Báo cáo khoa học: Role of disulfide bonds in goose-type lysozyme potx

Role of disulfide bonds in goose-type lysozyme Shunsuke Kawamura 1 , Mari Ohkuma 1 , Yuki Chijiiwa 1 , Daiki Kohno 1 , Hiroyuki Nakagawa 1 , Hideki Hirakawa 2 , Satoru Kuhara 2,3 and Takao Torikata 1 1 Department of Bioscience, School of Agriculture, Tokai University, Aso, Kumamoto, Japan 2 Graduate School of Systems Life Sciences, Kyushu University, Hakozaki, Higashi-ku, Fukuoka, Japan 3 Graduate School of Genetic Resource Technology, Kyushu University, Hakozaki, Higashi-ku, Fukuoka, Japan Lysozyme, one of the best characterized carbohydro- lases, cleaves the glycosidic linkage between N-acetyl- glucosamine (GlcNAc) and N-acetylmuramic acid in bacterial cell walls. This enzyme is classified into six types, chicken type (C-type) [1–3], phage type (T4-type) [4,5], goose type (G-type) [6–8], invertebrate type [9–11], bacteria type [12], and plant type [13], on the basis of the similarity in amino acid sequences. These different classes of lysozymes have overall simi- larities in tertiary structure [7,14–17], although their amino acid sequences are almost entirely different. Much information on the structural properties and enzymatic mechanisms of C-type and T4-type lyso- zymes has been accumulated thus far. In particular, hen egg-white lysozyme and human lysozyme, which belong to a class of C-type lysozymes with four disul- fide bonds, and T4 phage lysozyme with no disulfide bonds, have been intensively studied as model proteins for elucidating enzymatic function and protein stabil- ity. In contrast to C-type and T4-type lysozymes, information on G-type lysozyme is limited. In verte- brates, the primary structure has been reported for five Keywords disulfide bonds; goose-type lysozyme; ostrich; site-directed mutagenesis; structural stability Correspondence S. Kawamura, Department of Bioscience, School of Agriculture, Tokai University, Aso, Kumamoto 869-1404, Japan Fax: +81 967 67 3960 Tel: +81 967 67 3918 E-mail: kawamura@agri.u-tokai.ac.jp (Received 15 November 2007, revised 3 March 2008, accepted 25 March 2008) doi:10.1111/j.1742-4658.2008.06422.x The role of the two disulfide bonds (Cys4–Cys60 and Cys18–Cys29) in the activity and stability of goose-type (G-type) lysozyme was investigated using ostrich egg-white lysozyme as a model. Each of the two disulfide bonds was deleted separately or simultaneously by substituting both Cys residues with either Ser or Ala. No remarkable differences in secondary structure or catalytic activity were observed between the wild-type and mutant proteins. However, thermal and guanidine hydrochloride unfolding experiments revealed that the stabilities of mutants lacking one or both of the disulfide bonds were significantly decreased relative to those of the wild-type. The destabilization energies of mutant proteins agreed well with those predicted from entropic effects in the denatured state. The effects of deleting each disulfide bond on protein stability were found to be approxi- mately additive, indicating that the individual disulfide bonds contribute to the stability of G-type lysozyme in an independent manner. Under reducing conditions, the thermal stability of the wild-type was decreased to a level nearly equivalent to that of a Cys-free mutant (C4S ⁄ C18S ⁄ C29S ⁄ C60S) in which all Cys residues were replaced by Ser. Moreover, the optimum tem- perature of the catalytic activity for the Cys-free mutant was downshifted by about 20 °C as compared with that of the wild-type. These results indi- cate that the formation of the two disulfide bonds is not essential for the correct folding into the catalytically active conformation, but is crucial for the structural stability of G-type lysozyme. Abbreviations (GlcNAc) n , b-1,4-linked oligosaccharide of GlcNAc with a polymerization degree of n; C-type, chicken type; GEL, goose egg-white lysozyme; GlcNAc, N-acetylglucosamine; G-type, goose type; MD, molecular dynamics; OEL, ostrich egg-white lysozyme; T4-type, phage type; b-ME, b-mercaptoethanol. 2818 FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS G-type lysozymes, i.e. those from ostrich [18], black swan [19], embden goose [6], cassowary [20], and rhea [21], and five from chicken [22], flounder [23], carp [24], salmon [25], and orange-spotted grouper [26]. Additionally, Irwin & Gong [27] reported that mam- mals and zebrafish carry two G-type lysozyme genes. Recently, invertebrate G-type lysozyme genes and ⁄ or enzyme activity from scallop [28,29] and tunicate [30] were also reported. G-type lysozyme differs from the C-type in that it is much more specific for peptide- substituted substrate [31]. C-type lysozyme hydrolyzes a homopolymer (chitin) effectively, whereas G-type lysozyme is a poor catalyst of the hydrolysis of this substrate. The differences in substrate specificity between these lysozymes and the mechanistic details of the catalytic reaction of G-type lysozyme remain unclear. Previously, Honda & Fukamizo reported the mode of binding of GlcNAc oligomer to goose egg- white lysozyme (GEL), and postulated that GEL has six substrate-binding subsites (sites B–G) [32]. This subsite structure was partly visualized in terms of the crystal structure of the GEL–(GlcNAc) 3 complex [14]; however, part of the subsite structure (sites E–G) remains unknown. On the basis of sequence comparison of G-type lyso- zymes, we have shown that the amino acid sequences of three a-helices (a5, a7, and a8) are highly conserved in this enzyme group [20,21]. These three a-helices are located at the center of the protein molecule, and form a hydrophobic core in the overall structure of G-type lysozyme (Fig. 1). Recently, using ostrich egg-white lysozyme (OEL) as a model, we demonstrated the involvement of Glu73 on a5 (Ala64–Glu73) as a criti- cal catalytic residue and also indicated the crucial role of Glu73 in the structural stability of G-type lysozyme, probably through the interhelical hydrogen bond with Tyr169 on a8 (Tyr169–Gln182) [33]. These observa- tions suggest that the core elements (a5, a7, and a8) play an important role in the maintenance of the three-dimensional structure of G-type lysozyme. In addition to the three a-helices, the Cys4–Cys60 and Cys18–Cys29 disulfide bonds (numbering from bird sequences), which are located in the N-terminal region, are completely conserved in avian and mamma- lian G-type lysozymes, although another three Cys res- idues are conserved from mouse to human [20,21,27]. In the crystal structure of GEL (Fig. 1), which shares 83% amino acid identity with OEL, these two disulfide bonds are located on the molecular surface, although Cys60 is partially buried in the interior of the protein. It has been shown that the integrity of the native three-dimensional structure of many proteins is pro- moted by the presence of disulfide bonds, because removal of one or more of these linkages results in a reduction in the stability of the native state relative to the denatured state [34–44]. On the other hand, none of the four disulfide bonds was reported to be impor- tant in stabilizing the native structure of the Pseudoal- teromonas haloplanktis a-amylase [45]. It was also shown that the Cys191–Cys220 disulfide bond, which is highly conserved in the trypsin family of serine pro- teases, is not essential for the catalytic function, struc- ture and stability of trypsin [46]. Therefore, analysis of the role of the disulfide bonds in activity and stability will be useful for our understanding of the structure– function relationship of G-type lysozyme. The present article describes a site-directed mutational analysis of OEL to address the role of the disulfide bonds in G-type lysozyme. Results and Discussion Choice of residues for mutagenesis A striking difference within G-type lysozymes is the variation in Cys content. There are four conserved Cys residues in avian and mammalian G-type lysozymes, which form two intramolecular disulfide bonds in the mature proteins [20,21,27]. The crystal structure of GEL shows that the Cys18–Cys29 disulfide bond con- nects the N-terminus of a-helix 1 with a loop between a-helices 1 and 2, and the Cys4–Cys60 disulfide bond connects the N-terminal long loop with a loop between a-helices 4 and 5. The G-type lysozymes found in fish have either no Cys residue, as in flounder and grouper [23,26], one, as in carp and salmon [24,25], or two (no potential to form an intramolecular disulfide bond), as in zebrafish [27]. The absence of intramolecular Fig. 1. The three-dimensional structure of GEL. The structure was created using the coordinate file, Protein Data Bank entry 153L [14]. The two disulfide bonds (Cys4–Cys60 and Cys18–Cys29) and three a-helices (a5, a7, and a8) are shown in blue and green, respectively. The side chain of Glu73 is also shown in red. The figure was generated using MOLSCRIPT (v. 2.1.2). S. Kawamura et al. Disulfide bonds in goose-type lysozyme FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS 2819 disulfide bonds seems to be a common characteristic among the fish G-type lysozymes. The G-type lyso- zymes in invertebrates have six to 13 Cys residues other than the four Cys residues conserved in avian and mammalian G-type lysozymes, which renders the disulfide patterns of invertebrate G-type lysozymes quite different from those of the bird and mammalian lysozymes [28–30]. As the locations of disulfide bonds in invertebrate G-type lysozymes have not yet been identified, we decided to focus our attention on the Cys18–Cys29 and Cys4–Cys60 disulfide bonds, which are absolutely conserved in avian and mammalian G-type lysozymes. Expression and characterization of mutant proteins To investigate the contribution of the two disulfide bonds to the activity and stability of G-type lysozyme, three mutant proteins (C4S ⁄ C60S, C18S ⁄ C29S, and C4S ⁄ C18S ⁄ C29S ⁄ C60S), in which each of the disulfide bonds was singly or together disrupted by Cys fi Ser mutations, were initially constructed. The Ser residue was chosen because it is structurally similar to Cys except that it contains a hydroxyl group instead of a thiol group. The mutant proteins were expressed and purified in the same manner as used for the wild-type [33]. The yields of the mutant proteins were com- parable to that of the wild-type, approximately 60–70 mgÆL )1 . The purified proteins were found to be homogeneous on analysis by SDS ⁄ PAGE, and gave a single peak on RP-HPLC (data not shown). The N-ter- minal sequence of each mutant protein was determined to be Ser-Arg-Thr-Gly, which coincided with that of the wild-type, indicating that each mutant was correctly processed at the C-terminus of the a-factor signal. The integrity of the mutant proteins was confirmed by mea- surements of far-ultraviolet CD. The CD spectra of the three mutants were almost indistinguishable from that of the wild-type (Fig. 2), indicating that the backbone conformation of the mutant proteins is practically the same as that of the wild-type. Thus, it appears that none of the disulfide bonds are critically important to the folding process of G-type lysozyme. Effects of mutations on catalytic activity We previously reported that the recombinant OEL preferentially hydrolyzes the third glycosidic linkage from the nonreducing end of (GlcNAc) 6 , and the cleavage pattern seen for (GlcNAc) 5 is similar to that seen for (GlcNAc) 6 [47]. To examine the effects of the mutations on the catalytic activity of G-type lysozyme, we initially analyzed the activities of the wild-type and its mutants by monitoring the enzyme-catalyzed lysis of Micrococcus luteus cells, which is a high molecular mass polymeric substrate with a highly negative charge. Mutant C4S ⁄ C60S had lytic activity to the same extent as the wild-type, exhibiting 99.0% activity. The lytic activities of mutants C18S ⁄ C29S and C4S ⁄ C18S ⁄ C29S ⁄ C60S were 76.5% and 70.6% of that of the wild-type, respectively (data not shown). As the substrate used for lytic activity is chemically heteroge- neous, the activities of the wild-type and three mutant proteins were more precisely evaluated by measuring the enzyme-catalyzed hydrolysis of (GlcNAc) 5 (Fig. 3). Consistent with the results obtained in the M. luteus assay, the wild-type and mutant C4S ⁄ C60S hydrolyzed the initial substrate (GlcNAc) 5 almost completely after 240 min of reaction, and (GlcNAc) 5 was hydrolyzed mainly to (GlcNAc) 2 + (GlcNAc) 3 with much less cleavage to (GlcNAc) 1 + (GlcNAc) 4 . Mutants C18S ⁄ C29S and C4S ⁄ C18S ⁄ C29S ⁄ C60S hydrolyzed (GlcNAc) 5 to produce (GlcNAc) 2 and (GlcNAc) 3 ,as in the case of the wild-type, although the overall rates of hydrolysis were slightly affected by each of the mutations: the two mutants took 420 min to hydrolyze most of the (GlcNAc) 5 . These results are consistent with the fact that each of the two disulfide bonds is –30 –20 –10 0 10 20 30 40 50 60 190 210 230 250 Wavelen g th (nm) [θ] × 10 3 (deg cm 2 · dmol –1 ) Wild type C18S/C29S C4S/C60S C4S/C18S/C29S/C60S Fig. 2. CD spectra of the wild-type and its three mutant proteins in the far-UV region. Disulfide bonds in goose-type lysozyme S. Kawamura et al. 2820 FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS far apart from the catalytic glutamate, Glu73, in the crystal structure of GEL (even the nearest two resi- dues, Cys18 and Glu73, are located 16.8 A ˚ apart from each other). Although the reason for the slight reduc- tion in the activity of the two mutants is presently obscure, none of the disulfide bonds is considered to be critically important to the catalytic function of G-type lysozyme. This observation, together with the result obtained by CD analysis, implies that G-type lysozyme can fold and function in the absence of both disulfide bonds. This is consistent with the findings that the flounder and salmon G-type lysozymes, which have no disulfide bonds in their native forms, and the scallop G-type lysozyme, which has six Cys residues other than the well-conserved four Cys residues in birds, possessed lytic activity against Micrococcus lysodeikticus [23,25,29]. Effects of mutations on stability Disulfide bonds have been suggested to play an impor- tant role in maintaining structural integrity and protein stabilization. This conclusion has been supported by characterization of mutants of various proteins in which disulfide bonds have been either deleted or mod- ified. For example, Pace et al. [34] reported that dis- ruption of one and two disulfide bonds in ribonuclease T1 caused decreases in conformational stability by 3.4 and 7.2–9.3 kcalÆmol )1 , respectively. Many other examples can be found in the reviews by Wetzel [48] and Bets [49]. It is widely accepted that the stabilizing effect of a disulfide bond can be attributed principally to the destabilization of the unfolded form by the loss of conformational entropy imposed by the crosslink [34,36,39,50–54]. However, the mechanism of protein stabilization by disulfide bond formation is difficult to resolve, because the disulfide bond may influence the enthalpy and entropy of both the native and unfolded states of the protein [49]. The thermal unfolding of the wild-type protein has been investigated using CD and fluorescence spectros- copy, and led to the observation that the unfolding transition of the wild-type is well represented by a two- state mechanism at pH 5.0 in the presence of 0.5 m guanidine hydrochloride [33]. Like the wild-type pro- tein, the three mutants (C18S ⁄ C29S, C4S ⁄ C60S, and C4S ⁄ C18S ⁄ C29S ⁄ C60S) reversibly unfolded in a single cooperative fashion under these conditions. The ther- mal unfolding curves of the wild-type and three mutant proteins obtained with fluorescence measurements are shown in Fig. 4A. Replacing Cys18 and Cys29 or Cys4 and Cys60 with a pair of Ser residues had significant effects on the thermal unfolding of the mutant proteins. The T m values for mutants C18S ⁄ C29S and C4S ⁄ C60S were decreased by 6.3 °C and 9.5 °C, respectively, as compared to 60.6 °C for the wild-type (Table 1). The Cys mutations reduced the thermostability of the pro- teins by 3.11 and 4.29 kcalÆmol )1 for mutants C18S ⁄ C29S and C4S ⁄ C60S, respectively, at 60.6 °C. The combination of these destabilizing mutations (C4S ⁄ C18S ⁄ C29S ⁄ C60S) caused a further decrease in thermostability relative to the wild-type by 15.3 °C (DDG: )6.14 kcalÆmol )1 ) (Table 1). The contribution of the disulfide bonds to the struc- tural stability of OEL was further assessed by means of unfolding experiments with guanidine hydrochloride as a denaturant. Figure 4B shows the guanidine hydro- chloride-induced unfolding curves of the wild-type and Fig. 3. Time course plots of (GlcNAc) 5 degradation by the wild-type and its three mutant proteins. The enzymatic reaction was performed in 10 m M sodium acetate buffer (pH 4.0) at 40 °C. Numerals in the figures are the polymerization degrees of the reaction product species. Relative error indicates the recovery of the observed value at each reaction time calculated as described in Experimental procedures. The solid lines were drawn by roughly following the experimental data points. S. Kawamura et al. Disulfide bonds in goose-type lysozyme FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS 2821 mutant proteins obtained with fluorescence measure- ments. The transitions of the three mutant proteins were highly cooperative. The unfolding transitions of the mutant proteins occurred at lower concentrations of guanidine hydrochloride than that of the wild-type: the C m values were reduced, as compared with that of the wild-type, by 0.47, 0.70 and 1.07 m for mutants C18S ⁄ C29S, C4S ⁄ C60S, and C4S ⁄ C18S ⁄ C29S ⁄ C60S, respectively (Table 2). The DG H2O values of unfolding indicated that the three mutants, C18S ⁄ C29S, C4S ⁄ C60S, and C4S⁄ C18S ⁄ C29S ⁄ C60S, were destabi- lized by 2.33, 3.33 and 4.86 kcalÆmol )1 , respectively, at 0 m guanidine hydrochloride in comparison to the wild-type. The decrease in the stability of the least stable C4S ⁄ C18S ⁄ C29S ⁄ C60S mutant was further confirmed by CD measurements: its thermal and guanidine hydrochloride transition curves derived from the CD and fluorescence data completely coincided, and the T m and C m values obtained with CD were in good agreement with the data determined with fluorescence (Fig. 5, and Tables 1 and 2). The coinciding transitions derived from these two different methods also indicate that the Cys-free mutant undergoes thermal and guani- dine hydrochloride-induced denaturation, which is con- sidered to be a reversible two-state process as observed in the wild-type. It is thus likely that the fold- ing ⁄ unfolding pathway of G-type lysozyme does not significantly change in the absence of one or both of the disulfide bonds, which supports the notion that the presence of a complete set of disulfide bonds is not required for the folding process of G-type lysozyme. To corroborate the importance of the disulfide bonds in the structural stability of OEL, two mutant proteins (C18A ⁄ C29A and C4A ⁄ C60A), in which Cys18 and Cys29 or Cys4 and Cys60 were replaced by Ala, respectively, were constructed and analyzed with respect to their guanidine hydrochloride dena- turation (Fig. 4B and Table 2). It was found that mutants C18A⁄ C29A and C4A ⁄ C60A exhibited the same stabilities as mutants C18S ⁄ C29S and C4S ⁄ C60S, respectively, which strongly suggests that the observed destabilization arising from the Cys to Ser or Ala mutations is not due to negative side –0.2 0 0.2 0.4 0.6 0.8 1.0 1.2 30 35 40 45 50 55 60 65 70 75 80 Temperature (ºC) Fraction unfolded Wild-type C18S/C29S C4S/C60S C4S/C18S/C29S/C60S Wild-type (reduced) –0.2 0 0.2 0.4 0.6 0.8 1.0 1.2 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 GdnHCl (M) Fraction unfolded Wild-type C18S/C29S C4S/C60S C4S/C18S/C29S/C60S C18A/C29A C4A/C60A A B Fig. 4. Thermal and guanidine hydrochloride (GdnHCl)-induced unfolding curves of the wild-type and its mutant proteins obtained by fluorescence measurements. (A) and (B) show the thermal and guanidine hydrochloride unfolding curves of the wild-type and its mutant proteins, respectively. Experimental details are described in Experimental procedures. The thermal unfolding curve of the wild- type treated with 0.1 M b-ME for reduction is indicated as ‘wild- type (reduced)’. Table 1. Parameters characterizing the thermal denaturation of the wild-type and the three mutants. Thermodynamic parameters were cal- culated from the thermal unfolding curves presented in Figs 4A and 5A. All values are the averages of at least two determinations. Data for the wild-type protein were reported by Kawamura et al. [33]. Errors are within ± 0.3 °C for T m , ± 5.5 kcalÆmol )1 for DH m , and ± 0.016 kca- lÆmol )1 K for DS m for the wild-type protein, determined from four independent experiments. Flu, fluorescence. Protein Method DH m (kcalÆmol )1 ) DS m (kcalÆmol )1 ÆK) T m (°C) DT m (°C) DDG (kcalÆmol )1 ) Wild-type Flu 170.1 0.510 60.6 – – C18S ⁄ C29S Flu 161.8 0.494 54.3 )6.3 )3.11 C4S ⁄ C60S Flu 145.5 0.452 51.1 )9.5 )4.29 C4S ⁄ C18S ⁄ C29S ⁄ C60S Flu 127.6 0.401 45.3 )15.3 )6.14 Wild-type (reduced) Flu 107.6 0.337 46.2 )14.4 )4.85 Wild-type CD 166.9 0.501 60.5 – – C4S ⁄ C18S ⁄ C29S ⁄ C60S CD 125.0 0.393 45.3 )15.2 )5.97 Disulfide bonds in goose-type lysozyme S. Kawamura et al. 2822 FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS effects of the introduction of the present mutations, but is due mainly to deletion of the disulfide bond(s). We also examined the thermal stability of the wild- type treated with 0.1 m b-mercaptoethanol (b-ME) for reduction and compared it with those of the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S (Fig. 4A and Table 1). The reduced wild-type exhibited a marked decrease in thermostability relative to the nonreduced wild-type of 14.4 °C(DDG: )4.85 kcalÆmol )1 ). The T m value for the reduced wild-type was 46.2 °C, a value almost identical to that of the Cys-free mutant (T m 45.3 °C). No change was observed for the Cys-free mutant when it was melted in the presence of 0.1 m b-ME (data not shown). In addition, the temperature dependence of the cata- lytic activity against (GlcNAc) 5 for the Cys-free mutant was examined, and the result was compared with that for the wild-type (Fig. 6). The wild-type protein exhibited the highest activity at 60 °C, and the activity was drastically reduced at 65 °C or above. In contrast, the optimum temperature for the Cys-free mutant was decreased to 40 °C, which was about 20 °C lower than that of the wild-type, and a remark- able drop of the activity was observed above this temperature. All of these results indicate that the two disulfide bonds are directly involved in the structural stability of G-type lysozyme. Interestingly, the optimum temperature of the lytic activity for the floun- der G-type lysozyme was shown to be 25 °C by lyso- plate assay [23]. Our results suggest that the low optimum temperature observed for the flounder lyso- zyme could be a consequence of the absence of the two intrachain disulfide bonds. In the case of inverte- brate G-type lysozymes, the high content of Cys residues suggests their importance in protein stability. We noted that the decrease in the T m value for mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S ()15.3 °C) agreed well with the sum of the decreases in the T m values for mutants C4S ⁄ C60S and C18S ⁄ C29S ()15.8 °C). The DC m value for the Cys-free mutant ()1.07 m) was also found to be Table 2. Parameters characterizing the guanidine hydrochloride denaturation at pH 5.0 and 30 °C. Parameters were calculated from the gua- nidine hydrochloride unfolding curves presented in Figs 4B and 5B. All values are the averages of at least two determinations. Data for the wild-type protein were reported by Kawamura et al. [33]. Errors are within ± 0.03 M for C m , ± 0.09 kcalÆmol )1 ÆM for m, and ± 0.08 kcalÆmol )1 for DG H2O for the wild-type protein, determined from four independent experiments. Flu, fluorescence. Protein Method m (kcalÆmol )1 ÆM) C m (M) DC m (M) DG H2O (kcalÆmol )1 ) DDG H2O (kcalÆmol )1 ) Wild-type Flu 5.48 2.21 – 12.11 – C18S ⁄ C29S Flu 5.67 1.74 –0.47 9.88 )2.33 C4S ⁄ C60S Flu 5.84 1.51 )0.70 8.78 )3.33 C4S ⁄ C18S ⁄ C29S ⁄ C60S Flu 6.38 1.14 )1.07 7.25 )4.86 C18A ⁄ C29A Flu 5.68 1.75 )0.46 9.93 )2.18 C4A ⁄ C60A Flu 5.90 1.51 )0.70 8.93 )3.18 Wild-type CD 5.32 2.20 – 11.73 – C4S ⁄ C18S ⁄ C29S ⁄ C60S CD 6.37 1.14 )1.06 7.25 ) 4.48 –0.2 0 0.2 0.4 0.6 0.8 1.0 1.2 Temperature (ºC) Fraction unfolded Wild-type (Flu) Wild-type (CD) C4S/C18S/C29S/C60S (Flu) C4S/C18S/C29S/C60S (CD) –0.2 0 0.2 0.4 0.6 0.8 1.0 1.2 GdnHCl(M) Fraction unfolded Wild-type (Flu) Wild-type (CD) C4S/C18S/C29S/C60S (Flu) C4S/C18S/C29S/C60S (CD) 30 35 40 45 50 55 60 65 70 75 80 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 A B Fig. 5. Thermal and guanidine hydrochloride (GdnHCl)-induced unfolding curves of the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S obtained by CD and fluorescence measurements. (A) and (B) show the thermal and guanidine hydrochloride unfolding curves, respectively. Experimental details are described in Experi- mental procedures. The unfolding curves of the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S obtained with CD are indicated as ‘wild-type (CD)’ and ‘C4S ⁄ C18S ⁄ C29S ⁄ C60S (CD)’, respectively, and those of the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S obtained with fluorescence are indicated as ‘wild-type (Flu)’ and ‘C4S ⁄ C18S ⁄ C29S ⁄ C60S (Flu)’, respectively. S. Kawamura et al. Disulfide bonds in goose-type lysozyme FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS 2823 nearly equal to the sum of the DC m values for the corresponding double mutants ()1.17 m). These findings indicate that the effects on the protein stability of delet- ing the disulfide bonds are approximately additive. As the locations of the two disulfide bonds are far from each other in the crystal structure of GEL (Fig. 1), the individual disulfide bonds probably contribute to the structural stability of G-type lysozyme in an indepen- dent manner rather than in a cooperative manner. We can assume two mechanisms by which the disul- fide bonds affect stability. One is the entropic effect on the unfolded forms, and the other is the effect of the amino acid substitutions on the native forms. Theoreti- cal approaches have suggested that the entropic effect (DS) will be related to the size of the loop enclosed by the crosslink (n). A commonly used approximation is that derived by Pace et al. [34]: DS = )2.1–1.5 · R · ln n (calÆmol )1 ÆK), where R is the gas constant. According to the equation, the increases in entropy in the unfolded proteins caused by deletion of the Cys18– Cys29 and Cys4–Cys60 disulfide bonds are 9.51 and 14.15 calÆmol )1 ÆK, respectively. In terms of free energy, the expected entropic destabilization ()TDS)of mutants C18S ⁄ C29S and C4S ⁄ C60S is )3.17 and )4.72 kcalÆmol )1 , respectively, at the T m value of the wild-type at pH 5.0 (60.6 °C). These theoretical values are in good agreement with the observed DDG values for mutants C18S ⁄ C29S () 3.11 kcalÆmol )1 ) and C4S ⁄ C60S ()4.29 kcalÆmol )1 ) (Table 1). The sum of the theoretical values for the two double mutants ()7.40 kcalÆmol )1 ) is also comparable to the observed DDG value for the Cys-free mutant ()6.14 kcalÆmol )1 ). These results suggest that the increase in entropy of the unfolded state is a dominant factor determining the DDG. In the case of the guanidine hydrochloride denaturation, the expected entropic destabilization at 30 °Cis)2.88 and )4.29 kcalÆmol )1 for mutants C18S ⁄ C29S and C4S ⁄ C60S, respectively. These theo- retical values are close to but lower than the observed DDG H2O values for mutants C18S ⁄ C29S ( )2.33 kcalÆ mol )1 ) and C4S ⁄ C60S ()3.33 kcalÆmol )1 ) (Table 2). However, as a small error in m results in a large devia- tion in DG H2O , due to a long extrapolation to 0 m denaturant, and as the concentration of guanidine hydrochloride at the midpoint of the denaturation (C m ) is regarded as the most reliable parameter for estimation of protein stability [55], the destabilization energies (DDG D ) of the three mutants (C18S ⁄ C29S, C4S ⁄ C60S, and C4S ⁄ C18S ⁄ C29S ⁄ C60S) were recalcu- lated using the equation [56] DDG D = m¢(C¢ m ) C m ), where m¢ and C¢ m are the values for the mutant, and C m is the value for for the wild-type. The destabiliza- tion energies thus obtained are )2.66 and )4.09 kcalÆ mol )1 for mutants C18S ⁄ C29S and C4S ⁄ C60S, respec- tively, which are in good agreement with the respective theoretical values. The DDG D value for the Cys-free mutant ()6.83 kcalÆ mol )1 ) is also nearly equal to the sum of the theoretical values for the corresponding double mutants ()7.17 kcalÆmol )1 ). These findings sug- gest that deletion of one or both of the disulfide bonds increases the conformational entropy of the unfolded state, thereby stabilizing the unfolded state and, as a result, destabilizing the protein thermodynamically. This is in agreement with the proposal that stabiliza- tion of proteins by disulfide bonds can be essentially ascribed to a decrease of the conformational entropy of the unfolded state. Cooper et al. [36] showed that the reduction in T m resulting from selective disruption and modification of the Cys6–Cys127 disulfide bond of hen egg-white lysozyme is totally attributable to an increase in the entropy difference between the native and denatured states. In contrast, Doig & Williams [57] reported, from a thermodynamic analysis on six small proteins, that the dominant effect of disulfide bonds on stability is enthalpic. The thermodynamic characterization of a mutant human lysozyme lacking the Cys77–Cys95 disulfide bond showed that the decrease in DG H2O for the mutant protein was caused Tem p erature (ºC) Concentration of hydrolyzed (GlcNAc) 5 at each temperature (mM) 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 10 20 30 40 50 60 70 80 90 Wild-type C4S/C18S/C29S/C60S Fig. 6. Temperature dependence of the catalytic activity for the hydrolysis of (GlcNAc) 5 by the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S. The concentrations of hydrolyzed (Glc- NAc) 5 at each temperature were calculated by subtracting the concentration of the remaining (GlcNAc) 5 from that of the initial (GlcNAc) 5 substrate. Disulfide bonds in goose-type lysozyme S. Kawamura et al. 2824 FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS by both entropic and enthalpic factors [37]. Therefore, detailed calorimetric measurements of the mutant pro- teins will be required to determine the thermodynamic parameters precisely. Heat inactivation Next, we examined the stability against irreversible heat inactivation for the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S. Unexpectedly, no difference was observed in the irreversible heat inactivation of these enzymes (data not shown). Both enzymes regained 60% and 20% of their activities after 2 h at 80 °C and 90 °C, respectively. This is consistent with the recent finding that the salmon G-type lysozyme with no disulfide bonds, which has an optimum tem- perature of 30 °C, regained 30% of its activity immedi- ately after incubation at 90 °C for 3 h [25]. As suggested by Kyomuhendo et al. [25], it appears that OEL, as in the case of the salmon protein, possesses an extraordinary capacity to correctly refold its struc- ture. When considered together with the result obtained for the salmon protein, this indicates that, probably, no disulfide bonds are required for the fold- ing process of G-type lysozyme. Homology modeling and MD (molecular dynamics) simulation The tertiary structures of the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S were constructed by homology modeling on the basis of the X-ray structure of GEL [14]. The Ramachandran plot provided by procheck ensured very good confidence for the wild-type and the mutant protein. The reliabilities of the constructed structures were with 94.3% residues in the most favored regions and 5.7% in additional allowed regions. There were no residues in the generously allowed regions and disallowed regions in the two proteins. Figure 7A shows the distribution of the B-factors of the main chain atoms (N, C a , C, and O) in the MD-generated average structural models of the wild- type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S. The mole- cules are colored according to the B-factor, from dark blue for low B-factor to red for high B-factor. Although the overall structure of the mutant was quite similar to that of the wild-type, an increase in B-factors throughout the molecule was observed in the Cys-free mutant. This increase indicates that the conformation of the mutant protein becomes more flexible. Figure 7B shows the plots of the B-factors of the main chain atoms versus each residue for the wild-type and the Cys-free mutant. All B-factors of the Cys-free mutant were substantially higher than those of the wild-type. The average B-factors of the main chain atoms for the wild-type and the Cys-free mutant in the 200 samples obtained by the MD sim- ulations were 36.4 and 63.1 A ˚ 2 , respectively. These findings suggest that the two disulfide bonds in G-type lysozyme act to keep the protein molecule folded tightly. A B Fig. 7. (A) Residue flexibilities calculated for the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S. The ribbon diagram was colored on the basis of the amplitudes of fluctuations (B-factor) of individual residues. A blue-to-red color spectrum is used to represent different levels of flexibilities, where the smallest motions are in blue and the highest ones are in red. (B) Amplitudes of B-factors of each amino acid residue. The B-factors for the wild-type and mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S are shown as blue and pink lines, respectively. The locations of a-helices and b-sheets in the wild-type are shown as red and sky-blue lines, respec- tively. The locations of the four Cys residues are shown as green bars. S. Kawamura et al. Disulfide bonds in goose-type lysozyme FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS 2825 Conclusions Our results demonstrated experimentally that the indi- vidual disulfide bonds contribute significantly to the structural stability of G-type lysozyme in an indepen- dent manner. The results also suggested that the reduced stabilities caused by deletion of one or both of the disulfide bonds are due mainly to entropic effects. The MD data showed that deletion of the two disulfide bonds makes the protein conformation more flexible. It is thus speculated that the formation of the disulfide bonds is involved in the structural stability of G-type lysozyme by reducing the confor- mational entropy of the unfolded state and by increasing the rigidity of the protein molecule. We also found that deletion of both disulfide bonds does not prevent the proper folding into the catalytically active conformation of G-type lysozyme. This sug- gests that the formation of the two disulfide bonds of G-type lysozyme occurs late in the folding process, and that these disulfide bonds can be formed inde- pendently rather than sequentially. It is therefore sug- gested that the structure around the mutation sites, the N-terminal region in this case (Arg1–Cys60), may not be responsible for the folding initiation site of G-type lysozyme. When the overall results are taken into account, the two disulfide bonds of G-type lyso- zyme may confer stability after the protein reaches its final folded form in the absence of both disulfide bonds. On the other hand, we have shown that G-type lysozyme has a structurally invariant core composed of three a-helices (a5, a7, and a8) [20,21]. Previous investigations of protein folding suggested that a-helical structures are formed at an early stage in protein folding [58–63]. As G-type lysozyme was considered to require no disulfide bonds for folding and function, we suppose that the three a-helices may pack together in the early stage of the folding process and act as nucleation sites around which the structure can be formed. Experimental procedures Materials All enzymes used for DNA manipulation were purchased from TaKaRa (Otsu, Japan) and Toyobo (Osaka, Japan). The oligonucleotides used were from Hokkaido System Sci- ence (Sapporo, Japan). Escherichia coli strain JM109 was used for the transformation and propagation of recombi- nant plasmids. Multi-Copy Pichia Expression kits, including expression plasmid pPIC9K and host strain GS115, were obtained from Invitrogen (Carlsbad, CA, USA). N-Acetyl- glucosamine oligosaccharides [(GlcNAc) n ] were prepared by acid hydrolysis of chitin followed by charcoal celite column chromatography [64]. M. luteus cells were from Sigma (St Louis, MO, USA). Other reagents were of analytical or biochemical grade. Preparation of mutant proteins Recombinant OEL with an extra Ser at the N-terminus was prepared as described previously [33] and used throughout this study as the wild-type. It should be noted that the additional Ser residue at the N-terminus had little effect on the secondary structure, substrate- binding ability, lytic activity and structural stability of OEL [33]. A plasmid harboring the wild-type sequence (pGSer–OEL) [33] was used as a template DNA for site- directed mutagenesis. The oligonucleotide primers used were 5¢-GCCCTCGAGAAAAGATCTAGAACTGGATCT TACGGAG-3¢ for C4S, 5¢-GCCCTCGAGAAAAGATC TAGAACTGGAGCTTACGGAG-3¢ for C4A, 5¢-CAAA AGCTTTCTGTCGATCCAGC-3¢ for C60S, 5¢-CAAAAG CTTGCTGTCGATCCAGC-3¢ for C60A, 5¢-TCTTCTAA GTCTGCTAAGCCAGAAAAGCTGAACTACTCT GGA GTTG-3¢ for C18S ⁄ C29S, and 5¢-TCTGCTAAGTCTGC TAAGCCAGAAAAGCTGAACTACGCTGGAGTT G-3¢ for C18A ⁄ C29A. Mutant genes were constructed by PCR-based site-directed mutagenesis (megaprimer method [65]) and verified by DNA sequencing. Mutants C4S ⁄ C60S and C4A ⁄ C60A were produced by two con- secutive rounds of mutagenesis. To create the gene encoding OEL with a quadruple mutation (C4S ⁄ C18S ⁄ C29S ⁄ C60S), the C18S ⁄ C29S mutation was introduced into the gene encoding C4S ⁄ C60S. Expression and puri- fication o f mutant proteins were carried out as described for the wild-type [33]. The purity was con- firmedbySDS⁄ PAGE and RP-HPLC on a YMC-Pack C4 column (4.6 · 250 mm; YMC, Tokyo, Japan). The N-terminal amino acid sequence was determined with a Shimadzu model PPSQ21 sequencer (Shimadzu C o., Kyoto, Japan). The protein concentration was measured by amino acid analysis with a Hitachi Model L-8500A amino acid analyzer (Hitachi High-Technologies Co., Tokyo, Japan). CD spectra CD spectra were obtained at 25 °C with a Jasco J-600 spec- tropolarimeter (Japan Spectroscopic Co., Tokyo, Japan). Proteins were dissolved to a final concentration of 0.15 mgÆmL )1 in 10 mm sodium acetate buffer (pH 5.0). The data were expressed in terms of mean residue elliptic- ity. The path-length of the cells was 0.1 cm for far-UV CD spectra (190–260 nm). Each spectrum was corrected by subtracting the spectrum of the buffer. Disulfide bonds in goose-type lysozyme S. Kawamura et al. 2826 FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS Assay of enzymatic activity Bacteriolytic activity (lytic activity) of lysozyme was assayed using lyophilized cells of M. luteus as a substrate. One hundred microliters of lysozyme (final concentration 0.015 lm) was added to 3 mL of a suspension of M. luteus adjusted to A 0.9 at 540 nm with 0.1 m sodium phosphate buffer (pH 7.0) at 25 °C. The activity was determined from the first 5 min of linear decrease in absorbance at 540 nm. Lysozyme-catalyzed hydrolysis of (GlcNAc) 5 was ana- lyzed at 40 °C, when all proteins are folded. The reaction mixture, containing 0.1 mm lysozyme and 1 mm (GlcNAc) 5 , was incubated in 10 m m sodium acetate buffer (pH 4.0). After a given reaction time, 200 lL of the reaction mixture was withdrawn and rapidly chilled in a KOOL KUP (Towa, Tokyo, Japan). The reaction mixture was centri- fuged at 4000 g for 1h with Ultrafree C3LGC (Millipore, Billerica, MA, USA), and the filtrate was lyophilized. The dried sample was dissolved in 50 lL of ice-cold water, and then 10 lL of the solution was applied to a TSKgel G-Oligo-PW column (7.8 · 600 mm; Tosoh, Tokyo, Japan) in a JASCO 800 series HPLC column. Elution was per- formed with distilled water at room temperature and a flow rate of 0.3 mLÆ min )1 . Each chito-oligosaccharide concentra- tion was calculated from the peak area monitored as the UV absorption at 220 nm, using the standard curve obtained for authentic saccharide solutions. The relative error was defined as (y ) x) ⁄ x · 100, where x is the concen- tration of the initial substrate in (GlcNAc) 1 units, and y is the recovered concentration of all chito-oligosaccarides in (GlcNAc) 1 units. The temperature dependence of the catalytic activity for the hydrolysis of (GlcNAc) 5 was assayed at temperatures ranging from 20 °Cto80°C. The substrate was dissolved in 10 mm sodium acetate buffer (pH 4.0) and incubated at various temperatures for 5 min. Then, the enzyme dissolved in the same buffer was added, and the activity was mea- sured at the designated temperature for 30 min (wild-type) or 40 min (C4S ⁄ C18S ⁄ C29S ⁄ C60S). The reaction time was chosen so that about 50% of the initial substrate (GlcNAc) 5 was hydrolyzed at 40 °C. Thermal unfolding Reversible thermal unfolding was monitored by CD and fluorescence measurements as described previously [33]. CD measurements at 222 nm were performed with a Jas- co J-600 spectropolarimeter using a 0.1 cm cuvette. The flu- orescence intensities at 360 nm, excited at 280 nm, were measured with a Hitachi F-4500 Fluorescence Spectropho- tometer using a 1 cm cuvette. Samples (CD, 0.15 mgÆmL )1 ; fluorescence, 0.015 mgÆmL )1 ) were dissolved in 0.1 m sodium acetate buffer (pH 5.0) containing 0.5 m guanidine hydrochloride. These conditions were chosen for complete reversibility of the thermal denaturation [33]. In the solution of the reduced wild-type, 0.1 m b-ME was also added. The water-jacketed cell containing each sample was heated for 5 min at a given temperature by a thermostati- cally regulated circulating-water bath. All samples were fully equilibrated at each temperature before measurement. The temperature of sample solutions was directly measured using a TX1001 thermometer (Yokokawa M&C Co., Tokyo, Japan). To facilitate comparison between the two sets of unfolding curves, the experimental data were normalized as follows. The fraction of unfolded protein was calculated from either the CD values or fluorescence intensities by linearly extrapolating the pretransition and post-transition base lines into the transition zone, and then plotted against temperature. Assuming that the unfolding equilibrium involves a two-state mechanism, the unfolding curves were subjected to a least squares analysis to deter- mine the midpoint temperatures (T m ) and thermodynamic parameters. The enthalpy and entropy changes at T m (DH m and DS m ) were calculated using van’t Hoff analysis. Under the assumption that the DC p values for the mutant proteins are negligible compared to DS m , the difference in the free energy change of unfolding (at T m of the wild-type protein) between the mutant and wild-type proteins (DDG) was esti- mated by the relationship DDG = DT m · DS m (mutant protein), given by Becktel & Schellman [66], where DT m is the difference in T m between the mutant and wild-type proteins. Guanidine hydrochloride unfolding Guanidine hydrochloride-induced unfolding curves were also determined by monitoring two different parameters at 30 °C [33]. One is the CD value at 222 nm, and the other is the intrinsic fluorescence (excitation at 280 nm and emission at 360 nm). Samples (CD, 0.15 mgÆmL )1 ; fluores- cence, 0.015 mgÆmL )1 ) were incubated in 0.1 m sodium acetate buffer (pH 5.0) with varying concentrations of gua- nidine hydrochloride at 30 °C for 1 h. All samples were fully equilibrated at each denaturant concentration before measurement. Denaturation was completely reversible under these conditions, and the unfolding data were analyzed on the basis of a two-state model. From the guanidine hydrochloride unfolding profiles, the difference in free energy change between the folded and unfolded states (DG) was calculated according to Pace [55]. The free energy change in water (DG H2O ) and the dependence of DG on the guanidine hydrochloride concentration (m) were determined by least squares fitting of the data for the transition region using the equation DG =DG H2O ) m[gua- nidine hydrochloride]. The guanidine hydrochloride con- centration at the midpoint of the transition (DG = 0) was defined as C m . The differences in C m (DC m ) between the wild-type and mutant proteins were calculated by subtract- ing the value of the wild-type from those of mutant proteins. S. Kawamura et al. Disulfide bonds in goose-type lysozyme FEBS Journal 275 (2008) 2818–2830 ª 2008 The Authors Journal compilation ª 2008 FEBS 2827 [...]... (1993) Disulfide bonds and the stability of globular proteins Protein Sci 2, 1551–1558 50 Flory PJ (1956) Theory of elastic mechanism in fibrous proteins J Am Chem Soc 78, 5222–5235 51 Poland DG & Scheraga HA (1965) Statistical mechanics of noncovalent bonds in polyamino acids VIII Covalent loops in proteins Biopolymers 3, 379–399 52 Goldenberg DP (1985) Dissecting the roles of individual interactions in. .. (1997) The role of the Cys191–Cys220 disulfide bond in trypsin: new targets for engineering substrate specificity Protein Eng 10, 405–411 47 Kawamura S, Fukamizo T, Araki T & Torikata T (2003) Expression of a synthetic gene coding for ostrich egg-white lysozyme in Pichia pastoris and its enzymatic activity J Biochem 133, 123–131 48 Wetzel R (1987) Harnessing disulfide bonds using protein engineering Trends... nonbonded interactions were truncated ˚ by using a cutoff of 12.0 A The initial structure for the MD simulation was constructed by the following four steps: (a) optimization of the positions of the water molecules using energy minimization and MD simulation; (b) optimization of the positions of the hydrogen atoms using energy minimization; (c) optimization of the conformation of the side chain using energy.. .Disulfide bonds in goose-type lysozyme S Kawamura et al Homology modeling and MD simulation The 50 models of the wild-type OEL were initially constructed on the basis of the crystal structure of GEL (Protein Data Bank code: 153L) using the homology modeling program modeller 8v2 [67] The structure of mutant C4S ⁄ C18S ⁄ C29S ⁄ C60S was obtained by replacing the four Cys residues of the model... (Epinephelus coioides), and the lytic activity of its recombinant protein Aquac Asia 3, 21–22 Disulfide bonds in goose-type lysozyme 27 Irwin DM & Gong Z (2003) Molecular evolution of vertebrate goose-type lysozyme genes J Mol Evol 56, 234–242 28 Zou H, Song L, Xu W & Yang G (2005) Molecular cloning and characterization analysis of cDNA encoding g-type lysozyme from scallop (Argopecten irradians) High... 4619–4624 39 Vogl T, Brengelmann R, Hinz H-J, Scharf M, Lotzbe¨ yer M & Engels JW (1995) Mechanism of protein stabilization by disulfide bridges: calorimetric unfolding studies on disulfide- deficient mutants of the a-amylase inhibitor Tendamistat J Mol Biol 254, 481–496 40 Zhu H, Dupureur CM, Zhang X & Tsai M-D (1995) Phospholipase A2 engineering The roles of disulfide bonds in structure, conformational stability,... of ribonuclease A Eur J Biochem 267, 566–572 43 Parisi M, Mazzini A, Sorbi RT, Ramoni R, Grolli S & Favilla R (2005) Role of the disulphide bridge in folding, stability and function of porcine odorant binding protein: spectroscopic equilibrium studies on C63A ⁄ C155A double mutant Biochim Biophys Acta 1750, 30–39 44 Ramazzotti M, Parrini C, Stefani M, Manao G & Degl’Innocenti D (2006) The intrachain... interactions in protein stability: lessons from a circularized protein J Cell Biochem 29, 321–335 53 Creighton TE (1988) Disulfide bonds and protein stability Bioessays 8, 57–63 54 Harrison PM & Sternberg MJ (1994) Analysis and classification of disulphide connectivity in proteins The entropic effect of cross-linkage J Mol Biol 244, 448–463 55 Pace CN (1990) Measuring and increasing protein stability Trends... Demonstration by NMR folding domains in lysozyme Nature 349, 633–636 62 Chaffotte AF, Guillou Y & Goldberg ME (1992) Kinetic resolution of peptide bond and side chain far-UV circular dichroism during the folding of hen egg white lysozyme Biochemistry 31, 9694–9702 63 Ueda T, Nakashima A, Hashimoto Y, Miki T, Yamada H & Imoto T (1994) Formation of a-helix 88–98 is essential in the establishment of higher-order... compilation ª 2008 FEBS 2829 Disulfide bonds in goose-type lysozyme S Kawamura et al 41 Guzzi R, Sportelli L, Rosa CL, Milardi D, Grasso D, Verbeet MP & Canters GW (1999) A spectroscopic and calorimetric investigation on the thermal stability of the Cys3Ala ⁄ Cys26Ala azurin mutant Biophys J 77, 1052– 1063 42 Klink TA, Woycechowsky KJ, Taylor KM & Raines RT (2000) Contribution of disulfide bonds to the conformational . the presence of a complete set of disulfide bonds is not required for the folding process of G-type lysozyme. To corroborate the importance of the disulfide bonds in. be a consequence of the absence of the two intrachain disulfide bonds. In the case of inverte- brate G-type lysozymes, the high content of Cys residues suggests