Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

... lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist Mani D. Kalluri 1, *, Praneel Datla 2, *, Akshaya Bellary 1, *, Khalander Basha 1 , Ashwani Sharma 1 , Anuradha Sharma 1 , Shiva Singh 1 , ... primers: ICAM-1 5¢- CTGATGGGCAGTCAACAGCTAAAA - 3¢(sense) 5¢- TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT- 3¢ (sense) 5¢- GGTAGATCATCTCTG...

Ngày tải lên: 22/03/2014, 21:20

... 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as mole- cular mass markers. K. Komaru et al. Novel aggregate formation of an alkaline ... Herscovics A & Nagata K (2001) A Novel aggregate formation of an alkaline phosphatase frame-shift mutant K. Komaru et al. 1716 FEBS Journal 272 (2005) 170 4–1 717 ª 2005 FEBS novel...

Ngày tải lên: 19/02/2014, 17:20

... Nakagawa T, Kita A, Sasayama Y, Fuku- mori Y & Miki K (2005) Crystallization and prelimin- ary X-ray crystallographic analysis of extracellular giant hemoglobin from pogonophoran Oligobrachia ... quaternary structure of Arenicola marina HBL-Hb has been proposed by Zal and collaborators based on electrospray ionization (ESI)-MS analysis and multiangle laser light scattering (MALLS) meas-...

Ngày tải lên: 23/03/2014, 10:21

... this paper will be described in more detail. 2.1 Aggregate Analysis of Bulgarian Dialectometry produces aggregate analyses of the dialect variations and has been done for different languages. ... Multidimensional scaling is data analysis technique that provides a spatial display of the data revealing relationships between the instances in the data set (Davison, 1992). On both the maps the b...

Ngày tải lên: 20/02/2014, 12:20

... MajSimpleSgl and MajSimplePair in a majority vote with MajAggr (in MajSgl+Aggr 8 A pair cast a vote for asense if, amongall the senses of a verb, aspecificsensehadthe highest value for bothmeasures. Variation ... tokens in a text corpus. Second, we take an “all-words”rather than a “lexical-sample” approach (Kilgarriff and Rosenzweig, 2000): All words in the lexical database “text”...

Ngày tải lên: 20/02/2014, 18:20

... syntactic and semantic ambiguity as part of the same parse chart. These parse charts can be seen as regular tree grammars that accept the lan- guage of parse trees, and conceivably an RTG that describes ... po- sitions in a string. Tree automata are related to tree transducers as used e.g. in statistical machine trans- lation (Knight and Graehl, 2005) exactly like finite- state string automa...

Ngày tải lên: 23/03/2014, 17:20

... human analysts) were actually causal relations that were not medically relevant. As mentioned earlier, the manual iden- tification of causal relations focused on medi- cally relevant causal relations. ... domains (15 each) – digestive system diseases and respi- ratory tract diseases. Each test abstract was analyzed by at least 2 of the authors to identify “medically relevant” cause and ef...

Ngày tải lên: 31/03/2014, 04:20

... recognition, chromatin modulation and gene expression Hiroshi Sakurai and Yasuaki Enoki Department of Clinical Laboratory Science, Kanazawa University Graduate School of Medical Science, Ishikawa, Japan Background The ... protein–DNA interactions Correspondence H. Sakurai, Department of Clinical Laboratory Science, Kanazawa University Graduate School of Medical Science, 5-11-80 Kodatsuno, Kan...

Ngày tải lên: 18/02/2014, 04:20

... primers 5¢-AAATA TAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGC GTAAAGGATGGGGAAAG-3¢. The final ratio of target cells was determined by counting the number of colonies retaining the target genes. Acknowledgements This ... episomal plas- mid caused by signalling in yeast. J Biochem 143, 66 7–6 74. 22 Ishii J, Izawa K, Matsumura S, Wakamura K, Tanino T, Tanaka T, Ogino C, Fukuda H & Kondo A (...

Ngày tải lên: 05/03/2014, 23:20

... siRNA ZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢ and 5¢-GAGUUUCUCAUGCUUCCU CUU-3¢) matched bases 94 5–9 63; and the third siRNA ZF5 (5¢-GGUCCUGAACUACAUGUACUU-3¢ and 5¢-GUAC AUGUAGUUCAGGACCUU-3¢) matched bases ... primers (5¢-GGCCTTCAAGGCATTAAG-3¢,5¢-AAACAAATGG CCTGTCCG-3¢) spanned a 958 bp 5¢-part of the ZF5 coding region; the second pair (5¢-CCCCTCAAGCCTT AACAT-3¢,5¢-TCTCCACTTTCCAGGCAA-3¢) spanne...

Ngày tải lên: 07/03/2014, 05:20