Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist Mani D Kalluri1,*, Praneel Datla2,*, Akshaya Bellary1,*, Khalander Basha1, Ashwani Sharma1, Anuradha Sharma1, Shiva Singh1, Shakti Upadhyay2 and Vikram Rajagopal1 Drug Discovery and Development Group, Reliance Life Sciences Pvt Ltd, Navi Mumbai, India EID Parry India Ltd, Chennai, India Keywords inflammation; lipopolysaccharide; monocytes; NF-jB; TLR signalling; tumour necrosis factor-a Correspondence V Rajagopal, Drug Discovery and Development Group, Reliance Life Sciences Pvt Ltd, Dhirubhai Ambani Life Sciences Center, Rabale, Navi Mumbai-400701, India Fax: +91 22 67678099 Tel: +91 22 67678854 E-mail: vikram_rajagopal@relbio.com *These authors contributed equally to this work (Received December 2009, revised 16 January 2010, accepted 21 January 2010) doi:10.1111/j.1742-4658.2010.07589.x The regulation of cytokines and pro-inflammatory genes is an absolute essentiality to combat inflammatory diseases The present study investigated the effects of 4-O-chloroacetyl-2,3-di-O-acetyl-6-O-levulinoyl-b-d-glucopyranosyl]-(1-3)-1-O-(p-methoxyphenyl)-2-deoxy-2-N-trichloroacetyl-4,6-O-benzylidene-a-d-glucopyranoside (RSCL-0409), a novel small molecule Toll-like receptor (TLR) signalling antagonist, and its mechanism of action in human monocytic (THP-1) cells stimulated with lipopolysaccharide (LPS) In THP-1 and RAW264.7 cells, RSCL-0409 suppressed LPS-induced production of tumour necrosis factor-a (TNF-a) with a 50% inhibitory concentration of 10.6 lm and mRNA expression of ICAM-1, Cox-2 and interleukin-8 with no evidence of cytotoxicity RSCL-0409 also suppressed TNF-a production from LPS-stimulated human peripheral blood mononuclear cells Similar results were obtained in vivo in a murine model of LPS-induced inflammation, where pretreatment with RSCL-0409 resulted in significant inhibition of TNF-a It is also noteworthy that RSCL-0409 suppressed the cytokine production induced by TLR2 and -4 ligands and not for any other TLR ligands RSCL-0409 significantly inhibited p65 nuclear translocation induced by LPS In conclusion, RSCL-0409, a novel small molecule, is the first of its kind in the category of carbohydrate-derived TLR signalling antagonists and could definitely be a promising therapeutic agent for inflammatory diseases whose pathogenesis involves TLR2- or TLR4-mediated signalling processes Introduction Humans have evolutionarily conserved immune receptors, Toll-like receptors (TLRs), which line up as our first defences against the invading foreign pathogens TLRs are able to elicit an immune response due to their ability to recognize the pathogen-associated molecular patterns of microbial pathogens, such as Abbreviations IL, interleukin; IRAK, interleukin-1 receptor-associated kinase; LBP, lipopolysaccharide-binding protein; LPS, lipopolysaccharide; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; NF-jB, nuclear factor-jB; NO, nitric oxide; PBMC, peripheral blood mononuclear cell; RSCL-0409, [4-O-chloroacetyl-2,3-di-O-acetyl-6-O-levulinoyl-b-D-glucopyranosyl]-(1-3)-1-O-(p-methoxyphenyl)-2-deoxy-2-N-trichloroacetyl4,6-O-benzylidene-a-D-glucopyranoside; SEAP, secreted embryonic alkaline phosphatase; TIRAP, Toll receptor IL-1R domain-containing adapter protein; TLR, Toll-like receptor; TNF-a, tumour necrosis factor-a; TRAF, TNFR-associated factor FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS 1639 RSCL-0409 inhibits LPS-induced TLR signalling bacteria and viruses, triggering inflammatory and antiviral responses that destroy the invading pathogens So far, 11 TLRs have been described and for most of them, except TLR10, natural ligands have been identified These include various proteins, lipopeptides, lipoteichoic acid, lipopolysaccharides (LPS) and oligonucleotides (double-stranded RNA, singlestranded RNA and DNA) [1] One of the prominent signalling mechanisms activated through TLRs is via LPS LPS, the predominant structural component of the outer membrane of Gram-negative bacteria, activates monocytes and macrophages, leading to the production of cytokines, such as tumour necrosis factor-a (TNF-a), interleukin-1 (IL-1) and IL-6, which in turn serve as endogenous inflammatory mediators Although TLR4 is primarily implicated as the TLR involved in LPS signalling, there are reports showing the involvement of TLR2 as the primary signal tranducing molecule in Gram-negative organisms, such as Porphyromonas gingivalis [2], which also have LPS as the cell component Furthermore, studies have also shown TLR1 functioning as a coreceptor for TLR2 and its coexpression in transfected cells augmented the TLR4-independent response to Escherichia coli LPS [3] The cells become activated when the lipid A moiety of LPS attaches to the LPS-binding protein (LBP); this LPS ⁄ LBP complex binds to CD14, which is then transferred to the TLR4–MD-2 complex [4,5] Activation of mitogen-activated protein kinases and nuclear factorjB (NF-jB) together with the release of inflammatory mediators [6] are the result of the signal transduction The LPS signalling cascade involves a lot of adapter molecules, such as MyD88 [7] and Toll receptor IL-1R domain-containing adapter protein (TIRAP) ⁄ MyD88 adapter-like (Mal) These further recruit kinases, IL-1R-associated kinase (IRAK)-1 and ⁄ or IRAK-2 [8], which in turn activate TNF receptor-associated factor 6-dependent signalling cascades, culminating in NF-jB activation [9] and the release of various inflammatory mediators Prominent among them is TNF-a capable of exerting host-damaging effects seen in conditions such as sepsis, fever syndromes, cachexia and in autoimmune diseases such as rheumatic arthritis and inflammatory bowel disease [10,11] Given the wide implications of TLR signalling, its regulation can alleviate the effects of pro-inflammatory mediators [12] It is well documented that most known TLR ligands contain carbohydrate moieties However, the potential role of pure carbohydrates or its analogues as ligands for TLRs has unlimited scope of further investigation Documented reports show low molecular mass hyaluronic acid oligosaccharides pro1640 M D Kalluri et al duced during inflammation exhibiting the ability to induce maturation of dendritic cells through TLR4 [13,14] Our goal was to use the available data to design novel selective carbohydrate-based, especially disaccharide-like molecules, that could serve either as agonists or antagonists of TLR signalling pathways Working in that direction, we discovered a novel disaccharide derivative, [4-O-chloroacetyl-2,3-di-O-acetyl6-O-levulinoyl-b-d-glucopyranosyl]-(1-3)-1-O-(p-methoxyphenyl)-2-deoxy-2-N-trichloroacetyl-4,6-O-benzylidene-a-d-glucopyranoside (RSCL-0409), from the vast library of analogues synthesized, which selectively inhibits the TLR-mediated production of TNF-a and also mRNA expression of various proinflammatory genes that lead to NF-jB activation The chemical structure of RSCL-0409 is shown in Fig 1A We have also delineated the mechanism responsible for the inhibitory effect Results RSCL-0409 inhibits the production of inflammatory cytokine TNF-a from LPS-stimulated THP-1, peripheral blood mononuclear cells (PBMCs) and RAW264.7 cells Human monocytic cells, THP-1, were stimulated with 250 ngỈmL)1 LPS in the presence and absence of various concentrations of RSCL-0409 (1–100 lm) TNF-a in the supernatants was measured by Duo-Set ELISA (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions RSCL-0409 inhibited the production of this pro-inflammatory mediator in a concentration-dependent manner (Fig 2A); having a 50% inhibitory concentration value of 10.6 lm (calculated using biodatafit software) We observed similar inhibition in both RAW264.7 cells and PBMCs stimulated with LPS (Fig 2B, C) In addition, we checked its ability to inhibit TNF-a when stimulated with higher concentrations of LPS As shown in Fig 2E, RSCL-0409 at 10 lm showed an inhibition of TNF-a secretion even with 1000 ngỈmL)1 LPS stimulation and a near complete inhibition of TNF-a secretion observed at 100 lm, making it a potential candidate for use in clinical conditions such as septic shock where LPS concentrations are known to be very high Cell viability as estimated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) method (Fig 2D) did not show any cytotoxicity These results clearly indicate that RSCL-0409 exerts an inhibitory effect on the production of the pro-inflammatory mediator TNF-a from both mouse and human monocytes and macrophages stimulated with LPS FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS M D Kalluri et al RSCL-0409 inhibits LPS-induced TLR signalling Chemical structure – RSCL-0409 A B Fig (A) Structure of RSCL-0409 (B) HPLC profile of RSCL-0409 RSCL-0409 was synthesized as mentioned in Materials and methods The purified compound was subjected to HPLC to determine its purity Peak with a retention time 3.6 shows 98.6% purity Inhibitory Effect on TLR1 ⁄ 2, -4 ligand-induced TNF-a The activation of TLRs by specific ligands leads to the release of many inflammatory cytokines Studies have shown that THP-1 cells are known to express all the TLRs Therefore, we checked the effect of various TLR ligands on THP-1 monocytes in the presence and absence of RSCL-0409 (50 lm) and their ability to release TNF-a As shown in Fig 3A, we detected TNF-a secretion from cells stimulated with TLR1 ⁄ 2, TLR4 and TLR6 No detectable TNF-a was observed following stimulations with other ligands In cells pretreated with RSCL-0409, we observed inhibited TNF-a production from THP-1 cells stimulated with TLR1 ⁄ and TLR4 We confirmed this selective inhibitory effect of RSCL-0409 on TLR-1 ⁄ 2- and TLR4-mediated TNF-a production in PBMCs (Fig 3B) and a similar observation was also made in RAW264.7 cells (unpublished data) These results suggest that RSCL-0409 inhibits TNF-a production mediated by TLR1 ⁄ and TLR4 To confirm the above observation, we checked for the ability of RSCL-0409 to inhibit nitric oxide (NO) FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS 1641 RSCL-0409 inhibits LPS-induced TLR signalling M D Kalluri et al A 2500 B 3500 NS 3000 2500 1500 *** TNF (pg/ml) TNF (pg/ml) 2000 1000 500 *** *** 2000 1500 1000 *** 500 LP S L04 09 SC R R SC + L04 09 R SC C on tro l LP S L04 09 C LP (1 S ,1 0, 50 R ,1 SC 00 L04 µM 09 ) (1 R µM SC )+ L04 LP 09 S (1 R µM SC )+ L04 LP 09 S (5 R SC µM L)+ 04 LP 09 S (1 00 µM )+ LP S on tro l C 3000 D 125 NS 2500 * 1500 *** 1000 *** 500 % Cell viability TNF-α (pg/ml) 100 2000 75 50 25 S µM ) 00 µM ) 0 LSC R R SC L- 04 04 09 09 (1 (5 (1 09 04 LSC R R L- SC L- 04 04 09 09 (1 (1 µM ) µM ) ls el 00 C µM )+ LP LP S S µM )+ R R SC SC SC L- L- 04 04 09 09 (5 (1 0 µM )+ µM )+ LP LP S µM ) R R SC L- R 04 SC 09 L- (1 04 ,1 09 0, (1 50 ,1 C 00 on LP tro l S E 1600 250 ng·mL–1 1400 500 ng·mL–1 1000 ng·mL–1 TNF (pg/ml) 1200 1000 800 600 400 200 S µM R SC L04 09 + LP S 10 50 µM R SC L04 09 + LP S LP + 09 L04 SC R µM 10 µM R SC L04 09 + LP LP S S Fig RSCL-0409 suppression of LPS-induced TNF-a in a dose-dependent manner and in different cell lines Serum-starved human monocytic cells (THP-1; B), human PBMCs (B) and mouse macrophage cells (RAW264.7; C) were pretreated with the indicated concentrations of RSCL-0409 and then stimulated with LPS for 24 h Culture supernatants were collected and assayed for TNF-a by ELISA Data are expressed as means + standard error of three independent experiments *P < 0.05, ***P < 0.001; LPS treated vs RSCL-0409 treated, NS, not significant (D) Serum-starved THP-1 cells (2 · 105 cellsỈwell)1) were pretreated with RSCL-0409 in increasing concentrations (1, 10, 50 and 100 lM) h before LPS stimulation The viability of the cells was checked using MTT after 24 h incubation The data represented are after the values have been normalized to the control Error bars represent the standard error for three separate experiments (E) Serum-starved THP-1 cells were stimulated with increasing concentrations of LPS (250–1000 ngỈmL)1) with and without pretreatment with RSCL-0409 (1–100 lM) for 24 h The supernatant was then assayed for the ability of the cells to release TNF-a by ELISA The data are a representation of two independent experiments 1642 FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS M D Kalluri et al A RSCL-0409 inhibits LPS-induced TLR signalling Effect of RSCL-0409 on various TLR ligands in THP-1 cells B 1400 Effect of RSCL-0409 on various TLR ligands in PBMCs 3000 Ligands alone RSCL-0409 1200 NS 1000 TNF (pg/ml) 2000 1500 1000 ** NS 200 *** 0 35 NS 30 Ligands alone RSCL-0409 D 24.0 20.0 NS 20 15 NS NS 10 * Nitrite (µM) 25 * 16.0 12.0 *** 8.0 *** 4.0 *** *** S µM )+ LP (1 09 04 R SC L- LSC R LP S S µM )+ (5 09 04 09 LSC R R SC L- 04 04 09 C (1 (2 pG 5 µM )+ µM )+ LP LP S S tro on N O D l 95 23 48 R -8 pal LP ) S M SK 3C I:C C 3H on C Pa m Po ly ( tro l l 0.0 C Nitrite (µM) ** 600 400 500 C Ligands alone RSCL-0409 ** 800 LP TNF (pg/ml) 2500 Fig RSCL-0409 inhibits TLR2, TLR4-induced TNF-a secretion in THP-1 monocytes and PBMCs Serum-starved THP-1 cells (A) and PBMCs (B), · 105 cellsỈwell)1, were pretreated with RSCL-0409 (50 lM) h before TLR ligand treatment The pretreated cells were stimulated with various TLR ligands at different concentrations (TLR1 ⁄ 75 ngỈmL)1, TLR3 75 lgỈmL)1, TLR4 750 ngỈmL)1, TLR5 75 ngỈmL)1, TLR6 75 ngỈmL)1, TLR7 ⁄ 7.5 lgỈmL)1 and TLR9 7.5 lgỈmL)1) for 24 h as per manufacturer’s instructions The culture supernatant was then assayed for TNF-a secretion Similar treatments were carried out on RAW 264.7 cells (C, D) We have used imidazoquinolines as TLR-7 ⁄ for stimulation Cells untreated with RSCL-0409 served as controls Data are expressed as mean + standard error of two independent experiments *P value < 0.05, **P value < 0.01, ***P value < 0.001; ligand-treated cells vs RSCL-0409-treated cells, NS, not significant induced by TLR ligands in RAW264.7 cells RSCL0409 selectively inhibited TLR1 ⁄ 2- and LPS-induced NO production (Fig 3C) RSCL-0409 had no significant effect on NO production induced by TLR3, TLR6, TLR7 ⁄ or TLR9 ligands As shown in Fig 3D, RSCL-0409 inhibited LPS-stimulated NO production in a dose-dependent manner Inhibitory effect on mRNA expression in THP-1 cells To determine whether the suppressive effect of RSCL0409 on cytokine production occurs at the mRNA expression level, we used quantitative real-time PCR to examine TNF-a and IL-6 mRNA expressions in THP1 cells stimulated with LPS TNF-a (Fig 4A) and IL-6 (Fig 4B) mRNA expression was detected h after LPS stimulation The expression levels were similar to cell control in RSCL-0409 (50 lm) pretreated cells On the other hand, TNF-a and IL-6 mRNA showed 13- and six-fold increased expression after LPS stimulation, respectively Furthermore, we wanted to determine whether this inhibitory effect on mRNA expression was seen on other pro-inflammatory genes, such as ICAM-1, Cox-2 and IL-8 We saw suppression of their mRNA expression levels at a concentration of 50 lm RSCL-0409 (Fig 4C) It is also noteworthy that treatment of cells with RSCL-0409 did not show any effect in any of the genes at the mRNA level (Fig 4C, lane 2) RSCL-0409 blocks nuclear translocation of NF-jB and activation of NF-jB transcription factor LPS, together with a range of inflammatory stimuli, activates and induces nuclear translocation of NF-jB NF-jB ⁄ IjB complexes are present in the cytoplasm under unstimulated conditions Following stimulation with LPS, we see phosphorylation and subsequent degradation of IjB, allowing the free NF-jB to translo- FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS 1643 RSCL-0409 inhibits LPS-induced TLR signalling M D Kalluri et al A 16.0 B 9.0 TNF-α IL-6 8.0 12.0 7.0 6.0 10.0 Fold change Fold change 14.0 8.0 6.0 5.0 4.0 3.0 NS 4.0 2.0 2.0 *** NS 0.0 Cell control Cells + LPS Cells + RSCL0409 (50 µM) 0.0 Cells + RSCL0409 (50 µM) + LPS C *** 1.0 Cell control Cells + RSCL0409 (50 µM) Cells + LPS Cells + RSCL0409 (50 µM) + LPS RSCL-0409 + LPS LPS RSCL-0409 Control Lanes M Time (min) 60 60 60 60 LPS – – + + RSCL-0409 – + – + ICAM-1 Fold change RSCL-0409 + LPS LPS ICAM-1 282 bp Cox-2 278 bp RSCL-0409 Control Cox-2 IL-8 221 bp β-actin Fold change 313 bp RSCL-0409 + LPS LPS RSCL-0409 Control IL- Fold change 10 Fig Inhibitory effect of RSCL-0409 on mRNA expression in THP-1 cells (A, B) Total RNA was isolated from THP-1 cells h after exposure to LPS (250 ngỈmL)1) with or without 50 lM RSCL-0409 The cDNA was used for real-time PCR with primers specific for human TNF-a, IL-6 and for the housekeeping gene b-actin The fold change of TNF-a and IL-6 mRNA in treated cells over control was obtained after correction for the amount of b-actin Error bars represent the standard error for three separate experiments ***P value < 0.001; LPS-treated cells vs RSCL-0409-treated cells, NS, not significant (C) cDNA from an experiment similar to (A) was used to amplify inflammatory genes (ICAM-1, Cox-2 and IL-8) using specific primers (see Materials and methods) with b-actin serving as the internal control The data are representative of three independent experiments cate into the nucleus to activate genes with NF-jBbinding regions Therefore, we checked whether RSCL-0409 blocked any signals responsible for NF-jB 1644 signalling leading to nuclear translocation RSCL-0409 prevented IjB-a degradation and phosphorylation of the p65 subunit (data not shown), resulting in the FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS M D Kalluri et al A Tubulin Lanes Discussion The release of multiple pro-inflammatory cytochemokines is a signature feature of the pathophysiology of inflammation induced by LPS These processes, which involve a number of signalling molecules, bring along with them their share of complexities Thus, a good anti-inflammatory agent targeting such a complex signalling mechanism needs to modulate this pro-inflammatory process, preferably at an early stage of signalling Our research focuses on identifying such novel molecules and taking them forward as novel anti-inflammatory drugs In our current study, we synthesized a library of novel small carbohydrate-derived analogues and identified a novel gluco-disaccharide derivative, RSCL-0409, through our screening process that exhibits strong anti-inflammatory properties both in in vitro and in vivo It inhibits LPS-induced signalling in cultured monocytes and reduces NF-jB-dependent expression of pro-inflammatory genes, ICAM-1, Cox-2 and IL-8, through a TLR-mediated process It is of significance 30 60 120 30 60 120 LPS – + + + + + + RSCL-0409 – – – – + + + RSCL-0409+LPS-60 RSCL-0409+LPS-30 RSCL-0409+LPS-15 LPS-120 LPS-60 LPS-30 Control Fold change 120.0 100.0 NS 80.0 ** 60.0 *** 40.0 NS 20.0 NS NS S 04 04 09 09 (5 (1 0 µM µM )+ )+ LP LP LP S S ) L- L- SC R R + C el ls ls el C C el ls + + C R SC SC + L- R 04 SC 09 L- (1 04 µM 09 )+ (5 (1 0 µM µM ) µM 09 el ls ls el C C el ls + + R R SC SC L- L- 04 04 el 09 lc (1 on tr LP ol S ) 0.0 C To follow-up on our in vitro observations, we tested the effect of RSCL-0409 pretreatment in a murine model of LPS-induced inflammation Balb ⁄ C was treated with RSCL-0409, 30 before LPS injection Blood samples were taken h after LPS injection for TNF-a analysis As shown in Fig 6, we saw  53 and 64% inhibition of LPS-induced TNF-a production at h at 10 and 20 mgỈkg)1 injected RSCL-0409, respectively Time (min) B Effect of RSCL-0409 on LPS-induced TNF-a production in vivo p65NF-kB Relative SEAP secretion inhibition of downstream signalling Further downstream, we saw partial translocation of NF-jB from the cytoplasm into the nucleus within 60 min, which was blocked when cells were pretreated with RSCL0409, as shown in Fig 5A We confirmed the suppressive effect of RSCL-0409 on the NF-jB signalling pathway using an NF-jB reporter assay In THP-1 blue CD14 cells containing stably transfected NF-jB reporter plasmids expressing the secreted embryonic alkaline phosphatase (SEAP) gene on stimulation with a TLR4 ligand, LPS released large amounts of SEAP into culture medium, which was blocked in a dose-dependent manner by pretreatment of cells with RSCL-0409 (Fig 5B) These observations further confirm that RSCL-0409 inhibits LPS-induced TLR-mediated activation of NF-jB transcription factor RSCL-0409 inhibits LPS-induced TLR signalling Fig RSCL-0409 blocks nuclear translocation of NF-jB and NF-jB activation in reporter assays (A) Serum-starved THP-1 cells were treated with 50 lM RSCL-0409 The nuclear fractions were obtained from LPS-stimulated THP-1 cells at the indicated times and processed for immunoblots as mentioned earlier using a NF-jB-specific antibody The blot was stripped and reprobed with an anti-tubulin Ig to ensure equal loading All the results shown are representative of three separate experiments (B) THP-1 CD14 blue cells (Invivogen) transfected with a SEAP reporter construct, in which the reporter expression was regulated by the NF-jB promoter, were stimulated with LPS (250 ngỈmL)1) with or without RSCL-0409 for 24 h The reporter activity was determined using the Quanti Blue kit The data are plotted as the relative change in reporter activity The data shown are the average from three independent experiments performed in duplicate NS, not significant **P value < 0.01, ***P value < 0.001; cells vs RSCL-0409 treated; LPS treated vs RSCL-0409 followed by treated that RSCL-0409 exerts similar inhibitory effects in both human monocytes and mouse macrophages, indicating that its potency is spread across different species With TLRs gaining prominence as drug targets, numerous agonists are currently being developed [15] FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS 1645 RSCL-0409 inhibits LPS-induced TLR signalling M D Kalluri et al TNF release (pg/ml) 2000 1500 1000 *** *** 500 LP R S SC (2 L25 04 µg 09 ) (1 R SC m Lg· R 04 SC kg 09 –1 L) (2 04 09 m (1 g· R kg SC m –1 Lg· ) 04 kg –1 09 )+ (2 LP m S g· kg –1 )+ LP S C on tro l Pl ac eb o Fig RSCL-0409 suppresses LPS-induced TNF-a release in Balb ⁄ c mice Specific pathogen-free female Balb ⁄ c mice (5–6 weeks, five animals per group) weighing 20–30 g were intraperitoneally injected with LPS (225 lgỈmL)1) with and without pretreatment of RSCL-0409 (10 and 20 mgỈkg)1) RSCL-0409 was injected intraperitoneally 30 before LPS injection One hour after LPS injection, blood was collected retro-orbitally under anaesthesia and serum analysed for TNF-a secretion ***P value < 0.001; LPS treated vs RSCL-0409 treated Control represents untreated animals The development of antagonists has gained impetus following concerns that agonists have not been effective in specific targeting Currently, TAK-242 [16] and E-5564 [17], apart from the few reported lipid A analogues as antagonists [18–20], are in the last phase of clinical developmental Furthermore, reports of LPSlike molecules extracted from cyanobacterium Oscillatoria Planktothrix [21], which blocks sustained TLR4 stimulation, have been documented RSCL-0409, gluco-disaccharide derivative, is one such initiative capable of developing into a potential TLR antagonist On the basis of our screening results, we short listed RSCL-0409 for further studies With a 50% inhibitory concentration of 10.6 lm, RSCL-0409 inhibited LPSstimulated TNF-a secretion from monocytic cells in a dose-dependent manner LPS signalling is initiated by its binding to LBP, followed by subsequent binding to CD14, TLR4 and MD-2 complex on the cell surface [22] However, depending on the LPS concentration, the pathway may occur in an LBP ⁄ CD14-dependent way or in an independent way [23] Concentrations up to 100 ngỈmL)1 initiate LBP ⁄ CD14 complex-dependent binding and higher concentrations set up LBP ⁄ CD14independent signalling We have worked with varying concentration of LPS (250–1000 ngỈmL)1) and irrespective of the LPS concentration, RSCL-0409 pretreated cells inhibited TNF-a secretion up to 1000 ngỈmL)1, making it a potential candidate for use in clinical conditions such as septic shock, where LPS concentrations are known to be very high The effects were similar in 1646 PBMCs and RAW264.7 cells, indicating its effectiveness on immune cells of different origins Signalling through LPS induces the expression of many cytochemokines and adhesion molecules apart from TNF-a [6], with NF-jB being the prominent transcription factor involved in their regulation Our preliminary studies indicated that RSCL-0409 inhibited the mRNA expression of pro-inflammatory genes ICAM-1, Cox-2 and IL-8 Hence, we postulated that RSCL-0409 might suppress the activation of NF-jB, as the above are regulated through it RSCL-0409 inhibited translocation into the nucleus and suppressed NF-jB-dependent reporter gene expression, indicating the inhibitory action of RSCL-0409 at the promoter level On the basis of these results, it appeared that RSCL-0409 acted upstream of IKK phosphorylation In order to delineate the probable site of action of RSCL-0409, we decided to check the upstream accessory and adaptor molecules LPS signalling through the activation of TLRs is very well established, with TLR4 largely implicated as the prominent mammalian LPS sensor [24] Simultaneously, studies have also implicated TLR2 mediating LPS signalling in cells [25,26] Furthermore, Aderem & Ulevitch [27] postulated that in RAW cells, the oligomerization of TLR receptors created functionally distinct LPS-specific signalling receptors unlike the existing conventionally accepted CD14–TLR4 pathway involved in the activation of NF-jB leading to TNF-a expression in RAW cells [28], where they showed TLR6 and TLR2 co-operating in the signalling process In addition, there are documented reports that TLR2, -3, -4 and -9 recognize peptidoglycan, poly (I:C), LPS and CpG DNA, respectively [29–31] In order to identify and delineate the probable mechanism of action of RSCL-0409, we studied the ability of various TLR ligands for cytokine TNF-a production in the presence of RSCL-0409 We were able to detect TNF-a secretion in cells stimulated with TLR1 ⁄ 2, TLR4 and TLR6 TLR3, -7, -8 and -9 are known to predominantly secrete interferon-a [1] We speculate that it might be the reason for not having detectable levels of TNF-a following stimulation with these ligands in our system Analysing our data, we observed RSCL-0409’s selectivity to suppress TLR1 ⁄ 2- and TLR4-mediated TNF-a production in THP-1-stimulated cells Similar results were noted in human PBMCs However, we did not see any inhibitory effects on TNF-a released due to TLR6 ligand stimulation TLR1 ⁄ ligand from the kit is Pam3CSK, a synthetic tripalymitoyl lipopeptide, which is known to potentially activate monocytes and macrophages [32] and TLR6 is a macrophage-stimulating lipopeptide-2 [33] known to activate the cells when it FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS M D Kalluri et al heterodimerizes with TLR2 In addition, we have ruled out any likely contamination in TLR2 agonist by endotoxin ⁄ LPS by thorough assessment using the Limulus amoebocyte lysate Therefore, it is plausible that RSCL0409 inhibits cytokine TNF-a production induced by an additive process of TLR2 and TLR4 Corroborating these data are the results observed in RAW cells, when we evaluated the nitrite levels following stimulation with TLR ligands Thus, the data suggest that RSCL-0409 suppresses the activation of cells by TLRs, probably an upstream event in TLR1 ⁄ 2-, TLR4-mediated signalling, and has the ability to recognize a lipopeptide LPS signalling through TLRs involves four adaptor molecules, MyD88, TIRAP, TRIF and TRAM [34] Furthermore, two signalling pathways, MyD88-dependent and MyD88-independent pathways, have been elucidated downstream of TLR2 and TLR4 [35–37] The downstream signalling is quite complex and comprises IRAK1–IRAK4–TNFR-associated factor (TRAF6), which transmits the signals to the TAK1 and IKK complex [1] This activates the p65–p50 NF-jB heterodimer complex, which translocates signals into the nucleus and transcribes the NF-jB transcription factor, which initiates the transcription of inflammatory mediators [38] We checked the mRNA expression of the genes involved in this signalling process following LPS stimulation with and without pretreatment of RSCL-0409 Preliminary data showed that RSCL-0409 downregulated TIRAP, IRAK1 and IRAK4 mRNA levels together with TIRAP and MyD88 protein levels (data not shown) TRAF6, which did not show any visible upregulation upon LPS stimulation, remained unaffected with RSCL-0409 pretreatment Documented evidence shows that recruitment of the adaptors involved in TLR signalling could lead to the activation of multiple intracellular cascades, including extracellular signal-regulated kinases, c-Jun N-terminal kinases, p38 and NF-jB, involving their phosphorylation [39,40] Therefore, we determined the effect of RSCL-0409 on LPS-induced phosphorylation of mitogen-activated protein kinases, extracellular signal-regulated kinase and p38 However, we did not observe any effect on their phosphorylation (unpublished data) There are reports of some antagonists, such as 6-shogaol, the most bioactive component of ginger [41], curcumin [42] and garlic extracts [43], inhibiting TLR-mediated signalling by inhibiting the dimerization of TLR4, a process that activates downstream signalling pathways We are currently evaluating this possibility In addition, we are also studying other possible targets, such as the TLR4 coreceptor MD2, which directly binds the disaccharide moiety of lipid A [44] Because cell signalling is a complex mechanism involving several interrelated processes, we are not ruling out other possible RSCL-0409 inhibits LPS-induced TLR signalling mechanisms of NF-jB- or TLR-mediated signalling inhibition On the basis of the current evidence, we set forth to test RSCL-0409’s efficacy in an in vivo model TNF-a plays a pivotal role as a mediator of the host’s response to LPS infection Therefore, blocking or antagonizing TNF-a in sepsis or a sepsis-like condition will definitely have immense therapeutic potential Our studies in Balb ⁄ C in LPS-induced TNF-a secretion followed a pattern reported by many investigators, with TNF-a levels peaking around 60–90 (unpublished data) However, pretreatment with RSCL-0409 at doses of 10 and 20 mgỈkg)1 significantly reduced TNF-a production, reconfirming our in vitro data Furthermore, treatment with RSCL-0409 alone or placebo did not lead to any detectable levels of TNF-a, implicating the specificity of the TNF-a inhibition due to RSCL-0409 However, we would also like to point out that the LPS dose (225 lg mice)1) is similar to that given for the septic shock model Because we had observed that RSCL-0409 exhibited the ability to inhibit TNF-a secretion at LPS doses of mgỈmL)1 we also looked at the effect of RSCL-0409 in preventing lethality induced by septic shock at two doses, 25 and 50 mgỈkg)1 We observed an  33 and 67% increase in survival ability in mice over a 30 h period (unpublished data) at respective doses In this context, our result has tremendous clinical application potential in attenuating LPS-mediated TNF-a, a property useful in delaying the onset of sepsis In conclusion, we have clearly demonstrated that RSCL-0409 prevents the expression of NF-jB-regulated genes in monocytes through a TLR-dependent process Preliminary data suggest that the inhibitory effect is exerted via the MyD88-dependent signalling cascade Investigations are continuing to elucidate the specific target molecule for RSCL-0409 RSCL-0409 is definitely a good candidate and further studies evaluating its potential therapeutic applications are in progress Materials and methods Materials RSCL-0409 (Fig 1A) was synthesized at Reliance Life Sciences (Navi Mumbai, Maharashtra, India) The synthesis was carried out by coupling glycosyl donor 2, 3-di-Oacetyl-4-O-chloroacetyl-6-O-levulinoyl-b-d-glucopyranosyl trichloroacetimidate with glycosyl acceptor 1-O-(p-methoxyphenyl)-2-deoxy-2-trichloroacetamido-4, 6-O-benzylidene-ad-glucopyranose using Lewis acid The crude product was purified using a silica gel column (40% ethyl acetate in hexane) to give disaccharide RSCL-0409 (91%) Rf 0.62 (50% ethyl acetate ⁄ hexane) The column-purified RSCL-0409 was FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS 1647 RSCL-0409 inhibits LPS-induced TLR signalling crystallized in ethyl acetate ⁄ hexane HPLC analysis of the purified compound showed  98.5% purity (Fig 1B) The compound was dissolved in dimethylsulfoxide at a stock concentration of 10 mm, aliquoted and stored at )20 °C Individual aliquots were used for carrying out the in vitro and in vivo assays All procedures were carried out using anhydrous solvents purchased from commercial sources and used without further purification Chromatographic separations were performed on silica gel using the solvent system indicated All reactions were monitored by TLC using precoated silica gel plates (Merck, Whitehouse Station, NJ, USA) Purity and yields were checked by chromatography and spectroscopy LPS (from E coli serotype O55: B5) was obtained from Sigma-Aldrich (St Louis, MO, USA) Penicillin, streptomycin, RPMI 1640 medium, sodium pyruvate and fetal bovine serum were obtained from Gibco (part of Invitrogen, Carlsbad, CA, USA) Tris, glycine, b-mercaptoethanol, glucose, sodium bicarbonate, NaCl, SDS, BSA, LPS and MTT were obtained from Sigma-Aldrich Polyclonal antibody anti-p65 was obtained from Cell Signaling Technology (Beverly, MA, USA) Anti-rabbit secondary horseradish peroxidase was obtained from Jackson Immuno Research (West Grove, PA, USA) Trizol was obtained from Invitrogen (Carlsbad, CA, USA) Chemiluminescence ECL was purchased from Amersham (Arlington Heights, IL, USA) The TNF-a Duo-Set ELISA detection kit was obtained from R&D Systems; TLR ligands (1–9) were purchased from Apotech (Enzo Life Sciences, Geneva, Switzerland) Quanti Blue was purchased from Invivogen (San Diego, CA, USA) PCR kits were obtained from Abgene (Epsom, UK) The cDNA synthesis kit was obtained from ABI Systems (Weiterstadt, Germany) All other reagents and chemicals were purchased from Sigma, unless stated otherwise Cells The THP-1 promonocytic cell line and RAW264.7 cells obtained from ATCC (Manassas, VA, USA) were cultured in RPMI 1640 and DMEM, respectively, containing 10% heat-inactivated fetal bovine serum supplemented with 1% penicillin ⁄ streptomycin, as suggested by ATCC, in a 5% CO2 humid atmosphere at 37 °C THP-1 blue CD14, purchased from Invivogen, overexpress CD14 and were stably transfected with a NF-jB inducible reporter plasmid system expressing a SEAP The culture conditions were similar to normal THP-1 cells with the addition of Zeocin and Blasticidin antibiotics in the culture media Human PBMCs were isolated from peripheral blood obtained from healthy human volunteers (as per the procedure approved by the appropriate regulatory committee) by density gradient centrifugation using HistoPaque-1077 (Sigma-Aldrich) and suspended in RPMI 1640 medium containing 10% heatinactivated fetal bovine serum, 100 mL)1 penicillin G and 100 lgỈmL)1 streptomycin 1648 M D Kalluri et al Treatment of the cells for quantification of TNF-a THP-1 cells were plated at a density of · 105 cells per well in 96-well culture plates and incubated overnight The cells in freshly replenished serum-free RPMI media were stimulated with various TLR ligands [TLR1 ⁄ (Poly I:C) (Pam3CSK4.3HCl) 75 ngỈmL)1, TLR3 75 lgỈmL)1, TLR4 (LPS from E coli) 750 ngỈmL)1, TLR5 (purified flagellin) 75 ngỈmL)1, TLR6 (Malp-2) 75 ngỈmL)1, TLR7 ⁄ [Poly(U) potassium salt] 7.5 lgỈmL)1 and TLR9 (CpG ODN 2395) 7.5 lgỈmL)1], LPS (250 ngỈmL)1) for 24 h in the presence or absence of RSCL-0409 (50 lm) Culture supernatants were collected by spinning down the cells and the medium collected and stored at )80 °C until further use The amount of secreted TNF-a in the supernatants was assayed using specific Duo-Set ELISA development systems (R&D Systems) according to the manufacturer’s instructions For assays involving PBMCs and RAW264.7 cells, the 96-well plates were similarly seeded at a density of · 105 cellsỈwell)1 A similar protocol was followed for assaying TNF-a in these cells For all experiments, RSCL-0409 was dissolved in dimethylsulfoxide, diluted with appropriate medium and added to the cells h before any stimulation Measurement of nitrite RAW264.7 cells provide an excellent model for evaluations of potential inhibitors on the pathway leading to the induction of inducible nitric oxide synthase and NO production NO production was determined in RAW264.7 cells from the National Center of Cell Science (NCCS, Pune, India) cultured in colour-free Dulbecco’s modified Eagle’s medium with standard supplements by measuring the amount of nitrite from the cell culture supernatant RAW264.7 cells (5 · 104 per well) were stimulated for 24 h with RSCL-0409 and ligands alone for TLRs, 75 ngỈmL)1 Pam3CSK4 for TLR2 ⁄ TLR1, 75 lgỈmL)1 poly (I:C) for TLR3, 250 ngỈmL)1 LPS for TLR4, 75 ngỈmL)1 Malp-2 for TLR6, 10 lm R-848 for TLR7 ⁄ and 7.5 lgỈmL)1 CpG ODN 2395 for TLR9 in the presence of 0.1 ngỈmL)1 mouse interferon-c for 24 h Nitrite was then measured using the Griess reaction One hundred microlitres of cell culture supernatant was reacted with 100 lL Griess reagent followed by spectrophotometric measurement at 540 nm Nitrite concentrations in the supernatants were determined by comparison with a sodium nitrite standard curve Cell viability assay Cell viability was assessed by morphology and by reduction of the tetrazolium salt MTT by mitochondrial dehydrogenases, according to the manufacturer’s instructions (Sigma) Cytotoxicity studies were performed in 96-well plates THP-1 cells (2 · 105 cells per well) were seeded RSCL- FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS M D Kalluri et al RSCL-0409 inhibits LPS-induced TLR signalling 0409 (1–100 lm) was added to the cells, and the plates were incubated for 24 h The cells were then washed once before adding 50 lL fetal bovine serum-free medium containing MTT (5 mgỈmL)1) After h of incubation at 37 °C, the medium was discarded and the formazan blue that formed in the cells was dissolved in dimethylsulfoxide The absorbance was measured at 570 nm using a powerwave Xs from Biotek Instruments (Winooski, VT, USA) p65NF-jB bands was normalized by tubulin The bands obtained were quantitated using imagej software version 1.42 Real-time quantitative PCR analysis of TNF-a and IL-6 expression Nuclear extracts were prepared from THP-1 cells according to the modified procedure of Dignam et al [45] Briefly, · 106 cells were pretreated with RSCL-0409 for h followed by LPS treatment for 30, 60 and 120 Following incubation, the cells were lysed in 400 lL lysis buffer (10 mm Hepes pH 7.9, 100 mm KCl, 1.5 mm MgCl2, 0.1 mm EGTA, 0.5 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride, 0.5% Nonidet P-40 and lLỈmL)1 protease inhibitor cocktail; Calbiochem, La Jolla, CA, USA) The homogenate was centrifuged in a microfuge at 10 000 g for The supernatant was discarded, and the nuclear pellet was resuspended in 50 lL nuclear extraction buffer (10 mm Hepes pH 7.9, 1.5 mm MgCl2, 420 mm NaCl, 0.1 mm EGTA, 0.5 mm dithiothreitol, 5% glycerol, 0.5 mm phenylmethanesulfonyl fluoride and lLỈmL)1 protease inhibitor cocktail) with intermittent mixing in ice The nuclear extract was obtained by centrifuging at 10 000 g for 10 at °C The concentration of protein in each sample was then quantified using the Bradford method (Bio-Rad, Hercules, CA, USA) Western blot analysis was carried out to check for p65 levels in the extracts THP-1 cells seeded at a density of · 106 cellsỈwell)1 in a six-well plate were stimulated with 250 ngỈmL)1 LPS in the presence or absence of RSCL-0409 (50 lm) for h Total RNA was isolated from these cells and cDNA was synthesized LPS-treated cells acted as a positive control All quantitative real-time PCR (TaqManÔ) primers and probes were obtained from Applied Biosystems (Weiterstadt, Germany) For the detection of TNF-a, IL-6 and internal control b-actin predeveloped assay reagents were used The PCR was performed utilizing lL cDNA per reaction in triplicates of 25 lL volume on an ABI 7500 real-time PCR machine using a two-step PCR protocol after the initial denaturing of the cDNA (10 at 95 °C) with 40 cycles of 95 °C for 15 s and 60 °C for The universal master mix, as obtained from Applied Biosystems, included all reagents, including Taq-polymerase, apart from specific primers and probes All amplification batches included no template controls Quantitation of mRNA was performed using the comparative threshold cycle method The highest control level attained by the stimulation (without RSCL-0409) was regarded as 100%, and the levels of the control group at other time points and the RSCL-0409-added group were expressed as a percentage of the highest control level Data were analysed using standard software Western blot analysis RT-PCR analysis Preparation of nuclear extracts )1 THP-1 cells at · 10 cellsỈmL in serum-free RPMI 1640 medium were incubated with LPS (250 ngỈmL)1) for different time points Where indicated, THP-1 monocytes were incubated with RSCL-0409 for 60 before LPS treatment Cells were lysed following incubation in RIPA buffer (1· phosphate-buffered saline, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, mm sodium orthovanadate, 10 lgỈmL phenylmethanesulfonyl fluoride and lLỈmL)1 protease inhibitor cocktail) The protein concentration in each sample was quantified using the Bradford method Twenty-five micrograms of protein were size fractionated in a 10% SDS ⁄ PAGE gel and transferred to a nitrocellulose membrane (BioTraceNT, Pall Corporation, Port Washington, NY, USA) Blots were probed with an anti-p65 IgG (Cell Signaling Technology) Horseradish peroxidase-conjugated secondary antibodies were used to develop the membrane and visualization of the bands was performed using a chemiluminescent substrate (Amersham) Blots were stripped and reprobed with tubulin to normalize the protein loading Quantification of THP-1 cells (3 · 106 cells) were seeded in a six-well dish The cells were treated with RSCL-0409 (50 lm) for h followed by incubation with or without 250 ngỈmL)1 LPS After two washes with ice-cold phosphate-buffered saline, the cells were harvested and total cellular RNA was isolated using TRIZOL Reagent (Invitrogen) according to the manufacturer’s instructions cDNA synthesis was carried out using a high capacity cDNA reverse transcription kit (ABI Systems) Amplification of ICAM-1, Cox-2 and IL-8 genes from the cDNA was carried out using the respective gene-specific primers: ICAM-1 5¢- CTGATGGGCAGTCAACAGCTAAAA - 3¢(sense) 5¢- TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT- 3¢ (sense) 5¢- GGTAGATCATCTCTGCCTGAGTATC - 3¢ (antisense), IL-8 5¢- GCCAAGGAGTGCTAAAGAACTTAG -3¢ (sense) FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS 1649 RSCL-0409 inhibits LPS-induced TLR signalling 5¢- GAATTCTCAGCCCTCTTCAAAAAC -3¢ (antisense) b-actin, an internal control, was also amplified using the following primers: 5¢- TCC TCC CTG GAG AAG AGC TA - 3¢ (sense) 5¢- AGT ACT TGC GCT CAG GAG GAC – 3¢ (antisense) Furthermore, the TLR-related genes (TIRAP, IRAK-1, IRAK-4 and TRAF6) were amplified from the cDNA extracted from a similar experimental set using the respective gene-specific primers [46] The amplified PCR products were then analysed on a 2% agarose gel electrophoresis and visualized under UV with ethidium bromide Quantification of bands for the specific genes was normalized by b-actin CA, USA) The Neuman–Keuls test was used for multiple comparisons Values of P < 0.05 were considered as significant Acknowledgements The authors gratefully acknowledge the encouragement and support of Reliance Life Sciences Pvt Ltd, in carrying out the research work PD and SU were part of Reliance Life Sciences Pvt Ltd when the work was undertaken Their current affiliation is indicative of their current address only, and not to be understood as collaborative work References Quanti Blue assay The Quanti Blue assay is a reporter-based assay system to determine the SEAP activity in supernatants of cell cultures induced by NF-jB activators such as LPS The assay was carried out as per the manufacturer’s instructions Briefly, THP-1 CD14 blue cells were plated and cultured overnight in 96-well plates (2 · 105 cellsỈwell)1) These cells were stimulated with LPS in the presence and absence of RSCL-0409 (50 lm) Culture supernatants were collected 24 h after LPS stimulation and the SEAP activity was determined using Quanti Blue reagent (Invivogen) The change in media colour to purple-blue was quantitated by measuring the absorbance at 625–655 nm The data was expressed relative to SEAP In vivo experiments: LPS-induced TNF-a release in Balb ⁄ c mice Specific pathogen-free female Balb ⁄ c mice (5–6 weeks) were injected with LPS (225 lg) intraperitoneally with and without pretreatment with two concentrations of RSCL0409 (10 and 20 mgỈkg)1) given intraperitoneally 30 before LPS treatment RSCL-0409 injected alone served as the negative control Blood collection was carried out retro-orbitally under anaesthesia h after LPS injection The serum collected was analysed for TNF-a secretion using individual Duo-Set ELISA (R&D Systems) according to the manufacturer’s instructions The local animal research board committee, Committee for the Purpose of Control and Supervision of Experiments on Animals, and the Institutional Animal Ethics Committee approved these studies Statistical analysis A statistical analysis of the responses obtained from control and LPS-treated THP-1 cells was conducted by one-way ANOVA using instat software (GraphPad La Jolla, 1650 M D Kalluri et al Kawai T & Akira S (2006) TLR signaling Cell Death Differ 13, 816–825 Hirschfeld M, Weis JJ, Toshchakov V, Salkowski CA, Cody MJ, Ward DC, Qureshi N, Michalek SM & Vogel SN (2001) Signaling by Toll-like receptor and agonists results in differential gene expression in murine macrophages Infect Immun 69, 1477–1482 Wyllie DH, Kiss-Toth E, Visintin A, Smith SC, Boussouf S, Segal DM, Duff GW & Dower SK (2001) Evidence for an accessory protein function for Toll-like receptor in anti-bacterial responses J Immunol 165, 7125–7132 Wright SD, Ramos RA, Tobias PS, Ulevitch RJ & Mathison JC (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein Science (Wash DC) 249, 1431–1433 da Silva Correia J, Soldau K, Christen U, Tobias PS & Ulevitch RJ (2001) Lipopolysaccharide is in close proximity to each of the proteins in its membrane receptor complex Transfer from CD14 to TLR4 and MD-2 J Biol Chem 276, 21129–21135 Guha M & Mackman N (2001) LPS induction of gene expression in human monocytes Cell Signal 13, 85–94 Akira S, Takeda K & Kaisho T (2001) Toll-like receptors: critical proteins linking innate and acquired immunity Nat Immunol 2, 675–680 Fitzgerald KA, Palsson-McDermott EM, Bowie AG, Jefferies CA, Mansell AS, Brady G, Brint E, Dunne A, Gray P, Harte MT et al (2001) Mal (MyD88-adapterlike) is required for Toll-like receptor-4 signal transduction Nature 413, 78–83 Silverman N & Maniatis T (2001) NF-jB signaling pathways in mammalian and insect innate immunity Genes Dev 15, 2321–2342 10 Raza A (2000) Anti-TNF therapies in rheumatoid arthritis, Crohn’s disease, sepsis and myelodysplastic syndromes Microsc Res Tech 50, 229–235 11 Hehlgans T & Pfeffer K (2005) The intriguing biology of the tumour necrosis factor ⁄ tumour necrosis factor FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS M D Kalluri et al 12 13 14 15 16 17 18 19 20 21 22 23 receptor superfamily: players, rules and the games Immunology 115, 1–20 Wang Q, McLoughlin RM, Cobb BA, Charrel-Dennis M, Zaleski KJ, Golenbock D, Tzianabos AO & Kasper DL (2006) A bacterial carbohydrate links innate and adaptive responses through Toll-like receptor J Exp Med 203, 2853–2863 Termeer C, Benedix F, Sleeman J, Fieber C, Voith U, Ahrens T, Miyake K, Freudenberg M, Galanos C & Simon JC (2002) Oligosaccharides of hyaluronan activate dendritic cells via Toll-like receptor J Exp Med 195, 99–111 Monari C, Bistoni F, Casadevall A, Pericolini E, Pietrella D, Kozel TR & Vecchiarelli A (2001) Glucuronoxylomannan, a microbial compound, regulates expression of costimulatory molecules and production of cytokines in macrophages J Infect Dis 91, 127–137 Romagne F (2007) Current and future drugs targeting one class of innate immunity receptors: the Toll-like receptors Drug Discov Today 12, 80–87 Ii M, Matsunaga N, Hazeki K, Nakamura K, Takashima K, Seya T, Hazeki O, Kitazaki T & Iizawa Y (2006) A novel cyclohexene derivative, ethyl (6R)-6-[N-(2chloro-4-fluorophenyl) sulfamoyl]cyclohex-1-ene-1carboxylate (TAK-242), selectively inhibits toll-like receptor 4-mediated cytokine production through suppression of intracellular signaling Mol Pharmacol 69 1288–1295 Mullarkey M, Rose JR, Bristol J, Kawata T, Kimura A, Kobayashi S, Przetak M, Chow J, Gusovsky F, Christ WJ et al (2003) Inhibition of endotoxin response by E5564, a novel Toll-like receptor 4-directed endotoxin antagonist J Pharmacol Exp Ther 304, 1093–1102 Christ WJ, Asano O, Robidoux AL, Perez M, Wang Y, Dubuc GR, Lewis MD, Kishi Y, Kawata T, Bristol JR et al (1995) E5531, a pure endotoxin antagonist of high potency Science (Wash DC) 268, 80–83 Rossignol DP & Lynn M (2002) Antagonism of in vivo and ex vivo response to endotoxin by E5564, a synthetic lipid A analogue J Endotoxin Res 8, 483–488 Fort MM, Mozaffarian A, Stover AG, da Silva Correia J, Johnson DA, Crane RT, Ulevitch RJ, Persing DH, Bielefeldt-Ohmann H, Probst P et al (2005) A synthetic TLR4 antagonist has anti-inflammatory effects in two murine models of inflammatory bowel disease J Immunol 174, 6416–6423 Sugiyama K, Muroi M & Tanamoto K (2008) A novel TLR4-binding peptide that inhibits LPS-induced activation of NF-jB and in vivo toxicity Eur J Pharmacol 594, 152–156 Ziegler-Heitbrock HW & Ulevitch RJ (1993) CD14: cell surface receptor and differentiation marker Immunol Today 14, 121–125 Triantafilou M, Triantafilou K & Fernandez N (2006) Rough and smooth forms of fluorescein-labelled RSCL-0409 inhibits LPS-induced TLR signalling 24 25 26 27 28 29 30 31 32 33 34 35 36 bacterial endotoxin exhibit CD14 ⁄ LBP dependent and independent binding that is influenced by endotoxin concentration Eur J Biochem 267, 2218–2226 Beutler B (2000) TLR4: central component of the sole mammalian LPS sensor Curr Opin Immunol 12, 20–26 Yang RB, Mark MR, Gray A, Huang A, Xie MH, Zhang M, Goddard A, Wood WI, Gurney AL & Godowski PJ (1998) Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signaling Nature 395, 284–288 Werts C, Tapping RI, Mathison JC, Chuang TH, Kravchenko V, Saint Girons I, Haake DA, Godowski PJ, Hayashi F, Ozinsky A et al (2001) Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism Nat Immunol 2, 346–352 Aderem A & Ulevitch RJ (2000) Toll-like receptors in the induction of the innate immune response Nature 406, 782–787 Ozinsky A, Underhill DM, Fontenot JD, Hajjar AM, Smith KD, Wilson CB, Schroeder L & Aderem A (2000) The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors Proc Natl Acad Sci USA 97, 13766–13771 Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, Takeda K & Akira S (1999) Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components Immunity 11, 443–451 Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K et al (2000) A Toll-like receptor recognizes bacterial DNA Nature (Lond) 408, 740–745 Alexopoulou L, Holt AC, Medzhitov R & Flavell RA (2001) Recognition of double-stranded RNA and activation of NF-jB by Toll-like receptor Nature (Lond) 413, 732–738 Takeda K, Takeuchi O & Akira S (2002) Recognition of lipopeptides by Toll-like receptors J Endotoxin Res 8, 459–463 Sandor F, Latz E, Re F, Mandell L, Repik G, Golenbock DT, Espevik T, Kurt-Jones EA & Finberg RW (2003) Importance of extra- and intracellular domains of TLR1 and TLR2 in NF-kappa B signaling J Cell Biol 162, 1099–1110 Dunne A & O’Neill LA (2005) Adaptor usage and Tolllike receptor signaling specificity FEBS Lett 579, 3330– 3335 Yamamoto M, Sato S, Hemmi H, Uematsu S, Hoshino K, Kaisho T, Takeuchi O, Takeda K & Akira S (2003) TRAM is specifically involved in the Toll-like receptor 4-mediated MyD88-independent signaling pathway Nat Immunol 4, 1144–1150 Fitzgerald KA, Rowe DC, Barnes BJ, Caffrey DR, Visintin A, Latz E, Monks B, Pitha PM & Golenbock FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS 1651 RSCL-0409 inhibits LPS-induced TLR signalling 37 38 39 40 41 DT (2003) LPS-TLR4 signaling to IRF-3 ⁄ and NF-jB involves the toll adapters TRAM and TRIF J Exp Med 198, 1043–1055 Oshiumi H, Matsumoto M, Funami K, Akazawa T & Seya T (2003) TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta induction Nat Immunol 4, 161–167 Hayden MS & Ghosh S (2004) Signaling to NF-kappaB Genes Dev 18, 2195–2224 Kong L & Ge BX (2008) MyD88-independent activation of a novel actin-Cdc42 ⁄ Rac pathway is required for Toll-like receptor-stimulated phagocytosis Cell Res 18, 745–755 Han J (2006) MyD88 beyond Toll Nat Immunol 7, 370–371 Ahn SI, Lee JK & Youn HS (2009) Inhibition of homodimerization of toll-like receptor by 6-shogaol Mol Cells 27, 211–215 1652 M D Kalluri et al 42 Youn HS, Lim HJ, Lee HJ, Hwang D, Yang M, Jeon R & Ryu JH (2008) Garlic (Allium sativum) extract inhibits lipopolysaccharide-induced Toll-like receptor dimerization Biosci Biotechnol Biochem 72 368–375 43 Youn HS, Saitoh SI, Miyake K & Hwang DH (2006) Inhibition of homodimerization of Toll-like receptor by curcumin Biochem Pharmacol 72, 62–69 44 Gangloff M & Gay NJ (2000) MD-2: the Toll ‘gatekeeper’ in endotoxin signaling Trends Biochem Sci 29, 6294–6300 45 Dignam JD, Lebovitz RM & Roeder RG (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei Nucleic Acids Res 11, 1475–1489 46 Nishimura M & Naito S (2005) Tissue-specific mRNA expression profiles of human toll-like receptors and related genes Biol Pharm Bull 28, 886–892 FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd Journal compilation ª 2010 FEBS ... the cDNA was carried out using the respective gene-specific primers: ICAM-1 5¢- CTGATGGGCAGTCAACAGCTAAAA - 3¢(sense) 5¢- TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT-... goal was to use the available data to design novel selective carbohydrate-based, especially disaccharide-like molecules, that could serve either as agonists or antagonists of TLR signalling pathways... Today 12, 8 0–8 7 Ii M, Matsunaga N, Hazeki K, Nakamura K, Takashima K, Seya T, Hazeki O, Kitazaki T & Iizawa Y (2006) A novel cyclohexene derivative, ethyl (6R)-6-[N-(2chloro-4-fluorophenyl) sulfamoyl]cyclohex-1-ene-1carboxylate