Báo cáo khoa học: microRNA-203 suppresses bladder cancer development by repressing bcl-w expression potx

microRNA-203 suppresses bladder cancer development by repressing bcl-w expression Juanjie Bo, Guoliang Yang, Kailing Huo, Haifeng Jiang, Lianhua Zhang, Dongming Liu and Yiran Huang Department of Urology, Renji Hospital, Shanghai Jiaotong University, China Introduction Human bladder cancer is the fourth most common malignancy in men, and the tenth most common in women [1]. Molecular and pathological studies suggest that bladder cancers comprise at least two major groups. The majority of malignant bladder tumors are urothelial cell carcinomas evolved from the epithelial lining of the bladder wall [2]. The urothelial carcino- mas are noninvasive papillary tumors that commonly recur, but rarely progress [3]. Patients with tumors in this group require long-term monitoring. Invasive bladder tumors are more aggressive, presenting with penetration of the basement membrane or invasion into muscle. Patients with invasive disease have a much worse prognosis, with a 5-year survival rate of 50% [4]. The high frequency of recurrence of noninva- sive urothelial carcinoma and the poor prognosis of invasive bladder tumors highlight the necessity for development of effective targeted therapies [5]. How- ever, the lack of effective therapies for advanced blad- der cancer is related to poor understanding of the molecular mechanisms underlying the progression of this disease [6]. Apoptosis is believed to be the major mechanism of chemotherapy ⁄ radiotherapy-induced cell death in blad- der cancer [7]. Unfortunately, many tumor cells evade drug-induced death signals, and certain oncogenes such as bcl-2 and bcl-w can become overexpressed, resulting in chemotherapy ⁄ radiotherapy resistance [8]. Bcl-2 family proteins are essential regulators of apoptosis, and bcl-w is anti-apoptotic member of this family. Bcl-w maintains cell viability by preventing mitochon- dria-mediated apoptosis [9,10]. Overexpression of bcl-w can prevent cell death, and is a potential mediator of resistance to several chemotherapeutic drugs [11]. Keywords apoptosis; bcl-w; bladder cancer; miR-203; proliferation Correspondence D. Liu, Department of Urology, Renji Hospital, School of Medicine Shanghai Jiaotong University, No. 145 Shan Dong Middle Road, Shanghai 200001, China Fax: +86 21 6373 0455 Tel: +86 21 6373 0455 E-mail: dmliu@hotmail.com (Received 16 November 2010, revised 13 December 2010, accepted 22 December 2010) doi:10.1111/j.1742-4658.2010.07997.x It is increasingly clear that microRNAs (miRNAs) play an important role in many diseases, including tumorigenesis. However, the mechanisms by which miRNAs regulate bladder cancer development remain poorly under- stood. Here, we evaluated the expression of microRNA-203 (miR-203) in bladder cancer tissues using real-time PCR, and defined the target genes and biologically functional effect using luciferase reporter assay, flow cytometry and western blot analysis. We first verified that the expression of miR-203 was decreased in bladder cancer tissues. Moreover, ectopic expres- sion of miR-203 promoted the apoptosis of human bladder cancer cell lines and inhibited cell proliferation, whereas its depletion increased cell growth. We further verified that miR-203 directly targeted 3¢ -untranslated region of the bcl-w gene, and decreased its expression in vitro and in vivo. Western blot analysis also showed that the expression level of miR-203 was nega- tively correlated with bcl-w level in tumor tissues. These data suggest an important role for miR-203 in the molecular etiology of bladder cancer and implicate the potential application of miR-203 in bladder cancer therapy. Abbreviations miRNA, microRNA; miR-203, microRNA-203; UTR, untranslated region. 786 FEBS Journal 278 (2011) 786–792 Journal compilation ª 2011 FEBS. No claim to original Chinese government works However, the regulation of endogenous bcl-w expres- sion is complex. For example, Michela et al. showed the role of Akt in apoptosis resistance by interacting with bcl-w [12]. They demonstrated that Akt interacted with the N- and C-terminal sequences of the bcl-w protein, and phosphorylated bcl-w both in vitro and in the intact cell. Lapham et al. [13] demonstrated that TCF4 and beta-catenin interacted with the bcl-w pro- moter, and the activity of the bcl-w promoter was increased or decreased, respectively, by overexpression of beta-catenin or dominant negative TCF4. Lin et al. [14] showed that bcl-w is a direct target of miR-122 that functions as an endogenous apoptosis regulator in these HCC-derived cell lines. There is increasing evidence that post-transcriptional regulation of gene expression, mediated by micro- RNAs (miRNAs), plays an important role in the con- trol of cells proliferation, apoptosis and tumorigenesis [15–17]. miRNAs are noncoding RNAs that have been highly conserved during evolution and have emerged recently as potent regulators of gene expression. Over- expression of oncogenic miRNAs and underexpression of tumor suppressor miRNAs play pivotal roles in tumorigenesis. Gottardo et al. [18] compared the miRNA profile of bladder cancers and noncancer blad- der tissues, and found that 10 miRNAs were upregu- lated. MicroRNA-203 (miR-203), possessing a tumor suppressive activity, was also downregulated in bladder cancer tissues [19,20]. However, the relationship between miR-203 and bladder cancer is remains unknown. In this study, we investigated the role of miR-203 in bladder cancer development. We demonstrated that expression of miR-203 was downregulated in bladder cancer tissues, and decreased expression of miR-203 contributed to cells proliferation. Finally, we confirmed that bcl-w is the direct target of miR-203. Results Expression of miR-203 is significantly downregulated in bladder cancer In order to assess the role of miR-203 in bladder can- cer development, we first evaluated the different expression of miR-203 in bladder cancer tissues and normal bladder tissues by using quantitative real-time PCR. Figure 1 shows that miR-203 was expressed at low levels in bladder cancer tissue, and miR-203 levels were increased in normal bladder tissue. The mean level of miR-203 expressed in normal bladder tissues was 2.7, whereas the mean level of miR-203 expressed in bladder cancer tissues was 1.4 (Fig. 1). These data indicate that down-regulation of miR-203 may be related to bladder cancer development. miR-203 promotes cells apoptosis in vitro To study the physiological role of miR-203 in cell growth, bladder cancer cell lines treated with miR-203, or microRNA control, were analyzed. Figure 2A shows that overexpression of miR-203 promoted cell apoptosis in T24 cells, a bladder cancer cell line. More- over, compared with the nonspecific microRNA con- trol (NC), miR-203 inhibited T24 cells proliferation (Fig. 2B), whereas its depletion promoted cell growth (Fig. 2C). These data suggest that miR-203 negatively regulates the growth of bladder cancer cells. bcl-w is a target gene of miR-203 In order to identify the target genes of miR-203 in regu- lating bladder cancer cell apoptosis, we searched for candidate genes using TargetScan 5.1 (http://www. targetscan.org/) and miRBase (http://www.mirbase. org/) microRNA databases. The bcl-w gene is one of predicted target genes of miR-203 (Fig. 3A), and is an important member of the bcl-2 family described as one of the anti-apoptotic protein. So, we constructed a fire- fly luciferase reporter containing the 3¢-untranslated region (UTR) of bcl-w. We then cotransfected HEK293 cells with the pGL3-promoter–bcl-w–3¢-UTR and miR-203. The reporter assay showed that miR-203 was 0.0 Normal Tumor * 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 5.0 miR-203 relative level 4.5 Fig. 1. miR-203 was downregulated in bladder tumor tissues. Analy- sis of miR-203 expression level was performed in bladder tumor tissues (n = 13) or normal bladder tissues (n = 9). Total RNA was subjected to real-time RT-PCR to analyze the expression level of miR-203 in each sample. U6 was used as reference for miRNAs. Each sample was analyzed in triplicate. The 2 )DDCt method was used to determine the relative quantization of gene expression levels. *P < 0.05. J. Bo et al. miR-203 suppresses bladder cancer FEBS Journal 278 (2011) 786–792 Journal compilation ª 2011 FEBS. No claim to original Chinese government works 787 able to significantly repress luciferase expression of pGL3-promoter–bcl-w–3¢-UTR (Fig. 3B), and mutation of four nucleotides in the miR-203 target sequence led to complete abrogation of the suppressive effect (Fig. 3B). Moreover, we observed that ectopic expression of miR-203 decreased the bcl-w protein content in a time-dependent manner in T24 cells (Fig. 3C). These observations confirm that miR-203 inhibits endogenous bcl-w in bladder cancer cells. miR-203 expression is inversely related to bcl-w expression in bladder cancer To further examine the relationship between miR-203 and bcl-w in bladder cancer tissues, the expression of miR-203 and bcl-w were detected. Our data showed that miR-203 levels were decreased in bladder cancer samples. bcl-w expression in bladder cancer samples was analyzed by western bloting. The bcl-w levels in bladder cancer samples were significantly higher than in normal tissue samples (Fig. 4). Importantly, Fig. 4 shows that bcl-w expression was increased in bladder cancer tissues that showed significantly decreased miR- 203 expression. miR-203 suppresses bladder cancer progression by repressing bcl-w Bcl-w is an important determinant of cells prolifera- tion or apoptosis in cancer development, and ele- vated expression of the bcl-w resulted in abnormal cell growth with reduced capability for apoptosis in many cancer types. Therefore, we thought that the role of miR-203 in bladder cancer cells growth was mediated by modulating bcl-w expression. Figure 5 shows that T24 cell proliferation was restored when bcl-w was re-expressed in cells treated with miR-203. These data confirm that miR-203, at least in part, inhibited bladder cancer progression by repressing bcl-w. 0 0 0 0.5 1 1.5 2 2.5 3 3.5 5 10 15 NC miR-203 * * * * * NC NC miR-203 miR-203- inhibitor 12 0 0.1 0.2 Absorbance (450 nm) Absorbance (450 nm) 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5 0.6 0.6 0.7 miR-203 1.32 14.35 4.94 miR-203-inhibitor T24 cells no-specific inhibitor NC T24 cells 24 48 60 72 h 12 24 48 60 72 h 5 miR-203 relative level miR-203 relative levelmiR-203 relative level 10 PI Annexin V-FITC Blank miR-203 NC 15 A B C Fig. 2. miR-203 inhibited bladder tumor cells proliferation. (A) T24 cells were treated with mature miR-203 and apoptosis induc- ers, and apoptosis was detected using the flow cytometry. Overexpression of miR-203 promoted cell apoptosis in T24 cells. (B) T24 cells were transiently transfected with miR-203 mimics, and at the indicated time points, the numbers of cells per well were measured by the absorbance (450 nm) of reduced WST-8. (C) T24 cells were tran- siently treated with miR-203 inhibitor, and the number of cells per well was measured by the absorbance (450 nm) of reduced 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5-(2,4-isulfophenyl)-2H-tetrazolium. The results show data from at least three independent experiments, expressed as the mean ± SD. *P < 0.05. miR-203 suppresses bladder cancer J. Bo et al. 788 FEBS Journal 278 (2011) 786–792 Journal compilation ª 2011 FEBS. No claim to original Chinese government works Discussion miRNAs have been reported to be involved in several important biological events, such as tumorigenesis, cell differentiation, proliferation and apoptosis. miRNAs are also known to act as regulators in bladder cancer cell growth, and have recently been reported to regu- late bladder cancer progression [21,22]. Some miRNAs, including miR-145, miR-133a and miR-203, were markedly downregulated in bladder cancer, and miR-145 and miR-133a are involved in the regulation of FSCN1 expression and possibly in the development of bladder cancer [19,22]. However, the relationship between miR-203 and bladder cancer is still unknown. Here we found that miR-203 suppresses bladder cancer development by repressing bcl-w expression. Bcl-2 family proteins regulate mitochondrial apopto- sis downstream of diverse stressors. Bcl-w is an impor- tant anti-apoptotic member of the bcl-2 family. Depletion of bcl-w has been proven to sensitize cells to apoptosis [23,24]. Increased bcl-w protein levels are commonly observed in various types of cancers, including colonic, cervical and breast cancer cells [9]. In gastric adenocarcinomas, bcl-w suppresses cancer cell death by blocking SAPK ⁄ JNK activation [25]. Bcl-w expression is modulated by a Met ⁄ HGF receptor (c-met) in human colorectal cancers. Downregulation of bcl-w by m iR-122 res ulted in a decrease in the Bc l-w ⁄ Bax ratio, ultimately leading to apoptosis in HCC- derived cell lines [14]. However, the regulation of bcl-w expression is complex, and its in-depth research con- tributes to cancer treatment. The function of miR-203 was recently reported. Wijnhoven et al. [26] showed that levels of miR-203 0 bcl-w Actin T1 T2 T3 T4 * * * * N1 N2 N3 N4 0.5 1 1.5 2 2.5 miR-203 relative level 3 3.5 4 4.5 5 Fig. 4. miR-203 expression is inversely related to bcl-w expression in bladder tissues. Bcl-w was decreased in normal bladder tissues that showed increased miR-203 expression, whereas bcl-w was increased in bladder tumor tissues that showed decreased miR-203 expression. T, tumor tissues; N, normal tissues. b-Actin was used as reference for RNAs. *P < 0.05. 0 0 20406080 h miR-203 miR-203 + pcDNA bcl-w * * NC 0.1 0.2 0.3 Absorbance (450 nm) 0.4 0.5 0.6 0.7 Fig. 5. miR-203 suppresses bladder cancer progression by bcl-w modulation. Bcl-w was re-expressed in T24 cells treated with miR-203, and the numbers of cells per well were measured by the absorbance (450 nm) of reduced 2-(2-methoxy-4-nitrophenyl)-3- (4-nitrophenyl)-5-(2,4-isulfophenyl)-2H-tetrazolium at 12, 24, 48, 60 and 72 h, respectively. The results show data from at least three independent experiments, expressed as the mean ± SD. *P < 0.05. Bcl-w 3′-UTR A B C CCCAAUUUUUAAAUCCAUUUCAU CCCAAUUUUUAAAUCCAAAAGAU GAUCACCAGGAUUUGUAAAGUG 5′ 5′ 3′ Bcl-w 3′-UTR-mut hsa-miR-203 0 NC miR-203 Hek293 cells * * 5 miR-203 relative level Relative luciferase activity 10 15 20 1.2 1 0.8 0.6 0.4 0.2 0 Wildtype Mutation NC miR-203 miR-203 NC bcl-w Actin bcl-w Actin 0122472h 0122472h Fig. 3. miR-203 inhibits bcl-w expression. (A) Schematic representa- tion of the miR-203 site in bcl-w 3¢-UTR. (B) The 3¢-UTR reporter assay was carried out in HEK293 cells that overexpressed miR-203. PGL3-promoter–bcl-w–3¢-UTR–WT or PGL3-promoter–bcl-w–3¢-UTR– MUT was cotransfected with pRL-TK using Lipofectamine 2000. Luciferase assays were performed 24 h after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was standardized to Renilla luciferase control. An asterisk indicates significantly different from the NC (P < 0.05). (C) Western blot analysis for endogenous bcl-w protein level using antibodies against bcl-w. b-Actin was used as reference for RNAs. J. Bo et al. miR-203 suppresses bladder cancer FEBS Journal 278 (2011) 786–792 Journal compilation ª 2011 FEBS. No claim to original Chinese government works 789 were high in normal squamous epithelium and low in columnar epithelia, and dysregulation of miR-203 could contribute to metaplastic and neoplastic pro- cesses in the oesophageal mucosa. Mathe et al. [27] demonstrated that miR-203 expression was reduced in cancerous compared with noncancerous tissue, and was potentially clinically useful for developing prog- nostic biomarkers and identifying novel drug targets and therapies. However, the relationship between miR- 203 and bladder cancer is unknown. Our results showed that miR-203 levels were decreased in bladder cancer tissues. Overexpression of miR-203 promoted bladder cancer cell apoptosis and inhibited cells prolif- eration. We identified that miR-203 targeted the bcl-w gene. The reporter assay showed that miR-203 was able to significantly repress luciferase-contained bcl-w– 3¢-UTR expression. Western blot analysis also showed that miR-203 significantly inhibited the bcl-w protein level in T24 cells. In conclusion, our data demonstrate that miR-203 suppresses bladder cancer cell proliferation by target- ing bcl-w. Thus, miR-203 is an important regulator in the development of bladder cancer and implicates the potential application of miR-203 in bladder cancer therapy. Materials and methods Tissue samples Human bladder tissues were obtained with informed con- sent from Renji Hospital affiliated to School of Medicine Shanghai Jiaotong University. Normal and pathologically diagnosed biopsy specimens were obtained from patients with bladder tumors who underwent radical cystectomy or endoscopic resection for primary or recurrent TCC. Cell culture Human bladder cancer cells T24 were obtained from the American Type Culture Collection and were maintained in RPMI 1640 with 10% fetal bovine serum (Gibco, New York, USA), and were cultured at 37 °C with 5% CO 2 . The human embryonic kidney epithelial cell HEK-293 was maintained in DMEM with 10% FBS and were cultured at 37 °C with 5% CO 2 . Real-time PCR Total RNA was extracted using Trizol reagent (Invitrogen, New York, USA), and the reverse-transcription reactions were carried out using an M-MLV Reverse Transcriptase kit (Invitrogen). The gene-specific stem–loop RT primers for miRNAs released by the Sanger Institute were designed according to Chen et al. [28]. Real-time PCR was performed using a standard SYBR Green PCR kit (Toyobo, Osaka, Japan) protocol on Rotor-Gene RG-3000A (Corbett Life Science, Sidney, Australia). U6 and b-actin were used as ref- erences for miRNAs and RNAs, respectively. Each sample was analyzed in triplicate. The 2 )DDCt method was used to determine the relative quantitation of gene expression levels. Luciferase reporter assay For luciferase reporter assay, HEK293 cells (1–3 · 10 4 cellsÆwell )1 ) were plated in a 24-well plate and then cotrans- fected with 20 mm of either miR-203 or microRNA control (NC), 40 ng of either pGL3-promoter–bcl-w–3¢-UTR–WT or pGL3-promoter–bcl-w–3¢-UTR–MUT and 4 ng of pRL- TK (Promega, Wisconsin, USA), using LipofectamineÔ 2000. HEK293 cells were collected 24 h after transfection and analyzed using the Dual-Luciferase Reporter Assay Sys- tem (Promega). The pRL-TK vector that provided the con- stitutive expression of Renilla luciferase was cotransfected as an internal control to correct the differences in both trans- fection and harvest efficiencies. Transfections were done in triplicate and repeated at least three times in independent experiments. Western blot analysis and antibodies Western blot analysis to assess bcl-w and b-actin expression was performed as previously described [29]. The anti-(bcl-w) primary Ig and anti-(b-actin) primary Ig were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Flow cytometric analysis T24 cells transfected with miR-203 (4 · 10 5 ) were plated in six-well plates and apoptosis inducers A (Apopisa) and B (Apobid) (1 : 1000; Beyotime, Jiangsu, China) were added to the culture. After a 24-h incubation, the cultures were stained with annexin V-fluorescein isothiocyanate and apoptosis rates were analyzed using a flow cytometer (FACSCalibur, BD Biosciences, CA, USA). Cell proliferation assay Cell proliferation assays were performed with a Cell Count- ing Kit-8 (Dojindo, Kumamoto, Japan) [30]. Cells were pla- ted in 24-well plates in triplicate at  1–2 · 10 5 cellsÆwell )1 and cultured in the growth medium. Then cells were treated with mature miR-203 (miR-203 mimics, MIMAT0000264; Qiagen, Germany) or with miR-203 inhibitor (anti-miR- 203, MIN0000236; Qiagen, Hilden, Germany), the numbers of cells per well were measured by the absorbance (450 nm) of reduced 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- miR-203 suppresses bladder cancer J. Bo et al. 790 FEBS Journal 278 (2011) 786–792 Journal compilation ª 2011 FEBS. No claim to original Chinese government works (2,4-isulfophenyl)-2H-tetrazolium (monosodium salt) at the indicated time points. Plasmid pcDNA–bcl-w was constructed by introducing a BamHI–EcoRI fragment containing the bcl-w cDNA into the same sites in pcDNA3.1. Statistical analysis All data are expressed as mean ± SD from at least three separate experiments. The differences between groups were analyzed using Student’s t-test. The difference was deemed statistically significant at P < 0.05. Acknowledgements This work was supported by Shanghai Municipal Nat- ural Science Foundation (09ZR1418000). References 1 Lacey JR Jr, Devesa SS & Brinton LA (2002) Recent trends in breast cancer incidence and mortality. Environ Mol Mutagen 39, 82–88. 2 Egerod FL, Bartels A, Fristrup N, Borre M, Orntoft TF, Oleksiewicz MB, Brunner N & Dyrskjot L (2009) High frequency of tumor cells with nuclear Egr-1 pro- tein expression in human bladder cancer is associated with disease progression. BMC Cancer 9, 385. 3 Seiler R, von Gunten M, Thalmann GN & Fleischmann A (2010) Pelvic lymph nodes: distribution and nodal tumour burden of urothelial bladder cancer. J Clin Pathol 63, 504–507. 4 Kim WJ, Kim EJ, Kim SK, Kim YJ, Ha YS, Jeong P, Kim MJ, Yun SJ, Lee KM, Moon SK et al. (2010) Predictive value of progression-related gene classifier in primary non-muscle invasive bladder cancer. Mol Cancer 9,3. 5 Tomlinson DC, Lamont FR, Shnyder SD & Knowles MA (2009) Fibroblast growth factor receptor 1 pro- motes proliferation and survival via activation of the mitogen-activated protein kinase pathway in bladder cancer. Cancer Res 69, 4613–4620. 6 Ismaili N, Heudel PE, Elkarak F, Kaikani W, Bajard A, Ismaili M, Errihani H, Droz JP & Flechon A (2009) Outcome of recurrent and metastatic small cell carci- noma of the bladder. BMC Urol 9,4. 7 Sanchez-Salas R, Duque Ruiz GI, Watson J, Rocha E, Barret E, Cathelineau X, Rozet F, Galiano M & Vallancien G (2009) Comprehensive surgical and chemotherapy treatment for invasive bladder cancer. Acta Urol Esp 33, 1062–1068. 8 Matsui Y, Hadaschik BA, Fazli L, Andersen RJ, Gleave ME & So AI (2009) Intravesical combination treatment with antisense oligonucleotides targeting heat shock pro- tein-27 and HTI-286 as a novel strategy for high-grade bladder cancer. Mol Cancer Ther 8, 2402–2411. 9 O’Reilly LA, Print C, Hausmann G, Moriishi K, Cory S, Huang DC & Strasser A (2001) Tissue expression and subcellular localization of the pro-survival molecule Bcl-w. Cell Death Differ 8, 486–494. 10 Crawford AC, Riggins RB, Shajahan AN, Zwart A & Clarke R (2010) Co-inhibition of BCL-W and BCL2 restores antiestrogen sensitivity through BECN1 and promotes an autophagy-associated necrosis. PLoS ONE 5, e8604. 11 Huang Z (2000) Bcl-2 family proteins as targets for anticancer drug design. Oncogene 19, 6627–6631. 12 Garofalo M, Quintavalle C, Zanca C, De Rienzo A, Romano G, Acunzo M, Puca L, Incoronato M, Croce CM & Condorelli G (2008) Akt regulates drug-induced cell death through Bcl-w downregulation. PLoS ONE 3, e4070. 13 Lapham A, Adams JE, Paterson A, Lee M, Brimmell M & Packham G (2009) The Bcl-w promoter is acti- vated by beta-catenin ⁄ TCF4 in human colorectal carci- noma cells. Gene 432, 112–117. 14 Lin CJ, Gong HY, Tseng HC, Wang WL & Wu JL (2008) miR-122 targets an anti-apoptotic gene, Bcl-w,in human hepatocellular carcinoma cell lines. Biochem Bio- phys Res Commun 375, 315–320. 15 Esquela-Kerscher A & Slack FJ (2006) Oncomirs – microRNAs with a role in cancer. Nat Rev Cancer 6, 259–269. 16 Hwang HW & Mendell JT (2006) MicroRNAs in cell proliferation, cell death, and tumorigenesis. Br J Cancer 94, 776–780. 17 Saito Y, Suzuki H, Tsugawa H, Nakagawa I, Matsu- zaki J, Kanai Y & Hibi T (2009) Chromatin remodeling at Alu repeats by epigenetic treatment activates silenced microRNA-512-5p with downregulation of Mcl-1 in human gastric cancer cells. Oncogene 28, 2738–2744. 18 Gottardo F, Liu CG, Ferracin M, Calin GA, Fassan M, Bassi P, Sevignani C, Byrne D, Negrini M, Pagano F et al. (2007) Micro-RNA profiling in kidney and bladder cancers. Urol Oncol 25, 387–392. 19 Chiang Y, Song Y, Wang Z, Chen Y, Yue Z, Xu H, Xing C & Liu Z (2010) Aberrant Expression of miR- 203 and its clinical significance in gastric and colorectal cancers. J Gastrointest Surg, doi:10.1007/s11605-010- 1367-8. 20 Castilla MA, Moreno-Bueno G, Romero-Perez L, De Vijver KV, Biscuola M, Lopez-Garcia MA, Prat J, Matias-Guiu X, Cano A, Oliva E et al. (2011) Micro-RNA signature of the epithelial–mesenchymal transition in endometrial carcinosarcoma. J Pathol 223, 72–80. 21 Huang L, Luo J, Cai Q, Pan Q, Zeng H, Guo Z, Dong W, Huang J & Lin T (2010) MicroRNA-125b J. Bo et al. miR-203 suppresses bladder cancer FEBS Journal 278 (2011) 786–792 Journal compilation ª 2011 FEBS. No claim to original Chinese government works 791 suppresses the development of bladder cancer by targeting E2F3. Int J Cancer, doi:10.1002/ijc.25509. 22 Chiyomaru T, Enokida H, Tatarano S, Kawahara K, Uchida Y, Nishiyama K, Fujimura L, Kikkawa N, Seki N & Nakagawa M (2010) miR-145 and miR-133a function as tumour suppressors and directly regulate FSCN1 expression in bladder cancer. Br J Cancer 102, 883–891. 23 Ross AJ, Waymire KG, Moss JE, Parlow AF, Skinner MK, Russell LD & MacGregor GR (1998) Testicular degeneration in Bclw-deficient mice. Nat Genet 18, 251–256. 24 Print CG, Loveland KL, Gibson L, Meehan T, Stylianou A, Wreford N, de Kretser D, Metcalf D, Kontgen F, Adams JM et al. (1998) Apoptosis regula- tor bcl-w is essential for spermatogenesis but appears otherwise redundant. Proc Natl Acad Sci USA 95, 12424–12431. 25 Lee HW, Lee SS, Lee SJ & Um HD (2003) Bcl-w is expressed in a majority of infiltrative gastric adenocarci- nomas and suppresses the cancer cell death by blocking stress-activated protein kinase ⁄ c-Jun NH 2 -terminal kinase activation. Cancer Res 63, 1093–1100. 26 Wijnhoven BP, Hussey DJ, Watson DI, Tsykin A, Smith CM & Michael MZ (2010) MicroRNA profiling of Barrett’s oesophagus and oesophageal adenocarci- noma. Br J Surg 97, 853–861. 27 Mathe EA, Nguyen GH, Bowman ED, Zhao Y, Budhu A, Schetter AJ, Braun R, Reimers M, Kumamoto K, Hughes D et al. (2009) MicroRNA expression in squa- mous cell carcinoma and adenocarcinoma of the esoph- agus: associations with survival. Clin Cancer Res 15, 6192–6200. 28 Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR et al. (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33, e179. 29 Kapinas K, Kessler CB, Ricks T, Gronowicz G & Delany AM (2010) miR-29 modulates WNT signaling in human osteoblasts through a positive feedback loop. J Biol Chem 285, 25221–25231. 30 Qin W, Shi Y, Zhao B, Yao C, Jin L, Ma J & Jin Y (2010) miR-24 regulates apoptosis by targeting the open reading frame (ORF) region of FAF1 in cancer cells. PLoS ONE 5, e9429. miR-203 suppresses bladder cancer J. Bo et al. 792 FEBS Journal 278 (2011) 786–792 Journal compilation ª 2011 FEBS. No claim to original Chinese government works . relationship between miR-203 and bladder cancer is still unknown. Here we found that miR-203 suppresses bladder cancer development by repressing bcl-w expression. Bcl-2. microRNA-203 suppresses bladder cancer development by repressing bcl-w expression Juanjie Bo, Guoliang Yang, Kailing