Oxidation of propionate to pyruvate in Escherichia coliInvolvement of methylcitrate dehydratase and aconitase Matthias Brock1,*, Claudia Maerker1,*, Alexandra Schu¨tz1, Uwe Vo¨lker1,2,†a
Trang 1Oxidation of propionate to pyruvate in Escherichia coli
Involvement of methylcitrate dehydratase and aconitase
Matthias Brock1,*, Claudia Maerker1,*, Alexandra Schu¨tz1, Uwe Vo¨lker1,2,†and Wolfgang Buckel1
1
Laboratorium fu¨r Mikrobiologie, Fachbereich Biologie, Philipps-Universita¨t, Marburg, Germany;2Abteilung Biochemie,
Max-Planck-Institut fu¨r terrestrische Mikrobiologie, Marburg, Germany
The pathway of the oxidation of propionate to pyruvate in
Escherichia coliinvolves five enzymes, only two of which,
methylcitrate synthase and 2-methylisocitrate lyase, have
been thoroughly characterized Here we report that the
isomerization of (2S,3S)-methylcitrate to
(2R,3S)-2-methyl-isocitrate requires a novel enzyme, methylcitrate dehydratase
(PrpD), and the well-known enzyme, aconitase (AcnB), of
the tricarboxylic acid cycle AcnB was purified as
2-methyl-aconitate hydratase from E coli cells grown on propionate
and identified by its N-terminus The enzyme has an
apparent Kmof 210 lMfor (2R,3S)-2-methylisocitrate but
shows no activity with (2S,3S)-methylcitrate On the other
hand, PrpD is specific for (2S,3S)-methylcitrate
(Km¼ 440 lM) and catalyses in addition only the hydration
of cis-aconitate at a rate that is five times lower The product
of the dehydration of enzymatically synthesized
(2S,3S)-methylcitrate was designated cis-2-methylaconitate because
of its ability to form a cyclic anhydride at low pH Hence,
PrpD catalyses an unusual syn elimination, whereas the
addition of water to cis-2-methylaconitate occurs in the usual anti manner The different stereochemistries of the elimination and addition of water may be the reason for the requirement for the novel methylcitrate dehydratase (PrpD), the sequence of which seems not to be related to any other enzyme of known function Northern-blot experi-ments showed expression of acnB under all conditions tested, whereas the RNA of enzymes of the prp operon (PrpE, a propionyl-CoA synthetase, and PrpD) was exclusively pre-sent during growth on propionate 2D gel electrophoresis showed the production of all proteins encoded by the prp operon during growth on propionate as sole carbon and energy source, except PrpE, which seems to be replaced by acetyl-CoA synthetase This is in good agreement with investigations on Salmonella enterica LT2, in which disrup-tion of the prpE gene showed no visible phenotype Keywords: 2-methylisocitrate; aconitase; methylcitrate dehy-dratase; propionate metabolism; prp operon
Several bacteria and fungi are able to oxidize propionate via methylcitrate to pyruvate Initially propionyl-CoA conden-ses with oxaloacetate to (2S,3S)-methylcitrate, which iso-merizes to (2R,3S)-2-methylisocitrate Cleavage leads to pyruvate and succinate The consecutive oxidative regener-ation of oxaloacetate from succinate completes the methyl-citrate cycle Initially this cycle was discovered by growing a mutant strain of the yeast Candida lipolytica on odd-chain fatty acids The accumulation of a tricarboxylic acid was observed during growth and identified as methylcitrate [1] Further investigations revealed other enzymes necessary for
a functional methylcitrate cycle The enzymes, however, were only partially characterized and no genomic sequences were identified [2–6] More recently it was discovered that propionate oxidation in aerobically growing Gram-negative bacteria, especially Escherichia coli [7] and Salmonella entericaserovar Thyphimurium LT2 [8], also proceeds via methylcitrate The purification of one of the key enzymes of the methylcitrate cycle, methylcitrate synthase, led to the identification of an operon necessary for propionate degra-dation In E coli and S enterica this prp operon is composed of the genes prpB, prpC, prpD and prpE PrpB and PrpC were identified as 2-methylisocitrate lyase [9] and methylcitrate synthase [7], respectively PrpE was shown to catalyse the activation of propionyl-CoA [10] It remained unclear, however, by which mechanism the dehydration and rehydration of (2S,3S)-methylcitrate is performed to yield (2R,3S)-2-methylisocitrate In S enterica it was reported that the first reaction, the dehydration of methylcitrate, is
Correspondence to W Buckel, Laboratorium fu¨r Mikrobiologie,
Fachbereich Biologie, Philipps-Universita¨t, D-35032 Marburg,
Germany Fax: + 49 6421 2828979, Tel.: + 49 6421 2821527,
E-mail: buckel@mailer.uni-marburg.de
Abbreviations: Acs, acetyl-CoA synthetase; AcnB, aconitase B
(2-methylisocitrate dehydratase); PrpB, 2-methylisocitrate lyase;
PrpC, methylcitrate synthase; PrpD, methylcitrate dehydratase; PrpE,
propionyl-CoA synthetase.
Enzymes: acetyl-CoA synthetase (Acs, EC 6.2.1.1); aconitase B [AcnB,
2-methylisocitrate dehydratase
(2S,3R)-3-hydroxybutane-1,2,3-tri-carboxylate hydro-lyase, EC 4.2.1.3, also 4.2.1.99]; citrate synthase
(EC 4.1.3.7); fumarase (EC 4.2.1.2); isocitrate lyase (EC 4.1.3.1);
malate dehydrogenase (EC 1.1.1.37); malate synthase (EC 4.1.3.2);
methylcitrate dehydratase
[(2S,3S)-2-hydroxybutane-1,2,3-tricarboxy-late hydro-lyase, PrpD, EC 4.2.1.79]; methylcitrate synthase
(EC 4.1.3.31); 2-methylisocitrate lyase (EC 4.1.3.30); phosphoglycerate
mutase (EC 5.4.2.1); propanol-preferring alcohol dehydrogenase
(EC 1.1.1.1); propionyl-CoA synthetase (EC 6.2.1.17); pyruvate kinase
(EC 2.1.4.70); succinate dehydrogenase (EC 1.3.5.1).
*Present address: Institut fu¨r Mikrobiologie der Universita¨t,
Herrenha¨user Str 2, D-30167 Hannover, Germany These two authors
contributed equally to this work.
Present address: Funktionelle Genomforschung, Medizinische
Fakulta¨t, Ernst-Moritz-Arndt-Universita¨t, Walther-Rathenau-Str.
49A, D-17489 Greifswald, Germany.
(Received 28 July 2002, revised 24 October 2002,
accepted 28 October 2002)
Trang 2catalysed by the PrpD protein [11] However, the product of
this reaction was not further analysed It was suggested that
2-methyl-cis-aconitate was formed Interestingly, this
reac-tion would involve the unusual syn eliminareac-tion of water,
whereas in all other analysed derivatives of malate this
b-elimination occurs in an anti manner; for a review see [12]
Aconitase from bovine heart follows this rule by
dehydra-ting both substrates, citrate and (2R,3S)-isocitrate, in an anti
manner Furthermore the enzyme is able to hydrate
2-methyl-cis-aconitate to threo-2-methylisocitrate in an anti
manner, but cannot use methylcitrate as substrate [13]
Surprisingly, investigations of the PrpD protein showed that
this enzyme is not able to catalyse the hydration of
2-methyl-cis-aconitate to 2-methylisocitrate There is genetic
evidence that an aconitase-like protein or even one of the
aconitases (AcnA or AcnB) from S enterica catalyse this
hydration [11] Other studies on the PrpD protein of E coli
revealed the existence of an iron-sulfur cluster essential for
catalytic activity [14] However, this is in disagreement with
results on the S enterica PrpD protein, in which such a
cluster was not found [11] Therefore, the biochemical
characterization of the E coli PrpD protein will also focus
on the activity of this enzyme in the presence of chelating
agents such as EDTA and o-phenanthroline
In this paper we report the in vitro reconstitution of the
oxidation of propionyl-CoA to pyruvate by the use of
purified PrpC, PrpD, AcnB and PrpB from E coli PrpD
and AcnB involved in the conversion of methylcitrate into
2-methylisocitrate were biochemically characterized
Fur-thermore, expression of the genes involved in propionate
metabolism was studied in 2D protein gel electrophoresis
and Northern-blot experiments
E X P E R I M E N T A L P R O C E D U R E S
Bacteria and culture conditions
For purification of wild-type enzymes and for expression
studies, the E coli K12 derivative W3350 (F–gal r+m+k
sensitive) was used [15] For overexpression of the genes prpD
and prpB, E coli TOP10 cells (Invitrogen) were used,
containing plasmids with the corresponding genes and an
N-terminal cloned histidine tag For purification of wild-type
enzymes and expression studies, cells were grown aerobically
at 37C in minimal medium containing 60 mMK2HPO4,
33 mM KH2PO4, 76 mM (NH4)2SO4, 2 mM trisodium
citrate, 0.1% (v/v) trace element solution without chelating
agent [16], 1 mMMgSO4, and 50 mMsodium propionate,
sodium acetate or glucose For overproduction of proteins,
cells were grown in Standard I medium (peptone, 15.6 gÆL)1;
yeast extract, 2.8 gÆL)1; 100 mM NaCl; 5 mM glucose;
Merck, Darmstadt, Germany) and induced with isopropyl
thio-b-D-galactoside Cells were harvested by centrifugation
at 10 000 g and used directly or stored at)80 C
Purification of 2-methylisocitrate dehydratase (AcnB)
fromE coli W3350
For a standard purification, 18 g (wet weight)
propionate-grown cells was used All purification steps were carried out
in an anaerobic chamber (95% N2, 5% H2) Cells were
thawed on ice and suspended in 20 mL anaerobic buffer I
(20 mM potassium phosphate, pH 7.5, 1 mM trisodium
citrate and 1 mM dithiothreitol) Cells were broken by sonication (Branson sonifier; 3· 5 min at 60% pulse and 80% of full power) Cell debris was removed by ultracen-trifugation at 96 000 g for 45 min This crude extract was filtered (0.45 lm pore size; Sarsted, Nu¨mbrecht, Germany) and loaded on to a hydroxyapatite column (20 mL bed volume) equilibrated with buffer I Unless otherwise indi-cated, the FPLC system and columns from Amersham Biosciences were used The hydroxyapatite column was washed with buffer I The flow through was concentrated with an Amicon chamber over a PM 30 size-exclusion filter (Millipore) and diluted in buffer II (20 mM Tris/HCl,
pH 7.5, with 1 mMtrisodium citrate and 1 mM dithiothrei-tol) The enzyme was loaded on to a Q-Sepharose column (30 mL bed volume), previously equilibrated with buffer II The enzyme was eluted with buffer III (20 mMTris/HCl,
pH 7.5, with 1 mM trisodium citrate, 1 mM dithiothreitol and 1M NaCl) with a linear NaCl gradient of
150)200 mM Active fractions were pooled, and solid (NH4)2SO4 was added to a final concentration of 1M, filtered and loaded on to a phenyl-Sepharose column (bed volume 30 mL), previously equilibrated with buffer IV (20 mMTris/citrate, pH 8.0, with 1 mMdithiothreitol and
1M (NH4)2SO4) The enzyme was eluted with a linear (NH4)2SO4gradient of 1.0–0Min buffer V (20 mMTris/ citrate, pH 8.0, with 1 mMdithiothreitol) between 0.2 and
0M(NH4)2SO4and was concentrated as described above by changing to buffer II The enzyme was loaded on to a UnoQ column (Bio-Rad; bed volume 6 mL) equilibrated with buffer II and eluted with buffer III The purity of the eluted fractions was checked by electrophoresis on a 15% poly-acrylamide gel in the presence of SDS
Overproduction and purification of PrpB and PrpD with N-terminal histidine tags
The source of PrpB protein, the 2-methylisocitrate lyase, was described elsewhere [9] The prpD ORF from the prp operon of wild-type E coli W3350 was amplified with Taq polymerase Primers were constructed with the complete restriction sites of BamHI (primer: 5¢-CGGGATCCT CAGCTCAAATCAACAACATCCGC-3¢) and PstI (5¢-AACTGCAGTTAAATGACGTACAGGTCGAGAT AC-3¢), respectively After restriction of the PCR product with both enzymes, the product was cloned into the previously restricted pQE30 vector (Qiagen) for overexpres-sion with an N-terminal His tag Chemically competent
E coli cells (TOP10) were transformed with the plasmid Overproduction of the PrpD protein was performed by growing the cells in Standard I medium until D578¼ 0.8 and induction with 1 mMof isopropyl thio-b-D-galactoside followed by incubation overnight Overproduction of methylcitrate dehydratase in four different clones was confirmed by SDS/PAGE All clones exhibted an induced protein at 54 kDa (data not shown)
Cells from a 1.2-L culture (D578 3) were induced for
10 h and harvested by centrifugation Cells were washed with 50 mMpotassium phosphate, pH 7.0, centrifuged, and suspended in the same buffer Cells were broken by sonication and centrifuged at 96 000 g The resulting cell-free extract was loaded on to a gravity flow Ni/nitrilotri-acetic acid/agarose column with a bed volume of 5 mL The column was washed with 20 mL 50 m potassium
Trang 3phosphate, pH 7.0, containing 20 mM histidine to remove
unspecifically bound proteins PrpD was eluted with 50 mM
potassium phosphate buffer, pH 7.0, containing 200 mM
histidine Active fractions were concentrated and desalted
over a PM 30 size-exclusion filter After addition of glycerol
to a final concentration of 50% (v/v), the protein could be
stored at)20 C without loss of activity
Enzymatic synthesis of (2S,3S )-methylcitrate
Methylcitrate was produced with the methylcitrate
syn-thases PrpC from E coli [7] or McsA from the filamentous
fungus Aspergillus nidulans [17] The reaction was carried
out at room temperature for 20 h Propionyl phosphate was
synthesized chemically by a modified synthesis described by
Stadtman [18], in which acetic acid anhydride was replaced
by propionic acid anhydride Propionyl phosphate was
converted into propionyl-CoA with the help of
phospho-transacetylase from Bacillus stearothermophilus (Sigma,
Taufkirchen, Germany) A typical reaction for the synthesis
of methylcitrate was carried out in a final volume of 60 mL
and contained 50 mM propionyl phosphate, 100 mM
oxaloacetic acid (neutralized with KHCO3), 0.2 mM
CoASH, 500 U phosphotransacetylase and 50 U
methyl-citrate synthase The reaction was buffered at pH 7.5 in
20 mMpotassium phosphate After incubation, the enzymes
were denatured by heat treatment for 20 min at 80C and
centrifuged at 10 000 g for 10 min The supernatant was
concentrated to a final volume of 10 mL in a rotary
evaporator Precipitated salts were removed by
centrifuga-tion as described above, and the supernatant was loaded on
to a Dowex 1x8 column (Cl– form, bed volume 10 mL)
Methylcitrate was eluted with 1MHCl The
methylcitrate-containing fractions, as tested enzymatically with the PrpD
protein, were concentrated by evaporation The residual
brownish oil was checked for purity by 1H-NMR
(500 MHz, CDCl3): d¼ 1.19 (3H, d, 3J¼ 6.9 Hz CH3),
2.90 (1H, q,3J¼ 6.9 Hz, CH), 2.90 (1H, d,2J¼ 16.6 Hz,
CHH), 3.17 (1H, d,2J¼ 16.6 Hz, CHH) Both, the E coli
and the A nidulans enzyme produced the same enantiomeric
pure (2S,3S)-methylcitrate (99.9%) as checked by
enantio-selective multidimensional capillary gas chromatography
(kindly performed by Professor A Mosandl, Universita¨t
Frankfurt/Main, Germany)
Enzyme assays
2-Methylisocitrate lyase (PrpB) was assayed with the
coupled NADH-dependent assay as described previously
[9] Methylcitrate dehydratase (PrpD) activity was measured
at 240 nm with a Kontron, model Uvikon 943 double-beam
UV/visible spectrophotometer, and the formation of the
double bond during dehydration of methylcitrate was
monitored The absorption coefficient, e240, was taken as
4.5 mM )1Æcm)1[4] The composition of the assay mixture
was 50 mM potassium phosphate, pH 7.5, and 1.3 mM
methylcitrate in a final volume of 1 mL
The racemic mixture of chemically synthesized
threo-2-methylisocitrate [9] was used to follow the dehydration and
the formation of the double bond in 2-methyl-cis-aconitate
at 240 nm; e240¼ 4.5 mM )1Æcm)1[4] The composition of
the assay was 50 mM potassium phosphate, pH 7.5, and
0.3 m threo-2-methylisocitrate in a final volume of 1 mL
To measure 2-methylisocitrate dehydratase (AcnB), a coupled assay was performed in the reverse direction The reaction was followed at 340 nm under anaerobic condi-tions with e340¼ 6.2 mM )1Æcm)1 The composition of the assay mixture was 50 mM potassium phosphate buffer,
pH 7.5, 2 mM MgCl2, 0.2 mM NADH, 0.64 mM methyl-citrate, 0.2 U PrpD, 0.2 U PrpB, 0.3 mMdithiothreitol, 3 U lactate dehydrogenase from rabbit muscle (Roche) and a sample of purified AcnB in a final volume of 1 mL Gel electrophoresis and blotting of proteins The protein fractions obtained from the purification of 2-methylisocitrate dehydratase were analysed by SDS/ PAGE The apparent molecular mass of the 2-methylisoci-trate dehydratase subunit was determined by measuring the mobility by SDS/PAGE (15% acrylamide) [19] with stand-ard proteins as molecular mass markers Purified 2-methyl-isocitrate dehydratase was blotted from the gel (10% acrylamide) on a poly(vinylidene difluoride) membrane (Millipore) with the transblot SD semidry transfer cell (Bio-Rad), as described in the manufacturer’s protocol, and was then N-terminally sequenced by Edman degradation (kindly performed by D Linder, Universita¨t Gießen, Germany) Re-activation and inactivation of AcnB
AcnB was inactivated by exposure to air and by addition
of either EDTA or o-phenanthroline (both 2.5 mM final concentration) For reactivation, 98.3 mg FeSO4· (NH4)2SO4· 6H2O (final concentration 5 mM) and 136 mg cysteine hydrochloride (monohydrate) (15 mM) were dis-solved under anaerobic conditions in 45 mL water, and the
pH was adjusted to 7.5 by dropwise addition of 1MNaOH Water was added to a final volume of 50 mL One part of enzyme solution was mixed with one part of re-activation mixture and incubated for 60 min at room temperature under anaerobic conditions
Iron–sulfur cluster and metal cofactors Purified PrpD protein was concentrated to 4 mg pro-teinÆmL)1in 20 mMHepes buffer, pH 7.5, and the activity was measured with methylcitrate as substrate An aliquot was diluted and a spectrum was determined in the range 220–900 nm A second 0.5-mL aliquot was taken and incubated for 60 min at room temperature under anaerobic conditions in re-activation mixture (0.5 mL) as described above for the re-activation of the 2-methylisocitrate dehy-dratase PrpD was separated from the re-activation mixture
by the use of a Sephadex-NAP column (Pharmacia Biotech) and eluted in 20 mM Hepes buffer, pH 7.5 Activity was tested and a spectrum was determined as described above A third and fourth aliquot were taken and incubated with a
5 mM final concentration of o-phenanthroline or 10 mM EDTA, respectively, and incubated for 20 min at room temperature PrpD was desalted, and activity and a spectrum were determined as described above
Synthesis of digoxygenin-labelled RNA probes For the detection of mRNAs of the genes acs, acnB, prpD and prpE, specific RNA probes labelled with digoxygenin
Trang 4were produced using the T7 polymerase Oligonucleotides
were designed that contained the sequence of the T7
promoter in the reverse primer (the full sequences of all
primers are shown in Table 1) A PCR was performed with
Taqpolymerase, and genomic DNA of E coli W3350 was
used as a template PCR products were separated by
electrophoresis in a 1% agarose gel and purified by the
Geneclean Kit II (BIO 101) as described in the
manufac-turer’s protocol For in vitro transcription, 0.5–1.0 lg PCR
product was mixed with 2 lL NTP labelling mixture
containing UTP (Dig RNA Labelling Kit T7; Roche),
2 lL reaction buffer (Ambion), 1 lL RNase inhibitor (Dig
RNA Labelling Kit T7; Roche), 2 lL T7 polymerase
(20 UÆlL)1; Ambion) and diethyl pyrocarbonate-treated
water to a final volume of 20 lL Transcription was carried
out at 37C for 1 h RNase-free DNase I was added, and
the mixture was incubated at 37C for a further 15 min
RNA was precipitated by the addition of 2.5 lL 1MLiCl
and 90 lL 100% ethanol and incubated for 1 h at)80 C
After centrifugation (12 000 g, 4C), RNA pellets were
dried and dissolved in 100 lL nuclease-free water The
intensity of the digoxygenin label of the probes was checked
by cross-linking the specific probes on a nylon membrane
and detection of the label by standard methods
2D gel electrophoresis
After harvesting of the bacteria by centrifugation, cells were
washed in 10 mMTris/HCl (pH 7.5)/1 mMEDTA, and the
cell pellet was suspended in the same buffer Cells were
disrupted by several passages through a French pressure
cell, and debris was removed by centrifugation at 4C and
20 000 g for 30 min The protein concentration of the
supernatant fraction was assayed by the method of
Brad-ford [20] For 2D gel electrophoresis, 400 lg crude protein
extract was solubilized in a hydration solution containing
8M urea, 2M thiourea, 2% (w/v)
3-[(3-chloramidopro-pyl)dimethylammonio]propane-1-sulfonate (Chaps), 28 mM
dithiothreitol, 1.3% (v/v) Pharmalytes, pH 3–10, and
bromophenol blue After hydration in the
protein-contain-ing solution for 24 h under low-viscosity paraffin oil,
Immobiline DryStrips (IPG-strips; Amersham Biosciences)
covering the pH range 4–7 or 3–10 were subjected to
isoelectric focusing The following voltage/time profile was
used: a linear increase from 0 to 500 V for 1000 Vh, 500 V
for 2000 Vh, a linear increase from 500 to 3500 V for 10 000
Vh and a final phase of 3500 V for 35 000 Vh (pH 4–7) or
for 21 000 Vh (pH 3–10) IPG-strips were consecutively
incubated for 15 min each in equilibration solution A and
B Solution A contained 50 mMTris/HCl, pH 6.8, 6Murea, 30% glycerol, 4% SDS and dithiothreitol (3.5 mgÆmL)1) Solution B contained iodoacetamide (45 mgÆmL)1) instead
of dithiothreitol In the second dimension, proteins were separated on SDS/12.5% polyacrylamide gels with the InvestigatorTM System (Perkin–Elmer Life Sciences, Cambridge, UK) at 2 W per gel Gels were stained with PhastGel BlueR according to the manufacturer’s (Amer-sham Biosciences) instructions After scanning, the 2D PAGE images were analysed with the Melanie3 software package (Bio-Rad Laboratories GmbH) Three separate gels of each condition and two independent cultivations were analysed, and only spots displaying the same pattern in all parallels were selected for further characterization Protein identification by peptide mass fingerprinting Protein spots were excised from PhastGel BlueR-stained 2D gels, destained, and digested with trypsin (Promega); peptides were then extracted [21] Peptide mixtures were purified with C18-tips according to the manufacturer’s (Millipore) instructions and directly eluted on to a sample template of a MALDI-TOF mass spectrometer with an eluent containing 50% (v/v) acetonitrile, 0.1% (v/v) tri-fluoroacetic acid, saturating amounts of a-cyano-3-hydroxycinnamic acid and calibration peptides Peptide masses were determined in the positive ion reflector mode in
a Voyager DE RP mass spectrometer (Applied Biosystems) with internal calibration Mass accuracy was better than 50 p.p.m Peptide mass fingerprints were compared with databases using the MASCOT program (http://www matrixscience.com/cgi/index.pl?page= /home.html) The searches considered oxidation of methionine, pyroglutamic acid formation at the N-terminal glutamine, and modifica-tion of cysteine by carbamidomethylamodifica-tion as well as partial cleavage leaving a maximum of one internal site uncleaved RNA isolation and Northern blot
E coliW3350 cells were grown on propionate, acetate or glucose minimal medium to an D578of 0.8 under vigorous shaking at 37C The cultures (20 mL) were mixed with
20 mL frozen killing buffer (20 mM Tris/HCl, pH 7.5,
5 mMMgCl2, 20 mMNaN3; diethyl pyrocarbonate treated) and centrifuged for 10 min at 4000 g Cell pellets were suspended in 200 lL killing buffer, and frozen in liquid nitrogen Cells were broken in a frozen state in a
Table 1 Oligonucleotides used for the generation of RNA probes The reverse primer contains the promoter region for the T7 polymerase at the 5¢ end An asterisk denotes the end of the promoter region.
Acs 5¢- TAATACGACTCACTATAGGGA * 5¢- AACACACCATTCCTGCCAAC -3¢
CCACCACAGGTCGCGCC -3¢
AcnB 5¢- TAATACGACTCACTATAGGGA * 5¢- CTCACACGCTGCTGATGTTC -3¢
CGTGGTTACGCACTTCACC -3¢
PrpD 5¢- TAATACGACTCACTATAGGGA * 5¢- AACATCGGCGCGATGATCC -3¢
TCGCTGCTTCAACTGCCG -3 PrpE 5¢- TAATACGACTCACTATAGGGA * 5¢- ACCGGAGCAGTTCTGGGC -3¢
GATTCCAGCCACGCCACC -3¢
Trang 5Micro-Dismembrator (Braun Biotech International) at
2600 r.p.m for 2 min Cell extracts were mixed with 4 mL
lysis solution containing 4Mguanidine thiocyanate, 25 mM
sodium acetate, pH 5.2, and 0.5% N-lauroylsarcosine (w/v)
at 37C One part of this solution was mixed with one part of
acidic phenol/chloroform/3-methylbutan-1-ol (50 : 48 : 2,
by vol.), shaken at room temperature for 5 min and
centrifuged at 12 500 g for 5 min The upper layer was
mixed with 1 mL acidic phenol/chloroform/
3-methylbutan-1-ol, shaken again for 5 min, and spun down
as described above The upper layer was mixed with 800 lL
chloroform/3-methylbutan-1-ol (24 : 1, v/v), and
centri-fuged as described above The aqueous phase was collected,
and 80 lL 3Msodium acetate (pH 5.2) and 1.1 mL
propan-2-ol were added RNA was precipitated by incubation at
)80 C for 1 h The RNA was centrifuged (23 000 g, 4 C,
15 min) and the pellet was washed with 70% ice-cold
ethanol The RNA was dried at room temperature and
dissolved in 30 lL diethyl pyrocarbonate-treated water
Quality and quantity of isolated RNA was checked with the
Agilent 2100 Bioanalyzer (Agilent Technologies, Bo¨blingen,
Germany) as described in the manufacturer’s protocol
RNA (8 lg in 4.5 lL) was mixed with 10.5 lL
denatur-ation solution [90 lL formamide, 18 lL formaldehyde,
18 lL 10· Mops (200 mMMops, 50 mMsodium acetate,
10 mM EDTA, dissolved in diethyl pyrocarbonate-treated
water and adjusted to pH 7.0)] and loaded on to a 1.4%
(w/v) agarose gel containing 1.8Mformaldehyde RNA was
separated at 70 V for 3 h and transferred to a nylon transfer
membrane (Schleicher and Schuell) [22] The RNA blot was
saturated with blocking reagent and hybridized with the
digoxygenin-labelled antisense RNA probes overnight
After a wash, specific hybridization signals were detected
by incubation with alkaline phosphatase-conjugated
anti-digoxygenin Ig (Roche) and monitoring the conversion of
the ECF-vistra substrate with a STORM 860 fluorimager
(Amersham Biosciences)
Determination of 2-methyl-cis-aconitate by anhydride
formation
Enzymatically synthesized methylcitrate (0.8 mM) was
dis-solved in a final volume of 5 mL 20 mMHepes, pH 7.5, and
incubated with 0.5 U PrpD A 1-mL aliquot was taken, and
the reaction was monitored at 240 nm until the equilibrium
of the reaction was reached PrpD was inactivated by
heating the whole sample for 15 min at 80C Denatured
protein was removed by centrifugation Of this solution,
900 lL was mixed with 100 lL water, and a UV/visible
spectrum in the range 220–400 nm was recorded A second
sample was prepared by using another 900 lL of the solution and addition of 100 lL 8MHCl The anhydride formation was followed at 259 nm until no further change
in absorbance was observed A second spectrum in the range 220–400 nm was recorded, and the difference spec-trum between the neutral and the acidified sample was calculated using the Microsoft Excel worksheet As a control, a methylcitrate solution without addition of PrpD was treated as described above No change in absorbance was detectable during acidification
R E S U L T S Biochemical analysis of 2-methylisocitrate dehydratase
E colicells were grown to D578¼ 1.2 in the presence of
50 mMpropionate in the minimal medium 2-Methylisoci-trate dehydratase was identified in extracts of these cells by monitoring the decrease in A340with enzymatically prepared (2S,3S)-methylcitrate as substrate and with PrpD, PrpB and lactate dehydrogenase as auxiliary enzymes (Fig 1) Start-ing from 18 g wet cells, the protein was purified from a specific activity in crude extracts of 0.16 UÆmg)1 to 1.9 UÆmg)1 with a yield of 3.6% Purification was per-formed by chromatography on hydroxyapatite, Q-Seph-arose, phenyl-Sepharose and UnoQ (Table 2) A major band was revealed in the resulting protein fractions by SDS/PAGE (Fig 2, lanes 6 and 7) with an apparent molecular mass of 94 kDa and a turnover number of 3 s)1 Comparison of the forward reaction (hydration of
Fig 1 Pathway of propionate oxidation to pyruvate The enzymes are indicated in italics.
Table 2 Purification protocol for AcnB A unit is defined as the oxidation of 1 lmol NADHÆmin)1in the coupled assay.
Purification step
Activity (U)
Protein (mg)
Specific activity (UÆmg)1)
Yield (%)
Purification factor
Trang 62-methyl-cis-aconitate) in the coupled assay with the activity
of the back reaction measured by the dehydration of
chemically synthesized threo-2-methylisocitrate yielded a
ratio of 1 : 0.7 The Kmof the purified enzyme with
threo-2-methylisocitrate as substrate was determined as 210 lM,
which is somewhat higher than Km¼ 51 lMfor
(2R,3S)-isocitrate determined with the aconitase, AcnB [23] The
enzyme showed no detectable activity with
(2S,3S)-methyl-citrate as substrate
N-Terminal sequence determination of the purified
protein by Edman degradation revealed the peptide
sequence, MLEEYXKXVAEXAAE, where X denotes
unclear amino acids Comparison of this sequence with
the databases showed 100% identity with the N-terminal
sequence of the E coli citrate cycle aconitase, AcnB
(SWISSPROT P36683), with the sequence, MLEEYRKH
VAERAAE The calculated molecular mass of AcnB from
its genomic sequence is 93 498 Da, which is in good
agreement with the apparent molecular mass of 94 kDa
derived from the SDS/PAGE analysis
The enzyme was rapidly inactivated by exposure to air,
which is already known for aconitases [24], as well as during
the purification procedure, especially during
chromatogra-phy on the phenyl-Sepharose column Activity was partially
restored by incubation in re-activation mixture under
anaerobic conditions as described in Experimental
proce-dures Addition of EDTA or o-phenanthroline totally
inactivated enzymatic activity This is in good agreement
with the requirement for a functional [4Fe)4S] cluster for
aconitase activity
Cloning and characterization of PrpD
The prpD gene was cloned and overexpressed as described
in Experimental Procedures The overproduced protein was
purified to a specific activity of 11.4 UÆ(mg protein))1by
chromatography on a Ni/nitrilotriacetate/agarose column
(Fig 3) PrpD showed maximum activity with
enzymati-cally produced (2S,3S)-methylcitrate as substrate (Km¼
440 l ) Another substrate was cis-aconitate, whereas
citrate and (2R,3S)-isocitrate (natural occurring stereoisom-er) showed no significant activity Other related compounds such as trans-aconitate, threo-2-methylisocitrate and eryth-ro-2-methylisocitrate, and (S)-malate and (R)-malate gave
no activity at all (Table 3) Unfortunately, authentic 2-methyl-cis-aconitate was not available The enzyme does not require any metal cofactors for full enzymatic activity
In UV/visible spectra, no extra band beside that at 280 nm could be seen Neither the spectra nor the activity changed after incubation of PrpD with o-phenanthroline or with the re-activation mixture as described for aconitase
The most likely product of the dehydration reaction of (2S,3S)-methylcitrate by PrpD is postulated to be 2-methyl-cis-aconitate Acidification of the reaction mixture with HCl led to an increased A259 as shown in Fig 4 This can be explained by the formation of a planar five-membered cyclic anhydride from 2-methyl-cis-aconitate under acidic conditions This condensation would be less likely with 2-methyl-trans-aconitate, which would lead to a nonplanar six-membered cyclic anhydride A comparable example of a five-membered cyclic anhydride formation between two carboxylic acid groups orientated in a cis conformation is observed in 2,3-dimethylmaleate, which is formed by a d-isomerase reaction from (R)-3-methylitaconate (2-methy-lene-3-methylsuccinate) during the nicotinate fermentation
Fig 3 Analysis of purified PrpD by SDS/PAGE The protein was overproduced with an N-terminal His tag and purified by chroma-tography on a Ni/nitrilotriacetate/agarose column Lane 1, sample of purified PrpD; lane M, molecular mass standard.
Fig 2 Analysis of the purification of AcnB by SDS/PAGE Lane 1,
crude extract (21 lg); lane 2, hydroxyapatite (30 lg); lane 3,
Q-Seph-arose (14 lg); lane 4, phenyl-SephQ-Seph-arose (5 lg); lane M, molecular mass
standard; lane 5, UnoQ column fraction 40 (2 lg); lane 6, UnoQ
column fraction 48 (2 lg); lane 7, UnoQ column fraction 49 (1 lg).
Lanes 6 and 7 show the purified AcnB protein at 94 kDa as determined
by Edman degradation.
Table 3 Substrate specificity of PrpD No activity (< 0.01 UÆmg)1) was found with threo-2-methylisocitrate and erythro-2-methylisoci-trate, trans-aconitate, D -malate and L -malate, fumarate, maleate,
D -tartrate and meso-tartrate, D -citramalate and L -citramalate, mesaconate, citraconate, itaconate, and (R,S)-3-methylitaconate.
Substrate
Concentration (m M )
Activity
UÆmg)1 %
(2S,3S)-Methylcitrate 1.0 11.4 100
(2R,3S)-Isocitrate 5–75 0.09 0.8
Trang 7by Eubacterium barkeri Under acidic conditions, dimethyl
maleate spontaneously forms the anhydride with a maximal
absorbance at 256 nm [25] The formation of
2-methyl-cis-aconitate from (2S,3S)-methylcitrate is further
suppor-ted by the substrate specificity of PrpD cis-Aconitate is a
moderate substrate, whereas no activity is detectable with
trans-aconitate
In vitro reconstitution of the methylcitrate cycle
For in vitro reconstitution, purified enzymes and
enzy-matically produced (2S,3S)-methylcitrate were used
(2S,3S)-Methylcitrate (1.3 mM) was converted into
2-methyl-cis-aconitate by the PrpD protein
2-Methyl-cis-aconitate acted as substrate for AcnB and was hydrated
to (2R,3S)-2-methylisocitrate This product was cleaved by
PrpB into succinate and pyruvate (Fig 1) To monitor the
reaction and to pull the equilibrium to the side of pyruvate
formation, lactate dehydrogenase and NADH as
cosub-strate were used This coupled assay was also used to
monitor the purification of the aconitase AcnB as described
above Absence of the aconitase or any other enzyme
resulted in a loss of pyruvate formation This result clearly
demonstrates that both proteins, PrpD and AcnB, are
essential for the conversion of methylcitrate into
2-methyl-isocitrate
Northern-blot analysis ofprpD, prpE, acnB and acs
transcripts
The four genes were selected for the following reasons
Transcription levels of acs, the gene coding for acetyl-CoA
synthetase (Acs), were used for comparison of the specificity
of transcription during growth on acetate and propionate,
respectively Furthermore, this gene was of interest because
of the ability of the Acs to activate propionate to the
corresponding CoA ester In S enterica it was shown earlier
that a strain carrying a deletion of the acs gene was still able
to grow on propionate but not on acetate A
propionyl-CoA synthetase mutant was able to grow on propionate as
well as on acetate A double mutant with deletion of both genes did not grow on acetate or propionate [10] Therefore
we postulated that transcripts of acs may be visible under both growth conditions, whereas the transcripts for propio-nyl-CoA synthetase, prpE, and methylcitrate dehydratase, prpD, should be exclusively formed during growth on propionate In contrast, transcription of acnB coding for AcnB is expected to achieve similar levels under all conditions tested AcnB is an essential enzyme of the citrate cycle, as well as of the glyoxylate cycle During growth on propionate, pyruvate is formed, which is oxidized to acetyl-CoA, a substrate for the citrate and the glyoxylate cycle [7] Furthermore, AcnB acts as 2-methylisocitrate dehydratase
Fig 4 UV spectra and difference spectrum of 2-methyl-cis-aconitate
and 2-methyl-cis-aconitate anhydride Methylcitrate was incubated with
methylcitrate dehydratase until the equilibrium of the reaction was
reached A UV spectrum was recorded (bold line) Another sample was
acidified with HCl and incubated until no further change in A 259 was
recorded A second spectrum was recorded (thin line) The difference
spectrum (inset) was calculated by the use of the Microsoft Exel
worksheet.
Fig 5 Northern-blot analysis of transcripts of acnB, acs, prpE and prpD under different growth conditions Lane 1, glucose-grown cells; lane 2, propionate-grown cells; lane 3, acetate-grown cells Equal amounts of total RNA were added in each lane Specific transcripts were detected with digoxygenin-labelled antisense RNA probes (see also Table 4 and Fig 7) An arrow denotes expected transcript sizes; the additional asterisk indicates alternative transcript sizes The sizes (kb) are: 2.0 and 5.7* for acs; 4.6 and 5.9* for prpE and prpD Further explanations are given in the Results section The small box on the right shows the region of the rRNA, to show that the same amount of RNA was applied to each lane.
Fig 6 Scheme of the structure of the E coli and S enterica prp oper-ons All genes are located in the same orientation, and the encoded proteins show sequence identities of 76–96% The E coli operon contains an additional repetitive extragenic palindromic element (REP-element) between the prpB and prpC coding sequence The DNA sequence of the intergenic region containing the REP-element is shown in the upper part of the figure Bold and italic letters highlight the single repetitive elements, respectively.
Trang 8and therefore comprises a twofold function during growth
on propionate
For the transcription experiments, RNA was purified
from E coli W3350 cells grown on glucose, acetate or
propionate as sole carbon and energy source Cells were
harvested in the early exponential growth phase
(D578¼ 0.7–1.2) and broken as described in Experimental
Procedures Quality and quantity of the RNA used in each
experiment was confirmed by the use of the Agilent 2100
Bioanalyzer For each probe, the same quantity of RNA
from cells grown on glucose, acetate or propionate was used
(Fig 5) Arrows denote main transcripts Those with an
additional asterisk denote larger transcripts, which may be
formed by a read-through and can be observed from high
gene expression or because of an alternative starting point of
transcription The first possibility may be correct for the acs
gene (2.0 kb), which is not located in an operon, but may be
transcribed together with the consecutive genes yjcH, yjcG
and yjcF (5.6 kb) The second possibility may be correct for
prpE and prpD, because the prp operon of E coli, in
contrast with that of S enterica, is interrupted by a so-called
repetitive extragenic palindromic element This element is
located between prpB and prpC (Fig 6) and may be
responsible for the two transcript sizes (4.6 and 5.9 kb),
because these elements are suspected to be involved in
transcriptional regulation [26] As expected, acnB is
expressed under all conditions tested and shows a single
transcript (Fig 5) Transcripts of prpD and prpE are
exclusively formed during growth on propionate It can be
concluded that acetate is not able to induce transcription of
the specific genes involved in propionate catabolism In
contrast, a strong signal for the transcript of acs was
observed on acetate as well as on propionate This coincides
with the investigations in S enterica described above [10]
The acs gene is able to replace prpE but not vice versa
Furthermore, propionate may be able to induce all genes of
a functional glyoxylate cycle, because activity measurements
for malate synthase of E coli grown on propionate medium
as compared with acetate showed specific activities of
0.50 UÆmg)1 and 0.48 UÆmg)1, respectively [7] The weak
acs signal detected on glucose is in agreement with the
observation of acetate excretion and consumption during
growth on glucose medium [27]
2D gel electrophoresis
2D gel electrophoresis was carried out to monitor
differ-ences in the protein pattern of cells grown on acetate or
propionate E coli W3350 cells were grown on propionate
or acetate minimal medium and crude extracts were
prepared from exponentially growing cells as described in Experimental procedures Figure 7 exemplarily displays the protein profile of E coli W3350 grown with either acetate or propionate as carbon source Protein spots, which displayed significantly different intensities under the two growth conditions, were isolated from the gels and identified by peptide mass fingerprinting (Table 4) Proteins induced in
Fig 7 Comparison of the protein profile of E coli grown in minimal
medium with acetate (A) or propionate (B) as carbon sources Crude
protein extracts were prepared and separated by 2D gel
electrophor-esis After staining with PhastGel BlueR, the gels were scanned with an
imaging system and analysed with the Melanie 3.0 software package.
Protein spots induced or repressed by propionate are marked with
arrowheads or boxes, respectively Proteins identified by peptide mass
fingerprinting are labelled with their gene names The acnB gene
product was identified by MS analysis of coseparated purified AcnB
and a comparison with previous 2DE data [33] (C) Alkaline sections
of gels covering the pH range 3–10 and containing PrpC are displayed.
Trang 9the presence of propionate at a higher or lower level than in
the presence of acetate are labelled with arrowheads and
boxes, respectively (Fig 7) PrpB, PrpC and PrpD encoded
by the prp operon were exclusively produced during growth
on propionate PrpE, the propionyl-CoA synthetase, was
detected on neither acetate nor propionate minimal
medium However, Acs seems to be present in high
amounts, suggesting that it can also serve as a
propionate-activating enzyme Furthermore, increased levels of malate
synthase (AceB) were found to be present during growth on
propionate Therefore, the main anaplerotic source of
oxaloacetate appears to be the glyoxylate cycle rather than
carboxylation of pyruvate or phosphoenolpyruvate as
proposed previously [7] Six proteins, including
phospho-glycerate mutase 1 (GpmA), a propanol-preferring alcohol
dehydrogenase (AdhP), and pyruvate kinase (PykF) seemed
to be present in reduced amounts in propionate-grown cells
compared with cultures grown in the presence of acetate
D I S C U S S I O N
AcnB purified from E coli W3350 cells grown on
propion-ate as sole carbon and energy source was the only enzyme
that displayed activity as a 2-methylisocitrate dehydratase
Similar results were obtained from S enterica AcnA and
AcnB from this organism were overproduced, and
enzy-matic activity for the dehydration of 2-methylisocitrate was
studied [11] This was in agreement with earlier
investiga-tions performed on horse and bovine heart aconitases,
which both catalyse the reversible hydration of
2-methyl-cis-aconitate to 2-methylisocitrate, but not to methylcitrate
[13,28] The aconitase from E coli (AcnB) completes the
methylcitrate cycle AcnB possesses a twofold function; it
acts as 2-methylisocitrate dehydratase and a
citrate/iso-citrate isomerase in the citrate/iso-citrate cycle The latter is also active
during growth on propionate, because a-oxidation of
propionate via methylcitrate yields pyruvate, which is
converted into acetyl-CoA and funnelled into the citrate
cycle [7] The observation that AcnB was purified instead of
AcnA is in agreement with the different expression of the
two genes AcnB was identified as the major citrate cycle enzyme, whereas AcnA is an anaerobic stationary-phase enzyme which is specifically induced by iron and redox stress [29]
Interestingly, two enzymes are involved in the conversion
of methylcitrate into 2-methylisocitrate PrpD is involved in the dehydration of (2S,3S)-methylcitrate to 2-methyl-cis-aconitate The elimination of water from (2S,3S)-methyl-citrate to 2-methyl-cis-aconitate is an unusual reaction, because it displays a syn elimination, which has not previously been found in any other dehydration of a derivative of malate This may explain why PrpD shows no significant identities with other proteins with known func-tion except deduced proteins from prp operons of many proteobacteria, e.g S enterica (Fig 6) In addition, PrpD shows sequence identities with deduced proteins from the Gram-positive Bacillus subtilis (61%, Mmge, accession no P45859), the eukaroytes Saccharomyces cerevisiae (57%, Pdh1p, accession no NP-015326) and Mus musculus (14%, immune responsive protein 1, accession no XP-127883), as well as the archaeon Sulfolobus tokodaii (23%, long hypothetical Mmge protein, accession no BAB66901) The PrpD protein from E coli possesses high substrate specificity The best substrate was stereochemically pure (2S,3S)-methylcitrate produced by methylcitrate synthases from E coli or A nidulans Partial activity was also observed with cis-aconitate As the activity with citrate was very low and that with (2R,3S)-isocitrate was almost absent, it would be of interest to identify the product of the synhydration of cis-aconitate, perhaps one enantiomer of erythro-isocitrate No significant activity was detected with many other hydroxy or unsaturated dicarboxylic and tricarboxylic acids such as trans-aconitate, threo-2-methyl-isocitrate and erythro-2-methylthreo-2-methyl-isocitrate, D-malate and
L-malate, and (R)-citramalate and (S)-citramalate (Table 3)
In E coli the dehydration of methylcitrate is independent of any metal cofactors, which was also shown for the PrpD protein from S enterica [11], but is in disagreement with another investigation [14], in which the specific activity of the purified PrpD from a genetically amplified source
Table 4 Summary of propionate-induced proteins identified by peptide mass fingerprint matching (see also Figs 5 and 7) The theoretical isoelectric point and molecular mass were calculated with the COMPUTE pI/mw tool of the proteomics tools collection at the ExPASy Molecular Biology Server (http://www.expasy.ch/tools/pi_tool.html).
Protein pI
Molecular mass (kDa) Function
SWISSPROT
acc no.
Sequence coverage (%)
1 Proteins induced at a higher level as compared with growth on acetate:
PrpB 5.44 32.1 2-Methylisocitrate lyase
(carboxyphosphoenolpyruvate phosphonomutase)
P77541 52
PrpD 5.68 54.0 Methylcitrate dehydratase P77243 49
MglB 5.68 35.7 Galactose-binding protein P02927 38
2 Proteins induced at a lower level as compared with growth on acetate:
AdhP 5.94 35.4 Propanol-preferring alcohol dehydrogenase P39451 54
GpmA 5.86 28.4 Phosphoglycerate mutase 1 P31217 39
Trang 10(1.65 UÆmg)1protein) was significantly underestimated The
substrate had been produced with the commercially
avail-able citrate synthase from pig heart, which yielded all four
possible stereoisomers rather than enantiomeric pure
(2S,3S)-methylcitrate as obtained with methylcitrate
syn-thases Furthermore, the only active stereoisomer is
pro-duced in the lowest amount [13,30] Our own observations
on the maximum activity of the PrpD protein with a
racemic mixture of all four stereoisomers of chemically
synthesized methylcitrate revealed a 10-fold decrease in
activity This may also explain the higher relative activities
obtained in the former study with substrates other than
methylcitrate
The necessary syn elimination of water performed by
PrpD may be the reason why this reaction cannot be
catalysed by aconitase Furthermore, aconitase eliminates a
proton from the R-methylene group of citrate, whereas PrpD
removes the proton from the methine group of
(2S,3S)-methylcitrate equivalent to the S-methylene group of citrate
There is also a steric conflict of the methyl group of
methylcitrate with the catalytically active Asp165 as
identi-fied in crystals of mitochondrial aconitase with bound
2-methylisocitrate [31] It remains unclear, however, whether
the citrate cycle aconitase B is always involved in the
hydration of 2-methyl-cis-aconitate to 2-methylisocitrate in
the bacterial methylcitrate pathway Some organisms, e.g
Ralstonia eutropha, seem to contain an additional aconitase
in their prp operon [32] The functionality of these proteins
and their ability to perform both reactions in the conversion
of methylcitrate into 2-methylisocitrate has to be established
Transcription of the genes of the prp operon underlies a
strong regulation Acetate is not able to induce transcription
as studied by Northern-blot experiments and 2D gel
electrophoresis Proteins such as PrpC, PrpB and PrpD
were not visible after growth on acetate, even on silver
staining (data not shown), whereas a strong signal appeared
after growth on propionate (Fig 7) Probably methylcitrate
acts as an inducer, as postulated for S enterica
Interest-ingly, we were not able to identify the PrpE protein in the
2D gels, despite the fact that a transcript of prpE was
detected in Northern-blot experiments Therefore, the
function of PrpE in wild-type E coli strains remains
unclear Activation of propionate to propionyl-CoA seems
to be performed exclusively by the Acs, which was identified
in the 2D gels and Northern-blot experiments of cells grown
on acetate as well as on propionate Probably prpE
transcripts are translated when the Acs is mutated, as
indirectly shown for S enterica In this study an acs mutant
strain was still able to grow on propionate [10]
In conclusion, the prp operon does not harbour all genes
necessary for a functional methylcitrate cycle However,
propionate catabolism via methylcitrate (Fig 1) connects
the enzymes of three different pathways to a new functional
unit: AcnB, succinate dehydrogenase, fumarase and malate
dehydrogenase from the citrate cycle, Acs from the
glyoxy-late cycle and three special enzymes, which are capable of
acting on C7organic acids (PrpC, PrpD and PrpB)
A C K N O W L E D G E M E N T S
The authors thank Professor A Mosandl, Universita¨t Frankfurt/Main,
Germany for performing the enantioselective multidimensional capillar
gas chromatography with our methylcitrate samples, and Dr D Linder,
Universita¨t Gießen, Germany, for the determination of the N-terminus
of aconitase B The work was supported by grants from Deutsche Forschungsgemeinschaft and the Fonds der Chemischen Industrie.
R E F E R E N C E S
1 Tabuchi, T., Serizawa, N & Uchiyama, H (1974) A novel path-way for the partial oxidation of propionyl-CoA to pyruvate via seven-carbon tricarboxylic acids in yeast Agric Biol Chem 38, 2571–2572.
2 Tabuchi, T & Uchiyama, H (1975) Methylcitrate condensing and methylisocitrate cleaving enzymes; evidence for the pathway of oxidation of propionyl-CoA to pyruvate via C 7 -tricarboxylic acids Agric Biol Chem 39, 2035–2042.
3 Tabuchi, T & Satoh, T (1977) Purification and properties of methylisocitrate lyase A key enzyme in propionate metabolism from Candida lipolytica Agric Biol Chem 41, 169–174.
4 Tabuchi, T., Aoki, H., Uchiyama, H & Nakahara, T (1981) 2-Methylcitrate dehydratase, a new enzyme functioning at the methylcitrate cycle of propionate metabolism Agric Biol Chem.
45, 2823–2829.
5 Tabuchi, T., Umetsu, H., Aoki, H & Uchiyama, H (1995) Characteristics of 2-methylisocitrate dehydratase, isolated from Yallowia lipolytica, in comparison with aconitase Biosci Bio-technol Biochem 59, 2013–2017.
6 Aoki, H., Uchiyama, H., Umetsu, H & Tabuchi, T (1995) Isolation of 2-methylisocitrate dehydratase, a new enzyme serving in the methylcitric acid cycle for propionate metabolism from Yallowia lipolytica Biosci Biotechnol Biochem 59, 1825– 1828.
7 Textor, S., Wendisch, V.F., De Graaf, A.A., Mu¨ller, U., Linder, M.I., Linder, D & Buckel, W (1997) Propionate oxidation in Escherichia coli: evidence for operation of a methylcitrate cycle in bacteria Arch Microbiol 168, 428–436.
8 Horswill, A.R & Escalante-Semerena, J.C (1999) Salmonella typhimurium LT2 catabolizes propionate via the 2- methylcitric acid cycle J Bacteriol 181, 5615–5623.
9 Brock, M., Darley, D., Textor, S & Buckel, W (2001) 2-Methylisocitrate lyases from the bacterium Escherichia coli and the filamentous fungus Aspergillus nidulans: characterization and comparison of both enzymes Eur J Biochem 268, 3577– 3586.
10 Horswill, A.R & Escalante-Semerena, J.C (1999) The prpE gene
of Salmonella typhimurium LT2 encodes propionyl-CoA synthe-tase Microbiology 145, 1381–1388.
11 Horswill, A.R & Escalante-Semerena, J.C (2001) In vitro con-version of propionate to pyruvate by Salmonella enterica enzymes: 2-methylcitrate dehydratase (PrpD) and aconitase enzymes cata-lyze the conversion of 2-methylcitrate to 2-methylisocitrate Biochemistry 40, 4703–4713.
12 Creighton, D.J & Murthy, N.R.S.K (1990) Stereochemistry of enzyme-catalysed reactions at carbon In The Enzymes, Vol 19, 3rd edn (Sigman, D.S & Boyer, P.D., eds), pp 324–421 Academic Press Inc., San Diego, USA.
13 Beach, R.L., Aogaichi, T & Plaut, G.W (1977) Identification of
D -threo-alpha-methylisocitrate as stereochemically specific sub-strate for bovine heart aconitase and inhibitor of TPN-linked isocitrate dehydrogenase J Biol Chem 252, 2702–2709.
14 Blank, L., Green, J & Guest, J.R ( 2002) AcnC of Escherichia coli
is a 2-methylcitrate dehydratase (PrpD) that can use citrate and isocitrate as substrates Microbiology 148, 133–146.
15 Campbell, A (1961) Sensitive mutants of bacteriophage lambda Virology 14, 22–32.
16 Widdel, F & Bak, F (1991) Gram-negative mesophilic sulfate reducing bacteria In The Prokaryotes (Balows, A., Tru¨per, H.G., Dworkin, M., Harder, W & Schleifer, K.-H., eds), pp 3352–3378 Springer, Heidelberg, Germany.