla, CA, USA). The forward primer contains a KpnI site and an optimized Kozak sequence (GGTACCGCCACCATG), and the reverse primer contains an XhoI site. The PCR product was purified and ligated into the KpnI ⁄ XhoI site of the pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA). Muta- genesis was performed using the Quick change kit (Strata- gene). All clones were checked for mutagenesis and the absence of PCR-induced errors. For constructing a c-Myc His-tagged chimeric actin, a PCR product from the same forward primer and a reverse primer bearing an XhoI restriction site substituting the stop codon was inserted into the KpnI ⁄ XhoI site in the pcDNA3.1 ⁄ Myc-His A vector Misfolding of actin variants in cardiomyopathies S. Vang et al. 2046 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS [...]... chain complexes in the folding of cytoskeletal proteins J Cell Biol 145, 265–277 Rommelaere H, Waterschoot D, Neirynck K, Vandekerckhove J & Ampe C (2003) Structural plasticity of functional actin: pictures of actin binding protein and polymer interfaces Structure (Camb) 11, 1279– 1289 Costa CF, Rommelaere H, Waterschoot D, Sethi KK, Nowak KJ, Laing NG, Ampe C & Machesky LM (2004) Myopathy mutations in. .. (2003) Tumorigenic mutations in VHL disrupt folding in vivo by interfering with chaperonin vinding Mol Cell 12, 1213–1224 Ory K, Legros Y, Auguin C & Soussi T (1994) Analysis of the most representative tumour-derived p53 mutants FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS Misfolding of actin variants in cardiomyopathies 36 37 38 39 40 41 42 43 44 reveals that changes in protein conformation are not... PAGE and visualized by phosphorimaging DNase I was coupled to Sepharose beads and incubated with actin as described previously [43] In brief, radioactively labeled wild-type and mutant actin from in vitro translation reactions (37 °C for 30 min) was incubated with the Sepharose coupled DNase I on ice for 60 min, washed, eluted in SDS sample buffer containing 40% (v ⁄ v) formamide for 5 min at 95 °C and. .. hypertrophic cardiomyopathy J Clin Invest 103, R39–R43 8 Mogensen J, Perrot A, Andersen PS, Havndrup O, Klausen IC, Christiansen M, Bross P, Egeblad H, Bundgaard H, Osterziel KJ et al (2004) Clinical and genetic characteristics of alpha cardiac actin gene mutations in hypertrophic cardiomyopathy J Med Genet 41, e10 9 Olson TM, Michels VV, Thibodeau SN, Tai YS & Keating MT (1998) Actin mutations in dilated cardiomyopathy, ... 000 g and soluble material was removed by washing in 1% (v ⁄ v) Triton X-100 All samples were separated by SDS ⁄ PAGE and visualized and quantified by phosphorimaging Immunoblotting and immunoprecipitation In vitro translated actin was separated by native PAGE and blotted on to poly(vinylidene difluoride) membrane using a transfer buffer containing 50 mm boric acid, blocked in 5% (w ⁄ v) nonfat milk and. ..S Vang et al Misfolding of actin variants in cardiomyopathies (Invitrogen) The Expand High Fidelity polymerase from Roche (Basel, Switzerland) was used in NP-40 buffer, separated by SDS ⁄ PAGE and visualized by phosphorimaging In vitro transcription/translation Folding efficiency assays In vitro protein biosynthesis was carried out using TNT Quick Coupled Transcription ⁄ Translation... according to supplier’s recommendations 48 h after transfection, the cells were washed in NaCl ⁄ Pi, fixed in freshly prepared 4% (w ⁄ v) paraformaldehyde (Merck, Darmstadt, Germany) for 15 min Immunostaining of transfected actin was done using the 9E10 monoclonal antibody against the c-Myc tag (Research Diagnostics Inc., Flanders, NJ, USA) as primary antibody, 2047 Misfolding of actin variants in cardiomyopathies... chaperones in the cytosol: from nascent chain to folded protein Science 295, 1852–1858 Barral JM, Broadley SA, Schaffar G & Hartl FU (2004) Roles of molecular chaperones in protein misfolding diseases Semin Cell Dev Biol 15, 17–29 McClellan AJ & Frydman J (2001) Molecular chaperones and the art of recognizing a lost cause Nat Cell Biol 3, E51–E53 Goldberg AL (2003) Protein degradation and protection against... myosin-binding protein C (MYBPC3) in 81 families with familial hypertrophic cardiomyopathy: total or partial haploinsufficiency Eur J Hum Genet 12, 673–677 6 Towbin JA & Bowles NE (2002) The failing heart Nature 415, 227–233 7 Mogensen J, Klausen IC, Pedersen AK, Egeblad H, Bross P, Kruse TA, Gregersen N, Hansen PS, Baandrup U & Børglum AD (1999) Alpha-cardiac actin is a novel disease gene in familial hypertrophic. .. carried out using the imagequant software Radioactively labeled wild-type and mutant actin from in vitro translation (37 °C for 30 min) was treated by adding 25 lgÆmL)1 proteinase K (Sigma, St Louis, MO, USA) in NaCl ⁄ Pi at 20 °C for 15 min Protease activity was stopped with 10 mm phenylmethylsulfonyl fluoride on ice for 10 min, samples were heated to 95 °C for 5 min in SDS sample buffer and separated . Actin mutations in hypertrophic and dilated cardiomyopathy cause inefficient protein folding and perturbed filament formation Søren Vang 1 ,. with phalloidin-stained actin filaments, indicating correct processing and filament formation of tagged actin. The Tyr166Cys, Ala295Ser and Ala331Pro mutant actin proteins