intra articular lentivirus mediated gene therapy targeting cracm1 for the treatment of collagen induced arthritis

Journal of Pharmacological Sciences xxx (2017) 1e9 Contents lists available at ScienceDirect Journal of Pharmacological Sciences journal homepage: www.elsevier.com/locate/jphs Full paper Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collagen-induced arthritis Shuang Liu a, *, Takeshi Kiyoi b, Erika Takemasa a, Kazutaka Maeyama a a b Department of Pharmacology, Ehime University Graduate School of Medicine, Shitsugawa, Toon-shi, Ehime 791-0295, Japan Department of Bioscience, Integrated Center for Sciences, Ehime University, Shitsukawa, Toon-shi, Ehime, 791-0295, Japan a r t i c l e i n f o a b s t r a c t Article history: Received 18 August 2016 Received in revised form 16 January 2017 Accepted February 2017 Available online xxx Abnormal store-operated calcium uptake has been observed in peripheral T lymphocytes of rheumatoid arthritis (RA) patients, and sustained intracellular calcium signalling is known to mediate the functions of many types of immune cells Thus, it is hypothesized that regulating calcium entry through CRACM1 (the pore-forming subunit of calcium release-activated calcium (CRAC) channels; also known as ORAI1) may be beneficial for the management of RA Localized CRACM1 knockdown in the joints and draining lymph nodes (DLNs) of mice with collagen-induced arthritis (CIA) was achieved via lentiviral-based delivery of shRNA targeting mouse CRACM1 Consistent with CRACM1 knockdown, calcium influx in synovial cells and the histopathological features of CIA were reduced These effects were also associated with reduced levels of several notable inflammatory cytokines, such as IL-6, IL-17A, and IFN-g, in the joints Additionally, CRACM1-shRNA reduced the number of bone marrow-derived osteoclasts in vitro as well as osteoclasts in CIA joints, which was associated with reduced RANKL levels in the serum and joints In summary, inhibiting calcium entry by CRACM1 knockdown suppressed arthritis development and may be therapeutically beneficial for RA patients © 2017 The Authors Production and hosting by Elsevier B.V on behalf of Japanese Pharmacological Society This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/ licenses/by-nc-nd/4.0/) Keywords: Intra-articular injection Lentivirus Gene silencing Calcium release-activated calcium channel Collagen induced arthritis Introduction Rheumatoid arthritis (RA) is a systemic autoimmune disease and one of the most prevalent forms of arthritis The treatment of RA has improved dramatically over the past decade since the introduction of disease-modifying antirheumatic drugs (DMARDs) In addition to synthetic chemical compounds, the systemic delivery of biological agents, especially the protein antagonists of tumour necrosis factor (TNF), has helped patients achieve RA remission However, less than 30% of patients show a robust response to these drugs, which are costly and associated with many side effects related to their systemic mode of delivery (1) Moreover, even in responsive patients, individual joints may not respond to therapy Therefore, novel therapies that deliver drugs locally and specifically to a small number of target joints must be considered for the management of RA * Corresponding author E-mail address: liussmzk@m.ehime-u.ac.jp (S Liu) Peer review under responsibility of Japanese Pharmacological Society In recent studies, the regulation of Ca2ỵ entry through a storeoperated Ca2ỵ release-activated channel (CRAC), known as ORAI, has shown benefits in the treatment of RA CRAC activation drives gene expression and promotes growth and proliferation of T cells, B cells, and osteoclasts, which are important cellular targets for the management of RA (2) The modulation of Ca2ỵ entry through the systemic gene silencing of CRACs showed great therapeutic potential for the control of global immune responses in an experimental arthritis model (3) Of the three CRAC homologues, CRAC modulator (CRACM1) is widely expressed in human and murine tissues and is fundamental to cell physiology In our previous cross-sectional study, the expression level and functional status of CRACM1 in peripheral CD4ỵ T cells was increased in active RA patients compared with osteoarthritis patients and healthy donors (4) However, in the experimental arthritis model, systemic high doses or repeated low doses of inhibitors targeting CRACM1 caused severe side effects, including low body weight and splenomegaly, in addition to low survival rates (3) Because normal Ca2ỵ homeostasis is fundamental and its efficiency cannot be achieved via the systemic knockdown of CRACM1, as a new attempt, local immunosuppression by the http://dx.doi.org/10.1016/j.jphs.2017.02.001 1347-8613/© 2017 The Authors Production and hosting by Elsevier B.V on behalf of Japanese Pharmacological Society This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 silencing of CRACM1 may be beneficial in controlling the symptoms of individual joints with RA To investigate the feasibility and efciency of the local regulation of Ca2ỵ entry following treatment, we achieved local gene silencing of CRACM1 using intra-articular lentivirus-delivered short hairpin RNA (shRNA) in a collagen-induced arthritis (CIA) model Systemic and local immunological and pathological assessments were performed to evaluate the therapeutic effects of the regulation of Ca2ỵ entry via CRACM1 in CIA mice Methods 2.1 Lentiviral constructs The lentiviral vectors were produced by the co-transfection of 293T kidney cells with the following three plasmids: (1) a specific vector plasmid encoding shRNA targeting mouse CRACM1 (M1shRNA) (NM_175423) (pLKO.1-puro): CCGGCACAACCTCAACTCG GTCAAACTCGAGTTTGACCGAGTTGAGGTTGTGTTTTTG and a negative control shRNA vector (NCshRNA) (SigmaeAldrich, Tokyo, Japan); (2) the packaging plasmid psPAX2 (Addgene, Cambridge, MA, USA); and (3) the envelope plasmid pMD2.G (Addgene) Lentiviral particles containing M1shRNA and NCshRNA were produced, and their titres were determined using a Lenti-X™ P24 Rapid Titer Kit (Clontech Laboratories, Mountain View, CA, USA) After testing the multiplicity of infection, the lentiviral particles were used for the reported series of experiments and a total score for all limbs was summed for a maximum possible score of 16 per animal The swelling rates of each joint were evaluated using MRI examinations after scoring for signs of arthritis every days, from day 20e50 MRI was performed using a MRmini SA110 scanner (DS Pharma Biomedical, Co., Ltd., Osaka, Japan) The animals were anesthetized using 1.5 vol% isoflurane vapourized in 100% medical oxygen Imaging was performed using a 3-dimensional T2weighted flash sequence The coronal and sagittal images were collected and reconstructed to obtain the volume of the arthritic ankles and forepaws The structural changes of the hind paws were visualized by micro-computed tomography (micro-CT) imaging at day 106 after the first CII immunization The animals were anesthetized using 1.5 vol% isoflurane vapourized in 100% medical oxygen Then, the mice were subjected to micro-CT imaging using a LaTheta LCT-200 CT scanner (Hitachi Aloka Medical, Ltd., Tokyo, Japan), and the projection images were reconstructed into 3-dimensional images using the VGStudio MAX 2.2 software (Volume Graphics, Heidelberg, Germany) Histological examination of the joints was undertaken on day 50 of the experiment after routine fixation, decalcification, and paraffin embedding Tissue sections from the hind knee joints were stained with H&E The slides were evaluated for synovial hypertrophy, formation and cartilage/subchondral bone destruction by two blinded observers Each joint was scored from to 3, and joints were analysed for each animal 2.3 Inflammation-related cytokine measurements 2.2 Intra-articular delivery of CRACM1 shRNA lentivirus in collagen-induced arthritis (CIA) mice and arthritis evaluation Male DBA/1J mice (7e10 weeks of age) were used for the induction of arthritis The mice were bred and maintained under standard conditions The experimental protocols were performed in accordance with the guidelines of the Animal Care Committee of Ehime University and were approved by the University Committee for Animal Research Arthritis was induced as described previously (3) Briefly, the mice were injected subcutaneously (s.c.) with bovine collagen type II (CII; Chondrex, Redmond, WA, USA) emulsified in complete Freund's adjuvant (CFA) containing heat-killed Mycobacterium tuberculosis H37 RA Twenty-one days later, a booster injection of CII emulsified in incomplete Freund's adjuvant (IFA) was administered s.c at the base of the tail To synchronize the onset of arthritis, lipopolysaccharide was injected intraperitoneally (i.p.) on day 28 after the first CII immunization Mice injected s.c with saline were used as a negative control CRACM1-shRNA and Control-shRNA were administered by a single intra-articular injection to each ankle joint of the CIA mice using a virus dose of 108 particles in ml of phosphate-buffered saline on day 21 or day 30 after the first CII immunization On day 35, the number of integrated provirus copies in tissue was determined using a Lenti-X Provirus Quantitation Kit (Clontech Laboratories, Mountain View, CA, USA) Genomic DNA extracted from the tissues of lentivirus-treated mice was subjected to quantitative real-time PCR amplification with a dilution of the calibrated provirus control template according to the manufacturer's instructions Following the development of CIA, the ankle circumferences and the articular indexes of the mice were evaluated every days, from day 20e50, under blinded conditions by two independent examiners Clinical arthritis scores were evaluated from to as follows: ¼ no swelling, ¼ slight swelling and erythema, ¼ moderate swelling and oedema, and ¼ joint rigidity Each limb was graded, For the preparation of murine joint protein extracts, the synovium of the infra-patellar fat pad and joint cartilage was harvested Total proteins were extracted from tissues using a ReadyPrep™ extraction kit in accordance with the manufacturer's instructions (BIO-RAD, Hercules, CA, USA) (5) Cytokine levels in the serum and joint protein extracts were detected on day 50 of the experiment using a bead-based immunoassay with the LEGENDplex™ Mouse Inflammation Panel (Biolegend, San Diego, CA, USA) according to the manufacturer's instructions The lower limits of detection were 1.3 pg/ml for IL-1a, 2.8 pg/ml for IL-1b, 0.9 pg/ml for IL-6, 2.1 pg/ml IL-10, 0.7 pg/ml for IL-12p70, 1.8 pg/ml for IL-17A, 4.2 pg/ml for IL-23, 9.8 pg/ml for IL27, 1.7 pg/ml for MCP-1, 4.0 pg/ml for IFN-b, 0.8 pg/ml for IFN-g, 1.9 pg/ml for TNF-a, and 1.9 pg/ml for GM-CSF 2.4 Cell differentiation of splenocytes and synovial cells Splenocytes were isolated from spleens on day 50 of the experiment using a standard dissection technique and resuspended in RPMI-1640 for staining (6) For the isolation of synovial cells, the synovia in the infra-patellar fat pad of the mice were harvested on day 50 of the experiment and digested in Dulbecco's modified Eagle's medium (SigmaeAldrich, At Louis, MO, USA) containing 0.1% collagenase D and 0.005% deoxyribonuclease I at 37  C for h The digested synovial cells were filtered through a 70-mm cell strainer For the detection of T cell subsets and B cell subsets, splenocytes and synovial cells were stained using a PE-anti-mouse B220 antibody and FITC-anti-mouse CD3 antibody For Th17 cell staining, dispersed cell suspensions from the spleens and synovia were resuspended at  105 cells/ml and incubated with a cell activation cocktail (Biolegend), which consists of optimized concentrations of phorbol 12-myristate-13-acetate, ionomycin, and Brefeldin A, for h After extracellular staining with PE-anti-mouse CD4, the cells were permeabilized with Fix/Perm solution (Biolegend) for 20 at  C The cells were stained with Alexa Fluor 488-anti-mouse IL- Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 17A All the antibodies were obtained from Biolegend The data were acquired on a BD FACSAria (BectoneDickinson, Oakville, ON, Canada) and analysed using FlowJo software (Tree Star Inc., Ashland, OR, USA) 2.5 Calcium influx in splenocytes and synovial cells Single-cell suspensions (105 cell/ml) pooled from the spleen and the synovial membrane were obtained 35 days post-immunization After lyse the red blood cells, the cells were loaded with fura-2-AM, and the assay was performed using a fluorometric imaging plate reader (FLIPR) (FlexStation II, Molecular Devices Japan, Tokyo, Japan) (7) The plates were read for a total of 700 s, including an initial 100-s reading window to measure the baseline fluorescence levels before the application of any compound with a mM-Ca2ỵ bath solution The plates were read for an additional 300 s after 0.5 mM thapsigargin was applied using the FLIPR Then, mM Ca2ỵ was applied to the wells, and the plates were read for an additional 300 s The calcium signals were read using the 340/380 nm excitation and 510 nm emission settings The results are presented as a ratio of RFUs (340 nm/380 nm) and the initial rates of Ca2ỵ inux (in the rst 15 s after Ca2ỵ addition) 2.6 Isolation of differentiated osteoclasts and bone-resorption assay Differentiated osteoclasts were purified using collagen films according to a previous protocol (3) Briefly, bone marrow cells, which include osteoclast precursors, were plated on a type I collagen-coated culture plate on day 50 of the experiment The cells were fed recombinant mouse macrophage colony-stimulating factor (M-CSF) (20 ng/ml) (ProSpec-Tany Technogene Ltd., East Brunswick, NJ, USA) and soluble receptor activator of nuclear factor kappa-B ligand (sRANKL) (200 ng/ml) (ProSpec-Tany Technogene Ltd) every other day One week later, the collagen film was digested with a solution of 0.1% collagenase A The harvested cells were plated on chamber slides or bone slices and fed with M-CSF (20 ng/ ml) and RANKL (250 ng/ml) in a-MEM After 48 h of incubation, the cells that were plated on the chamber slides were stained for tartrate-resistant acid phosphatase (TRAP) using a TRAP/ALP staining kit The bone slices were subjected to Mayer's hematoxylin staining and scanning electron microscopy for pit formation assay 2.7 Statistical analysis All experiments were designed in a completely randomized multifactorial format The results are expressed as the mean ± SEM Repeated measures were probed with analysis of variance  F-test, to evaluate the statistical (ANOVA), followed by the Scheffe significance of the differences according to the arthritis scores and the swelling rates of the arthritic joints Other data were analysed using a two-sample t-test assuming unequal variance P values < 0.05 were considered statistically signicant Results 3.1 The inhibition of Ca2ỵ inux in synovial cells by the local gene silencing of CRACM1 Lentiviral shRNA targeting CRACM1 was intra-articularly administered (2  108 lentiviral particles) to experimental CIA mice The CIA model shares immunological and pathological similarities with human RA, making it useful for RA studies The survival rates for the CRACM1-expressing lentivirus (CRACM1- shRNA)-treated mice and the control-shRNA-expressing lentivirus (Control-shRNA)-treated CIA mice were both 100% The biodistribution of the inoculated vector was described using the number of integrated provirus copies in individual tissue-derived cells (Fig 1a) The majority of the provirus copies were observed in the joints and popliteal lymph nodes (LNs) Few virus copies were detected in the blood, lungs, liver, spleen, and heart Quantitative PCR (qPCR) demonstrated the inhibition of CRACM1 in individual tissues, especially in the synovium and draining LNs (Fig 1b) The lack of gene silencing of CRACM1 in the kidneys, bone marrow, and blood suggests that the lentivirus-mediated gene delivery was limited to specific sites Cell suspensions pooled from spleen, thymus, and knee synovium were obtained 35 days post-immunization for Ca2ỵ inux analysis Intracellular Ca2ỵ was labelled with fura 2, and the oscillation of intracellular Ca2ỵ was reflected by the relative fluorescence units at 340 nm/380 nm (RFU340/380) After the addition of thapsigargin to the mM Ca2ỵ extracellular bath solution, the intracellular Ca2ỵ stores were depleted A sustained increase in the Ca2ỵ inux was observed in thapsigargin-stimulated cells upon the addition of mM Ca2ỵ to the extracellular bath solution According to the RFU340/380 values for each group, the peaks and initial rates of Ca2ỵ inux were higher for the splenocytes, thymocytes, and synovial cells from CIA mice than those from the naive mice (peaks: 1.51-fold, 2.52-fold (P < 0.05), and 2.16-fold (P < 0.05), respectively; influx rates: 1.61-fold, 1.40-fold, and 1.43-fold, respectively) (Fig 1c and d) The Ca2ỵ inux peaks in synovial cells from CRACM1shRNA-treated CIA mice were suppressed to 37.8% (P < 0.05) of the peaks in cells from control-shRNA-treated CIA mice The initial rates of Ca2ỵ inux in the cells from CRACM1-shRNA-treated CIA mice decreased to 19.76% (P < 0.05) of the rates in the cells from control-shRNA-treated CIA mice No significant differences were found in the peaks and initial rates of Ca2ỵ influx in splenocytes and thymocytes from control-shRNA-treated CIA mice and CRACM1shRNA-treated mice These results indicated that Ca2ỵ inux via CRACs in synovialderived cells was suppressed by local lentivirus-mediated CRACM1 silencing Moreover, the influence of the CRACM1shRNA treatment was locally limited 3.2 Intra-articular CRACM1-shRNA reduced CIA severity We next investigated the potential therapeutic application of CRACM1-shRNA in CIA mice Control-shRNA was given on the onset of disease (day 21 post-immunization, day being the day of first immunization), whereas CRACM1-shRNA was given on day 21 or after the onset of arthritis (day 30) A single intra-articular injection of CRACM1-shRNA at disease onset (21 days after the first sensitization) abrogated early symptoms or when arthritis was already established, completely abrogated clinical symptoms (30 days after the first sensitization), significantly reducing further disease (Fig 2a) An intra-articular injection of the lentiviral vector temporarily promoted joint swelling, and the effect was transient (Fig 2b) The administration of CRACM1-shRNA at disease onset delayed the establishment of arthritis but led to a less favourable prognosis compared with injections administered after the disease was established based on the clinical scores and swelling rates (Fig 2a and b) Intra-articular injections of CRACM1-shRNA in CIA mice with full clinical symptoms (30 days after the first sensitization) progressively attenuated the severity of CIA and reduced late bone deformity (60 days after the first sensitization) (Fig 2c) The histopathological analysis of the joints on day 50 of the experiment using haematoxylin/eosin (H&E) staining showed that the delayed administration of CRACM1-shRNA reduced CIA-characteristic Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 Fig CRACM1-shRNA-mediated local inhibition of CRACM1 expression in mice (a) The biodistribution of the inoculated vector Four weeks after the intra-articular delivery of lentiviral particles, the number of integrated provirus copies in individual tissues was determined (b) Real-time PCR amplification of the reverse-transcription products predicted shRNA-mediated mRNA suppression in individual tissues weeks after the intra-articular delivery of lentiviral particles (Control-shRNA vs CRACM1-shRNA; *, P < 0.05; **, P < 0.01; n ¼ 8e10) (c) The Ca2ỵ inux peaks in splenocytes, thymocytes, and synovial cells obtained from naive mice, CRACM1-shRNA-treated mice, control-shRNA-treated CIA mice and CRACM1-shRNA-treated CIA mice Single-cell suspensions (106 cells/ml) were obtained 35 days post-immunization The assay was performed using a fluorometric imaging plate reader (FLIPR) Calcium signals were read using the 340/380 nm excitation and 510 nm emission settings The results are presented as the peak ratio of relative fluorescence units (RFUs) (340 nm/380 nm) (d) The Ca2ỵ inux initial rates (in the rst 15 s after Ca2ỵ addition) in splenocytes, thymocytes, and synovial cells obtained from naive mice, CRACM1shRNA-treated mice, control-shRNA-treated CIA mice and CRACM1-shRNA-treated CIA mice The results are expressed as the mean ± SEM (naive vs CRACM1-shRNA; *, P < 0.05; CIA ỵ Control-shRNA vs CIA ỵ CRACM1-shRNA; **, P < 0.01; n ¼ 5) chronic inflammation, including joint inflammation, cartilage destruction, and bone histomorphometry analysis (Fig 2d and e) Taken together, these results indicated that local gene silencing of CRACM1 at the acme phase decreased arthritis severity and improved prognosis in the CIA murine model 3.3 Reduced infiltration of inflammatory cells by local gene silencing of CRACM1 To investigate the cellular and molecular mechanisms underlying the decreased severity of CIA, we evaluated the differentiation potential of immune cells derived from mouse synovium and spleen on day 50 of the experiment Based on the flow cytometry analysis of mouse synovium-derived and spleen-derived primary cells, the intra-articular injection of lenti-M1shNRA decreased the percentage of B220ỵ lymphocytes and CD4ỵ IL-17ỵ lymphocytes (Fig 3aef) No significant differences were observed in the percentages of CD3ỵ lymphocytes in synovial cells and splenocytes between CRACM1-shRNA-treated mice and control-shRNA-treated mice We also evaluated inflammatory mediators in the joint protein extracts and serum on day 50 of the experiment The cytokine profile of the joint protein extracts suggested that the local gene silencing of CRACM1 reduced the protein expression of inflammatory cytokines, including IL-6, IL-12, IL-17A, IL-27, TNF-a, IFN-g, and GM-CSF in the local joints of CIA mice (Fig 3g) In addition, lower levels of cytokines, such as IL-6, IL-17A, IL-23, IL-27, and GM-CSF, were detected in the serum of lenti-M1hRNA-treated mice than in the serum of control-shRNA-treated mice (Fig 3h) Release of the suppressive cytokine IL-10 was increased in the joint protein extracts and serum after intra-articular CRACM1-shRNA treatment These data indicated that intra-articular CRACM1-shRNA treatment modulated the inflammatory response, including the differentiation of inflammatory cells and the release of inflammatory mediators, in the joints and periphery of CIA mice 3.4 Intra-articular gene silencing of CRACM1 inhibited the activity of mature osteoclasts Osteoclastogenic cells may be potential therapeutic targets of intra-articular CRACM1-shRNA treatment; therefore, we evaluated the activity of mature osteoclasts in joints Bone marrow cells were isolated from CRACM1-shRNA-treated CIA mice and controlshRNA-treated CIA mice on day 50 of the experiment and cultured in the presence of M-CSF and RANKL After days of culture, mature osteoclasts were harvested from detached collagen films The total number of TRAP-positive cells in CIA mice increased 3.62-fold compared with saline-sensitized naive mice (P < 0.01) (Fig 4aec, m) Gene silencing of CRACM1 around the arthritic joint resulted in a lower number of TRAP-positive cells (47.27%, P < 0.05) in CRACM1-shRNA-treated mice than in control-shRNA-treated CIA Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 Fig Application of CRACM1-shRNA reduces the severity of collagen-induced arthritis (CIA) (a) The clinical severity of arthritis was scored every days from day 20 to day 50 of the experiment CRACM1-shRNA viral particles were injected on day 20 or 30 of the experiment; Control-shRNA viral particles were injected on day 20 (naive vs other experimental groups; *, P < 0.05; CIA ỵ CRACM1shRNA vs CIA; , P < 0.05; , P < 0.01; n ¼ 13e22) (b) The swelling rates of the arthritic ankles and forepaws Coronal and sagittal MRI images were collected to obtain the volume of arthritic ankles and forepaws every days from day 20e50 The ratio of the increased volume after antigen sensitization to the volume in the presensitization period was calculated (naive vs other experimental groups; *, P < 0.05; CIA ỵ CRACM1shRNA vs CIA; ƚ, P < 0.05; n ¼ 13e22) (c) Upper panel: MRI images of arthritic ankles and forepaws on day 50 of the experiment Imaging was performed using a 3-dimensional T2-weighted flash sequence Lower panel: Micro-CT images of arthritic ankles and forepaws on day 81 of the experiment (d) Histological analysis of the paw joints of control-shRNA- and Lenti-M3shRNA-treated CIA mice using haematoxylin/eosin (H&E) staining on day 50 of the experiment (e) The results of the histological analysis were quantitated by scoring for inflammation, bone histomorphometry analysis (BHA), and cartilage damage (CIA ỵ Control-shRNA vs CIA ỵ CRACM1-shRNA; *, P < 0.05) The results are expressed as the mean ± SEM (n ¼ 5e8) mice Additionally, TRAP staining of the knee joint sections suggested that CRACM1-shRNA-treated CIA mice had significantly reduced osteoclast activity compared with control-shRNA-treated CIA mice (Fig 4def) The quantification analysis revealed that local CRACM1 silencing reduced osteoclast activity to 19.21% (P < 0.01) (Fig 4n) The pit formation area on the bone slides of CRACM1-shRNA-treated CIA mice was significantly decreased compared with bone slides of control-shRNA-treated CIA mice (Fig 4gel, o) These results suggest that the bone-resorption capacity of primary mature osteoclasts from CRACM1-shRNA-treated CIA mice was significantly reduced compared with those from control-shRNA-treated CIA mice Because pro-inflammatory cytokines in CIA mice may trigger the differentiation of osteoclasts by stimulating T cells to produce RANKL (8), we assessed the RANKL levels in the serum and protein extracts from joints on day 50 of the experiment (Fig 4p) Local treatment with CRACM1-shRNA inhibited the production of RANKL in the serum by 44.64% (P < 0.05) and in the knee joints to 6.56% (P < 0.001) Taken together, these results demonstrated that intra-articular treatment with CRACM1-shRNA down-regulated osteoclast activity by reducing local and systemic RANKL production in CIA mice Discussion To date, the therapeutic targets for biological DMARDs in clinical trials and those approved for use include T cells, B cells, and osteoclasts, or their associated cytokines and activation-related intracellular signalling proteins (9) In the current study, by targeting T cells, B cells, and osteoclasts in arthritic joints, we demonstrated Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 Fig Administration of CRACM1-shRNA modulates the differentiation potential of immune cells and inhibits the inflammatory response in CIA mice CRACM1-shRNA viral particles were injected on day 30 of the experiment For Th17 cell staining, dispersed cell suspensions were incubated with the cell activation cocktail The cells were stained using specific antibodies, and the data were acquired on a BD FACSAria flow cytometer (a) Representative plots and combined data of the CD3 and B220 expression levels in (b) splenocytes and (c) synovial cells are shown (d) Representative plots and combined data of the CD4 and IL-17 expression levels in (e) splenocytes and (f) synovial cells are shown (CIA ỵ Control-shRNA vs CIA ỵ CRACM1-shRNA; *, P < 0.05; **, P < 0.01; n ¼ 5e6) The cytokine profiles in (g) joint protein extracts and (h) serum were determined on day 35 postimmunization using the LEGENDplex™ Mouse Inflammation Panel The results are expressed as the mean ± SEM (CIA ỵ Control-shRNA vs CIA ỵ CRACM1-shRNA; *, P < 0.05; **, P < 0.01; n ¼ 8e10) the feasibility of inhibition of CRACM1 in the treatment of CIA CRACM1 protein locates on the plasma membrane of T cells, B cells, and osteoclasts and it is essential for forming CRAC channels Since store-operated Ca2ỵ entry (SOCE) via CRACM1 is fundamental to the function of most non-excitable cells and intracellular Ca2ỵ homeostasis is also vital to these cells, in vivo systemic manipulation of the function of CRACM1 is a challenge Systemic suppression of SOCE via CRAC channels by perturbing the function of CRACM1 caused systemic toxicity by inducing hepatorenal syndrome and glycaemia (unpublished data), and is not considered safe In present study, we attempted to locally instead of systematically suppress CRACM1 Intra-articular manipulation of CRACM1 appeared to be well-tolerated by CIA mice and the treatment of local joints successfully improved the systemic status The goal of the intra-articular CRACM1-shRNA treatment was to provide a high synovial fluid concentration that acted locally at the joints to silence CRACM1 and to reduce local inflammation through anti-inflammatory effects while limiting the systemic response We demonstrated that the local immune responses in an experimental arthritis model were suppressed by targeting CRACM1 using gene therapy The results indicated that efficient local gene silencing with specifically designed CRACM1 shRNA led to the suppression of synovial inflammation by inhibiting the activity and differentiation of immune cells Moreover, the strong functional blockage of T cells downregulated the production of RANKL The functional inhibition of CRACM1 in arthritic joints reduced subsequent bone loss and late bone deformity as a result of decreased osteoclast activity Therefore, our results suggest that intra-articular gene therapy targeting CRACM1 is beneficial in the treatment of individual arthritic joints To deliver sustained, therapeutic amounts of molecules to joints via the circulation requires repeated systemic administration, which is effective for RA because the condition has systemic, extraarticular involvement However, systemic administration is a disadvantage because this type of drug delivery does not specifically target drugs to the joints Therefore, non-target organs are exposed to high concentrations of the drug, which increases the potential for unwanted side effects (10) The systemic delivery of CRACM1 suppressors, including YM-58483, which is a small molecular blocker of store-operated Ca2ỵ entry via CRAC (11), and lentiviral delivery of shRNA formulations to CIA mice caused severe side effects Moreover, the risk of insertional mutagenesis based on viral vectors should always be a consideration in systemic gene therapy The direct injection of lentiviral particles into the articular cavity could overcome physiological barriers to entry while limiting systemic side effects The gene-based transduction of joint cells, Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 Fig CRACM1-shRNA-mediated CRACM1 silencing inhibits the activity of mature osteoclasts in collagen-induced arthritis (CIA) mice CRACM1-shRNA viral particles were injected on day 30 of the experiment Bone marrow cells were isolated on day 50 of the experiment and differentiated into osteoclasts (aec) TRAP staining of the cells, which were plated on chamber slides (def) Joint sections were detected using TRAP staining on day 50 of the experiment Paraffin-embedded joint sections were stained using a TRAP/ALP-staining kit and counterstained with haematoxylin The sections were using a by light microscope (600Â) The representative red field shows the TRAP-positive area (gei) Bone slide were stained with Mayer's haematoxylin and observed using a light microscopy (100Â) The arrows represent resorption pits (jel) Surfaces of bone slides were assessed using scanning electron microscopy (500Â) (m) The total number of TRAP-positive cells isolated from each mouse was counted (CIA ỵ Control-shRNA vs CIA ỵ CRACM1-shRNA; *, P < 0.05; naive vs CIA þ Control-shRNA; **, P < 0.01; n ¼ 5) The results are expressed as the mean ± SEM (n) The quantification of the TRAP-positive area on the joint slides A representative redfield image showing the TRAP-positive area was segmented from the background objects and scored The total area of the tissue slide was segmented using the greyscaled image (1 ¼ 0.237 mm2) The TRAP-positive area was divided by the area of the total tissue sections to determine the TRAP-positive area per mm2 (CIA ỵ Control-shRNA vs CIA ỵ CRACM1shRNA; *, P < 0.05; naive vs CIA ỵ Control-shRNA; **, P < 0.01; n ¼ 5) The results are expressed as the mean ± SEM (o) The quantification of the pit area on bone slides The area of resorption pits was segmented from background objects and scored The pit area is represented by the resorption pit area/bone slides (CIA ỵ Control-shRNA vs CIA ỵ CRACM1shRNA; *, P < 0.05; naive vs CIA ỵ Control-shRNA; *, P < 0.05; n ẳ 5) The results are expressed as the mean ± SEM (p) RANKL levels in the serum and joint protein extracts The levels of RANKL in the serum and protein extracts, which were obtained on day 35 post-immunization from the joints of normal naive mice, control-shRNA-treated CIA mice, and CRACM1-shRNA-treated CIA mice, were determined using a sandwich ELISA (CIA ỵ Control-shRNA vs CIA ỵ CRACM1-shRNA; *, P < 0.05; ***, P < 0.001, n ¼ 7e15) whereby CRACM1-targeting shRNA is maintained locally for an extended period, may provide sustained, therapeutic concentrations that lack the peaks and troughs of intermittent application By local application to peripheral joint tissues, the systemic toxic risks of viral vectors may be much more moderate than those in systemic application The cells carrying random integration sites, which are probably mutagenic, are locational limited In this study, a single intra-articular injection using relatively low copies of virus particles silenced CRACM1 around the joint and ameliorated the symptoms of CIA The local delivery of CRACM1-shRNA at the acme phase successfully suppressed CRACM1 activity and showed anti-CIA benefits Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 The intra-articular administration of CRACM1-shRNA to CIA mice resulted in decreased pro-inflammatory cytokine release in the joints and the periphery Among the pro-inflammatory cytokines, the IL-23-IL-17 axis was regulated by local CRACM1-shRNAtreatment High expression of CD4ỵ IL-17ỵ cells, known as Th17 cells, along with their major effector molecule, IL-17A, was detected among the splenocytes and synovial cells of CIA mice The increased levels of IL-23, a cytokine mainly secreted from macrophages and dendritic cells, in synovial extracts and serum indicated that the IL-23eIL-17 axis was activated at the onset of CIA Evidence also suggests that Th17 cells and the effector cytokine IL-17 play pivotal roles in the pathogenesis of CIA, which is related to T cell activation and bone resorption, as well as inflammatory cell infiltration and joint destruction (12) Intra-articular injections of CRACM1-shRNA had no effect on the IL-23 levels in the synovium but down-regulated the number of Th17 cells and the amount of IL-17A in the synovium Moreover, the local regulation of the IL-23-IL-17 axis caused systemic functional suppression of Th17 cells, which was reflected by the decreased Th17 population among splenocytes and the reduction of IL-17A and IL-23 in the serum from CRACM1-shRNA-treated CIA mice A lower circulating concentration of cytokines, as shown in the cytokine profile of serum, induced by local immunosuppression in joint could systemically affect the deviation of Th17 cells Also, osteoclastogenic Th17 cells play an important role in bone destruction Therefore, inhibition of the IL-23-IL-17 axis may have a beneficial effect on RA (13) The decreased activation of osteoclasts and the progressive attenuation of late bone deformity in the current study may have partially resulted from suppression of the IL23-IL-17 axis in CRACM1-shRNA-treated mice In many cells, CRAC channels function as an essential route for SOCE The CRAC channels of mast cells and lymphocytes were the rst to be characterized and exhibit high Ca2ỵ selectivity (14) Increased Ca2ỵ signalling via CRAC channels plays a fundamental role in mast cells and lymphocytes in processes ranging from gene expression to the regulation of proliferation CRAC channel families regulate mast cell functions not only through the modulation of intracellular Ca2ỵ signalling but also by directly affecting the stability of vesicle fusion during exocytosis, which is a critical process in mast cell degranulation (15,16) Mast cells are a strongly suggested therapeutic target in RA because activated IL-17Aexpressing mast cells existing in the synovium from RA patients contribute to the IL-17-rich environment and therefore may promote the amplification of the innate immune responses in the joints (17) Although the present study was mainly focused on the functional assessment of lymphocytes, CRAC inhibitors may also lead to beneficial effects in RA through the in situ inhibition of mast cell activation in the joints The timing of the local CRACM1-shRNA injection is important for improving prognosis A single injection during the onset phase delayed the progression of arthritis However, this approach did not affect prognosis, whereas treatment with CRACM1-shRNA in the acme phase with clinical symptoms suppressed ongoing disease and attenuated late bone deformity, which fulfils an essential prerequisite for anti-arthritic therapy The local blockade of Ca2ỵ entry via CRAC channels, which are the cellular targets in mainly T, B, and osteoclastogenic cells but not macrophages, may not disturb antigen presentation and delay the onset of autoimmune arthritis In the acme phase, the local inflammatory microenvironment is already established, and inflammatory cells are overwhelmingly dominant The therapeutic effects of the CRAC inhibitor are evident in this phase of CIA, which is mainly characterized by the T cellmediated activation of osteoclastogenesis Therefore, regarding CRACM1-shRNA treatment, it is important to consider the timing of administration In this study, we found that the intra-articular injection of lentiviral vectors temporarily promoted joint inflammation, as shown by the joint swelling rates, which were quantified using 3dimensional magnetic resonance imaging (MRI) The safety of the intra-articular CRACM1-shRNA injection is an important prerequisite for the local application of gene therapy The increased swelling that was observed in mice may have been because of a site infection or the lentiviral product Infection of the joint could have occurred as a response to local immunosuppression or contamination during the infection process However, because the increased swelling was mild and transient, it is difficult to attribute this swelling to deep infection Other requirements for the intra-articular application of this novel treatment include sufficient viral counts and appropriate composition of the viral solutions Non-specific host immune responses may lead to unexpected swelling (18) The amount of some pro-inflammatory cytokines increased after lentiviral treatment in CIA mice, such as IL-1b, IL-12, and TNF-a According to a report by Guo et al., infection with HIV-1, from which the lentiviral vector was derived, induces the expression of pro-IL-1b through Toll-like receptor (TLR) 8-dependent mechanisms and IL-1b maturation via the leucine-rich repeat-containing protein inflammasomedependent pathway in human monocytic cells (19) Neutrophils also recognize HIV-1 through TLR7/8 and produce reactive oxygen species, which are associated with cell activation and secretion of pro-inflammatory cytokines, including TNF-a, which favours HIV-1 replication (20) A similar effect was previously reported in human microglial cells and in HIV-1-latently infected promonocytic cells as well In the present study, an increased level of IL-12 protein in the joints and systemically increased levels of TNF-a in lentiviraltreated mice may be partially due to the immunological responses of the application of lentiviral particles Future studies using different quantities of viral particles or different compositions of viral solutions should be undertaken to investigate the feasibility and safety of intra-articular CRACM1-shRNA injection for the treatment of CIA In summary, our approach involved the delivery of the CRAC inhibitor to joints in CIA mice with the goal of achieving local immunosuppression by regulating SOCE via CRAC channels The intra-articular injection of CRACM1-shRNA at the acme phase of CIA resulted in the amelioration of symptoms, the prevention of joint damage and bone resorption, and an improvement in late bone deformity Further modifications of lentivirus-mediated local gene therapies are needed to translate this treatment approach into the clinical setting; however, we suggest that the findings of this study provide the basis and will generate enthusiasm for the use of CRACM1 inhibitors, which are already widely studied as a novel target of drug development to treat autoimmune diseases such as RA Conflicts of interest The authors have no financial conflicts of interest to disclose Acknowledgement This work was supported by the Japan Society for the Promotion of Science (JSPS) (KAKENHI Grant Number 15K19575) References (1) Mandema JW, Salinger DH, Baumgartner SW, Gibbs MA A dose-response meta-analysis for quantifying relative efficacy of biologics in rheumatoid arthritis Clin Pharmacol Ther 2011;90:828e835 (2) Parekh AB Store-operated CRAC channels: function in health and disease Nat Rev Drug Discov 2010;9:399e410 Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 S Liu et al / Journal of Pharmacological Sciences xxx (2017) 1e9 (3) Liu S, Kiyoi T, Takemasa E, Maeyama K Systemic lentivirus-mediated delivery of short hairpin RNA targeting calcium release-activated calcium channel as gene therapy for collagen-induced arthritis J Immunol 2015;194:76e83 (4) Liu S, Watanabe S, Shudou M, Kuno M, Miura H, Maeyama K Upregulation of store-operated Ca entry in the naive CD4 T cells with aberrant cytokine releasing in active rheumatoid arthritis Immunol Cell Biol 2014;92:752e760 (5) Liu X, Cai F, Zhang Y, Yang A, Liu L Celastrol, an NF-kappaB inhibitor, ameliorates hypercalciuria and articular cartilage lesions in a mouse model of secondary osteoporosis J Pharmacol Sci 2016;130:204e211 (6) Cato MH, Yau IW, Rickert RC Magnetic-based purification of untouched mouse germinal center B cells for ex vivo manipulation and biochemical analysis Nat Protoc 2011;6:953e960 (7) Tagishi K, Shimizu A, Endo K, Kito H, Niwa S, Fujii M, et al Defective splicing of the background Kỵ channel K2P5.1 by the pre-mRNA splicing inhibitor, pladienolide B in lectin-activated mouse splenic CD4ỵ T cells J Pharmacol Sci 2016;132:205e209 (8) Kay J, Calabrese L The role of interleukin-1 in the pathogenesis of rheumatoid arthritis Rheumatology (Oxford) 2004;43(Suppl 3):iii2eiii9 (9) Venkatesha SH, Dudics S, Acharya B, Moudgil KD Cytokine-modulating strategies and newer cytokine targets for arthritis therapy Int J Mol Sci 2015;16:887e906 (10) Evans CH, Ghivizzani SC, Robbins PD Arthritis gene therapy and its tortuous path into the clinic Transl Res 2013;161:205e216 (11) Ohga K, Takezawa R, Arakida Y, Shimizu Y, Ishikawa J Characterization of YM58483/BTP2, a novel store-operated Ca2ỵ entry blocker, on T cell-mediated immune responses in vivo Int Immunopharmacol 2008;8:1787e1792 (12) Korn T, Bettelli E, Oukka M, Kuchroo VK IL-17 and Th17 cells Annu Rev Immunol 2009;27:485e517 (13) Sato K, Suematsu A, Okamoto K, Yamaguchi A, Morishita Y, Kadono Y, et al Th17 functions as an osteoclastogenic helper T cell subset that links T cell activation and bone destruction J Exp Med 2006;203:2673e2682 (14) Prakriya M Store-operated Orai channels: structure and function Curr Top Membr 2013;71:1e32 (15) Liu S, Sahid MNA, Takemasa E, Kiyoi T, Kuno M, Oshima Y, et al CRACM3 regulates the stability of non-excitable exocytotic vesicle fusion pores in a Ca2ỵ-independent manner via molecular interaction with syntaxin4 Sci Rep 2016;6:28133 (16) Ma HT, Beaven MA Regulation of Ca2ỵ signaling with particular focus on mast cells Crit Rev Immunol 2009;29:155e186 (17) Hueber AJ, Asquith DL, Miller AM, Reilly J, Kerr S, Leipe J, et al Mast cells express IL-17A in rheumatoid arthritis synovium J Immunol 2010;184: 3336e3340 (18) Rothe M, Schambach A, Biasco L Safety of gene therapy: new insights to a puzzling case Curr Gene Ther 2014;14:429e436 (19) Guo H, Gao J, Taxman DJ, Ting JP, Su L HIV-1 infection induces interleukin1beta production via TLR8 protein-dependent and NLRP3 inflammasome mechanisms in human monocytes J Biol Chem 2014;289:21716e21726 (20) Saitoh T, Komano J, Saitoh Y, Misawa T, Takahama M, Kozaki T, et al Neutrophil extracellular traps mediate a host defense response to human immunodeficiency virus-1 Cell Host Microbe 2012;12:109e116 Please cite this article in press as: Liu S, et al., Intra-articular lentivirus-mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017), http://dx.doi.org/10.1016/j.jphs.2017.02.001 ... article in press as: Liu S, et al., Intra- articular lentivirus- mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017),... article in press as: Liu S, et al., Intra- articular lentivirus- mediated gene therapy targeting CRACM1 for the treatment of collageninduced arthritis, Journal of Pharmacological Sciences (2017),... effects The gene- based transduction of joint cells, Please cite this article in press as: Liu S, et al., Intra- articular lentivirus- mediated gene therapy targeting CRACM1 for the treatment of collageninduced