Available online at www.sciencedirect.com International Journal for Parasitology 38 (2008) 725–730 www.elsevier.com/locate/ijpara Human fascioliasis and the presence of hybrid/introgressed forms of Fasciola hepatica and Fasciola gigantica in Vietnam Thanh Hoa Le a, Nguyen Van De b, Takeshi Agatsuma c, Thanh Giang Thi Nguyen d, Quoc Doanh Nguyen d, Donald P McManus e, David Blair f,* a f Department of Immunology, Institute of Biotechnology, Hanoi, Viet Nam b Department of Parasitology, Hanoi Medical University, Viet Nam c Department of Environmental Health Sciences, Kochi Medical School, Kochi, Japan d National Institute of Veterinary Research, Hanoi, Viet Nam e Queensland Institute of Medical Research, Brisbane, Qld 4006, Australia School of Marine and Tropical Biology, James Cook University, Townsville, Qld 4811, Australia Received 19 June 2007; received in revised form October 2007; accepted October 2007 Abstract The two species common of liver fluke, Fasciola hepatica and Fasciola gigantica, cause human fascioliasis Hybrids between these species, and introgressed forms of Fasciola, are known from temperate and subtropical regions of eastern Asia Here, we report the presence of hybrid and/or introgressed liver flukes in Vietnam where it has recently been recognised that human fascioliasis is an important zoonotic disease Specimens examined came from domestic stock (cattle and buffalo) at slaughter and also from human patients DNA sequences were obtained from the nuclear ribosomal second internal transcribed spacer (ITS-2) and from portions of two mitochondrial protein-coding genes Mitochondrial sequences in every case were similar to those of Fasciola gigantica Nuclear ITS-2 sequences belonged to one or other of the Fasciola species, or, sequences from both were found in the same individual worm This study extends the known range of hybrids or introgressed forms of Fasciola into tropical regions of Asia Ó 2007 Australian Society for Parasitology Inc Published by Elsevier Ltd All rights reserved Keywords: Fasciola gigantica; Fasciola hepatica; Hybridisation; Internal transcribed spacer region; Introgression; Vietnam Introduction The commonest and most widespread liver flukes of the genus Fasciola are Fasciola hepatica Linnaeus, 1758 (mostly in temperate regions) and Fasciola gigantica Cobbold, 1856 (mostly tropical in distribution) Adults of both species occur in many domestic ruminants and in humans (Mas-Coma et al., 2005; Le et al., 2007) and can cause serious disease The two liver fluke species appear to be sympatric in many subtropical and warm temperate areas, especially in Africa and Asia (Le et al., 2007) They can generally be distinguished on the basis of their morphology (e.g Ashrafi * Corresponding author Tel.: +61 4781 4322; fax: +61 4725 1570 E-mail address: david.blair@jcu.edu.au (D Blair) et al., 2006), but the existence of individuals with intermediate morphological characteristics can cause confusion (e.g Terasaki et al., 1982; Itagaki et al., 2005a) and has led to the increasing use of molecular methods (e.g Marcilla et al., 2002) or morphometric methods (e.g Ashrafi et al., 2006) to distinguish between the species It is desirable to know which species is the agent of human or animal disease in a given area The two species differ in pathological and epidemiological characteristics (Mas-Coma et al., 2005) Difficulties in specific identification have been most intensively studied in Japan and adjacent areas Research there has revealed not only a confusing range of morphological forms but also the presence of worms of different ploidies (diploid, triploid and ‘‘mixoploid’’), all of which are parthenogenetic and not produce normal sperm (Terasaki et al., 1982, 2000) Genetic studies on Japanese 0020-7519/$34.00 Ó 2007 Australian Society for Parasitology Inc Published by Elsevier Ltd All rights reserved doi:10.1016/j.ijpara.2007.10.003 726 T.H Le et al / International Journal for Parasitology 38 (2008) 725–730 and Korean worm populations have detected individuals that have both nuclear and mitochondrial sequences typical of F hepatica and others that appear on the same grounds to be F gigantica Individuals also occur that resemble one species in their nuclear DNA (usually assayed using ribosomal RNA gene or spacer sequences) but have a mitochondrial genotype typical of the other species (Agatsuma et al., 2000; Itagaki et al., 2005a,b) Individuals have also been found that have, in their tandem array of nuclear ribosomal genes, copies of genes apparently derived from both liver fluke species (Agatsuma et al., 2000 in Korea; Huang et al., 2004 in north eastern China; Itagaki et al., 2005a,b in Japan and Korea; Lin et al., 2007 in China) An obvious conclusion is that hybridisation and introgression (definitions in Dowling and Secor, 1997) are common in Fasciola populations in this part of Asia, processes that can lead to production of polyploid and parthenogenetic individuals (Dowling and Secor, 1997) Such individuals are often aspermic There have been no convincing demonstrations of hybrid/introgressed liver fluke populations outside Asia, although aspermic triploid individuals of ‘‘pure’’ F hepatica are now known from Britain (Fletcher et al., 2004) Examples of triploid Fasciola sp are also known from Assam and Hawaii (reviewed in Terasaki et al., 2000) and Vietnam (Itagaki et al., 2005a) In addition to Japan and Korea, aspermic Fasciola spp of unknown ploidy are present (but generally uncommon) in the Philippines, Vietnam, Thailand, Taiwan, India, Nepal and Hawaii (Terasaki et al., 1982) In Vietnam, fascioliasis (caused by morphologically identified F gigantica) is very common in cattle and water buffaloes, with prevalences of more than 50% in the Red River and Mekong deltas, as well as in other coastal regions (Bui et al., 2003) In recent years, an extraordinary number of human cases of fascioliasis has been reported, to such an extent that this zoonotic infection has become a major public health concern in Vietnam More than 500 human cases were recorded in the three years from 1997 to 2000 based on serological tests (Tran et al., 2001) Prior to 1991, fascioliasis had been regarded as rare in Vietnam For example, only two cases were reported in 1978 (Tran et al., 2001) Unusual cases of cutaneous fascioliasis have also been described (e.g Xuan et al., 2005; Le et al., 2007) Morphologically, the adult flukes found in animals and human patients in Vietnam fall into two categories, one typical of F gigantica and the other closely resembling F hepatica Here we report data indicating that hybrid/introgressed populations of Fasciola occur in Vietnam and that these are implicated in human infection Materials and methods 2.1 Sources of Fasciola specimens Parasite material and nucleotide sequences of Fasciola species, their host and geographical origin used in this study are listed in Table Adult worms of Fasciola sp of Vietnamese origin, collected during 2001–2005 from human patients and animals (cattle and buffaloes), were preserved in 70% ethanol and kept at À20 °C until used for extraction of DNA Of 21 Vietnamese samples, 12 were of human origin, of which two (FspN-VN and FspQB-VN) were from the cases involving unusual cutaneous migration of worms reported in Le et al (2007) Specimens from eight human cases were obtained surgically In two further cases, eggs morphologically identified as being of a Fasciola sp were recovered from faeces of human patients serologically positive for fascioliasis These eggs were allowed to develop and hatch in water (1–2 weeks) and 10–20 miracidia from each patient were collected for subsequent DNA extraction 2.2 Genetic markers Genetic markers including mitochondrial genes (cox1, nad1) and the nuclear second internal ribosomal spacer (ITS-2) sequences were obtained ITS-2 is a useful marker for distinguishing between F gigantica and F hepatica It is rather conserved, especially in F hepatica There are seven sites at which the two species typically differ One of these is a deletion in F gigantica relative to F hepatica that appears to be a diagnostic difference between the species (e.g Adlard et al., 1993; Semyenova et al., 2005) There is some variability, especially in F gigantica, that can be confusing (Le et al., 2007) Sequence data from mitochondrial genes are more variable than is the case for ITS-2, but also provide unambiguous recognition of the two species (Le et al., 2007) 2.3 DNA extraction, PCR and sequencing Total genomic DNA was extracted from adult worms and miracidia using the commercial QIAamp DNA extraction kit (QIAGEN Inc.) according to the manufacturer’s instructions In the case of adult worms, only a single specimen was used in each DNA extraction Genomic DNA was diluted to a working concentration of 50 ng/lL and lL of this was used as template in a PCR reaction of 50 lL PCR was used to amplify the entire nuclear ITS-2 and two mitochondrial genetic markers (a portion of each of cox1 and nad1) Primers 3SF (forward) (5 GGTACCG GTGGATCACTCGGCTCGTG3 ) and BD2R (reverse) (5 TATGCTTAAATTCAGCGGGT3 ) were used for amplification of ITS-2; JB3F (forward) (5 TTTTTTGG GCATCCTGAGGTTTAT3 ) and JB4.5R (reverse) (5 TAAAGAAAGAACATAATGAAAATG3 ) for cox1 as previously published (Bowles and McManus, 1993; Bowles et al., 1995) Primers FND1F (forward) (5 TGG GGTCTGTTGCAGAGATTTGC3 ) and FND1R (reverse) (5 ATCCAATGGAGTACGGTTACA3 ) for nad1 were designed for use in this study PCR amplification was carried out in a final volume of 50 lL, including 100 ng template, 10 pmol of each primer 727 T.H Le et al / International Journal for Parasitology 38 (2008) 725–730 Table List of Fasciola specimens and sequences used in this study, their host and geographical origins Species F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F sp sp spa spa spa spa spa spa sp spb spb sp sp sp sp sp sp spa spa spa sp hepatica hepatica hepatica hepatica hepatica hepatica hepatica hepatica hepatica gigantica gigantica gigantica gigantica gigantica gigantica gigantica gigantica gigantica gigantica sp sp sp sp sp sp spa spa sp sp sp G G H H H H H H G H H G G ? G G ? H H H H Country Code of samples DNA Extracted from Host Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Australia Uruguay Spain France China Ireland C Asia Armenia Austria C Asia Indonesia Indonesia China China Indonesia Thailand Burkina Faso Zambia Zambia China China Japan Japan Japan Japan Japan Korea Korea Korea Japan FspBD-VN FspPY-VN FspH1-VN FspH2-VN FspCB1-VN FspFG1-VN FspFG2-VN FspNA-VN FspTH-VN Fsp1-VN Fsp2-VN FspB3-VN FspBDB-VN FspM-VN FspNB-VN FspT4-VN FspX-VN FspBD1-VN FspCB2-VN FspN-VN FspQB-VN Fh-AU Fh-UR FhCa-SP Fh-FR Fh(Si)-CN Fh-IR FhSemyenovaH1 FhSemyenovaH2 Fh_AT FgSemyenovaG5, G6, G7, G8 Fg(IndoA)-ID Fg-ID Fg(GxB10)-CN Fg(Gx)-CN Fg(IndoT)-ID Fg-TL Fg(Bobo)-BF FgZamI-ZA FgZamII-ZA Fsp(He1)-CN Fsp(He2)-CN FspI-JP FspII-JP FspKochi1-JP FspSaita-JP FspHokai-JP Fsp(Kor2)-KR Fsp(Kor4)-KR Fsp(Kor5)-KR FspKochi2-JP Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult miracidia Adult Adult miracidia Adult Adult Adult Adult Adult Adult N/A Adult Adult Adult Adult Adult N/A Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Adult Human Cattle Human Human Cattle Human Human Cattle Cattle Human Human Cattle Cattle Human Cattle Buffalo Human Human Buffalo Humand Humand Cattle N/A Cattle Cattle N/A N/A N/A N/A N/A N/A N/A N/A Buffalo Buffalo Cattle Cattle Cattle N/A N/A Sheep Sheep N/A N/A Cattle Cattle Cattle N/A N/A N/A N/A Markers used cox1 p p p p p p p p p p p p p p p p p p p p p p p nad1 p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p Genbank no/Refs ITS-2 p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p EU260063 EU260074 EU260068 EU260069 EU260064 EU260066 EU260067 EU260071 EU260076 EU260059 EU260060 EU260061 EU260057 EU260070 EU260072 EU260075 EU260077 EU260062 EU260065 EU260073 EU260078 EU260058 AB010974 AJ272053 AJ557567 AJ557568 AB207148 Semyenova et al., 2005 Semyenova et al., 2005 DQ683546 Semyenova et al., 2005 c EU260080 EU260079 AJ557569 AB010977 AB207149 AJ853848 AB010975 AB010976 AJ557570 AJ557571 AB010978 AB010979 AB207152 AB207151 AB207150 c c c c N/A: not available a Indicates apparent hybrid/ introgressed specimens (see text) b Indicates two worms known to have ITS-2 sequences of both Fasciola hepatica and Fasciola gigantica type For Vietnamese worms, G = F gigantica – like and H = F hepatica - like c Indicates data from Agatsuma et al (2000) d Indicates specimens that had undertaken cutaneous migration in humans as reported in Le et al (2007) and a mix of the remaining PCR components (PCR Master Mix from Promega) The PCR reactions were carried out in a MJ Thermal Cycler PTC-100 (MJ Research, USA) for cox1 with initiation at 94 °C for min, then 35 cycles including denaturation at 94 °C for min, annealing at 37 °C for min, extension at 72 °C for For ITS-2 728 T.H Le et al / International Journal for Parasitology 38 (2008) 725–730 and nad1 the above conditions were used, except that annealing was at 50 °C for Finally, all reactions were held for 10 at 72 °C to complete the amplification The PCR products were purified using QIAquick Purification kit (QIAGEN) PCR products were initially subjected to direct sequencing using the PCR primers as sequencing primers However, when traces with ambiguities were obtained (ITS-2), PCR products were cloned using a TA cloning kit (Invitrogen, USA) and recombinant plasmid DNAs subjected to sequencing using Big Dye Terminator Cycle Sequencing technology on an automated sequencer (ABI 3100 Avant Genetic Analyzer) using M13 forward and reverse primers 2.4 Data analysis and phylogenetic construction The sequences were edited in SeqEd v 1.03, aligned using AssemblyLIGN v 1.9c and analysed using the MacVector 8.2 package (Accelrys) in a Macintosh computer system Specific identification was confirmed by comparison with known sequences of the corresponding species in GenBank or by reference to our previous published data Le et al., 2001; Le and Nguyen, 2002 The multiple alignment of sequences was performed using GeneDoc v2.5 (Nicholas and Nicholas, 1997 GeneDoc: A tool for editing and annotating multiple sequence alignment Distributed by author) and/or ClustalW incorporated into the MacVector 8.2 package Modeltest v3.7 (Posada and Crandall, 1998) was used to find the best substitution model This model (HKY+G) was then specified for likelihood analyses in PAUP* v4.0b10 (Swofford, D L 2000 PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods) Version Sinauer Associates, Sunderland, Massachusetts) PaupUP graphical interface (Calendini, F., Martin J.-F 2005 PaupUP v1.0.3.1 A free graphical frontend for PAUP* Dos software Available from http://www.agro-montpellier.fr/sppe/Recherche/ JFM/PaupUp/main.htm) was used to facilitate working with PAUP* The dataset was resampled 100 times using the bootstrap method Phylogenetic analyses are presented only for the nuclear ITS-2 sequences Outgroups (sequences from Fascioloides magna DQ683545 and Fasciolopsis buski DQ341852) were used in some analyses to confirm monophyly of each Fasciola species As far as possible, all available published ITS-2, cox1 and nad1 sequences have been included Some sequences have been omitted – this is especially so for ITS-2 in which there are relatively few variable sites Sequences with ambiguous sites or incomplete sequences can bias the tree dramatically Available ITS-2 sequences not used were: AB207153 (Hiroshima and Kagoshima, Japan), which includes several ambiguous sites reflecting the fact that ITS-2 sequences of both Fasciola species are present (Itagaki et al., 2005a); AB259058 (Kyoto, Japan), which is incomplete; L07844, one of the earliest reported sequences of F hepatica, which has possible sequencing errors at the end, and DQ383512 from Egyptian F gigantica and which has many probable errors near the end Sequences reported by Adlard et al (1993) (F gigantica from Indonesia and Malaysia; F hepatica from Australia, New Zealand, Hungary and Mexico; Fasciola sp from Japan) are shorter than those presented here and have not been included Their inclusion would not have altered the conclusions reached All ITS-2 sequences reported by Huang et al (2004; AJ557567- AJ557571) include a pair of sites near the end that are inverted relative to all other available sequences However, Prof Zhu Xing-Quan (personal communication), one of the authors of that paper, has confirmed that this inversion is a sequencing error: their sequences have been corrected as used in this paper (note that Alasaad et al (2007), have used the uncorrected sequences) Sequences for some haplotypes from Turkmenistan and adjacent regions of West and Central Asia reported by Semyenova et al (2005) have been reconstructed from information in that paper: none was available from any database Immediately prior to submission of this paper, a further sequence of F gigantica, from Meghalaya, India, appeared in the public databases This is EF027103, identical in sequence to the Indonesian reference sequence of F gigantica mentioned below Sequences of F hepatica from Bolivia (Mas-Coma et al., 2001) are identical to those from Spain For reference, F gigantica from Indonesia (Fg_ID) and F hepatica from Australia and Europe (Fh_AU) are regarded as representing genetically pure forms of each species that have not experienced introgression or hybridisation (Agatsuma et al., 2000) (indicated by arrows on Fig 1) Results Excluding flanking regions in the 5.8S and 28S genes, the length of the ITS-2 alignment was 362 bp For the mitochondrial markers, partial sequences were obtained from cox1 (423 bp) and nad1 (435 bp) The main purpose of the phylogenetic analyses was to compare species-of-origin of nuclear and mitochondrial sequences in a number of individual worms from Vietnam and elsewhere This is easily done by presenting a tree based on one marker on which can be indicated, for each individual, species-of-origin of the other marker(s) Here we present only the tree of the ITS-2 sequences (Fig 1) Given the small number of differences between the species in the ITS-2 region, and the slight variation within each species, it is not surprising that bootstrap values are rather low However, the two species are clearly distinguished (and remain so in analyses using other fasciolids as outgroups) It is immediately apparent that the Vietnamese worms fall readily into the F gigantica or the F hepatica cluster based on ITS-2 data However, all Vietnamese worms had mitochondrial sequences (both cox1 and nad1) typical of F gigantica only Mitochondrial genomes in animals are maternally inherited Our data thus demonstrate that hybridisation or introgression has occurred T.H Le et al / International Journal for Parasitology 38 (2008) 725–730 729 had probably not experienced introgression/hybridisation, were placed where expected on the tree (Fig 1) However, for many of these worms, ITS-2 only was available and nothing was known about their mitochondrial genome The exceptional sequence was from a specimen of F gigantica from Zambia (AB010975) This sequence had the single-base deletion characteristic of F gigantica, but at most other variable sites it possessed the base typical of F hepatica We are uncertain how to interpret this Individual worms from human patients were distributed in both clades of the tree (Fig 1) Discussion Fig Tree inferred from ITS-2 sequences Specimen codes are those used in Table GenBank accession numbers are included where available Sequences from human cases are shown in bold-italic type Arrows point to reference sequences from ‘‘pure’’ Fasciola gigantica or Fasciola hepatica With the few exceptions discussed in the text, sequences fall into two groups corresponding to F gigantica and F hepatica Sequences are labeled according to the species name or code given to them in the relevant original publications: Fg = F gigantica, Fh = F hepatica and Fsp for those not assigned to a species Specimens from Vietnam are indicated by the letters ‘‘VN’’ after the specimen code Other country codes: AR, Armenia; AT, Austria; AU, Australia; BF, Burkina Faso; BV, Bolivia; CA, Turkmenistan and adjacent regions of Central Asia; CN, China; FR, France; ID, Indonesia; IN, India; IR, Ireland; JP, Japan; Kr, Korea; RU, Russia, and neighbouring countries; SP, Spain; TL, Thailand; UR, Uruguay; ZA, Zambia Specimens known to have F gigantica-like mitochondrial sequences (this study or from the literature) are indicated by * Similarly, specimens with F hepatica-like mitochondrial sequences are indicated with # after the specimen code Neither symbol appears if mitochondrial data are not available for that individual The two sequences marked with Ù came from the same worm specimen in north eastern China (Huang et al., 2004) The symbol indicates worms from Vietnam for which direct-sequencing traces indicated the presence of both F hepatica and F gigantica ITS-2 sequences Clean sequence for only one type of ITS-2 was subsequently obtained from cloned PCR products, which is why the worms are included in only one clade Bootstrap values (as percentage support for each branch) are shown involving the two Fasciola species and that F gigantica was the maternal parent in each case Direct sequencing of PCR products from some of the Vietnamese worms yielded traces with ambiguities indicating the presence of both F hepatica and F gigantica ITS-2 sequences (data not shown) Clean sequence for only one type of ITS-2 was subsequently obtained from cloned PCR products, which is why each of these worms is included in only one clade in Fig All ITS-2 sequences (except one) from populations of either species that, because of their geographical origins, It is clear that hybridisation and/or introgression has occurred in Vietnam involving both of the common species of Fasciola In every case in that country, the mitochondrial genome was typical of F gigantica, whereas the nuclear genome could be from either species Distinguishing between hybridisation and introgression requires more data than we have available We regard hybrids as the F1 offspring of a mating between the two species In such a case, all offspring will carry the mitochondrial genome of the maternal parent However, their nuclear ribosomal RNA cluster will contain copies from both parents Back-crossing of hybrids and of subsequent generations with one parent species (=introgression) should homogenise the ribosomal array so that sequences of the other species will eventually disappear However, the nonrecombining nature of the mitochondrial genome means that it will be passed on largely unchanged from generation to generation If back-crossing of hybrids is with the paternal species, then the mitochondrial genome of the maternal species will introgress into the paternal species (reviewed in Blair, 2005) All this assumes that the organisms involved reproduce sexually and undergo normal meiosis For many eastern Asian populations of Fasciola species, this assumption seems to be false If hybrids are parthenogenetic, then worms should carry ribosomal repeats from both parents, as well as the mitochondrial genome of the maternal parent, for as many generations as the clonal lineage persists We not yet know the ploidy of any of the Vietnamese worms, nor we know if any are parthenogenetic However, in at least some cases, individual worms carried ribosomal sequences from both parent species, suggesting either that they were F1 hybrids, had undergone recent introgression, or that these worms were from parthenogenetic lineages of unknown age Not all human infections are due to hybrid/introgressed worms Some were apparently due to ‘‘pure’’ F gigantica infection In addition, worms from human patients were scattered in both clades in the tree (Fig 1), suggesting that multiple genotypes of Fasciola in Vietnam are capable of infecting humans We have no information on whether the mixing of genetic material of the two Fasciola species in Vietnam is a recent phenomenon Nor we know if ‘‘pure’’ F hepatica is present in the country 730 T.H Le et al / International Journal for Parasitology 38 (2008) 725–730 In conclusion, we have demonstrated the presence in Vietnam of hybrid and/or introgressed populations of liver flukes bearing genetic material from both F hepatica and F gigantica Some of these worms were from human patients This appears to be the first demonstration from a tropical country of the presence of liver flukes containing genetic material from both common species of Fasciola Acknowledgments This investigation received financial support from ICGEB (Project No CRP/VIE05-02 awarded to Thanh Hoa Le) and the Wellcome Trust (Grant No 068762 awarded to Le, McManus and Blair) We thank our collaborators for their kind provision of materials used in this study and staff in Dr Le’s Laboratory (Institute of Biotechnology, Hanoi, Vietnam) for their laboratory work References Adlard, R.D., Barker, S.C., Blair, D., Cribb, T.H., 1993 Comparison of the second internal transcribed spacer (Ribosomal DNA) from populations and species of Fasciolidae (Digenea) Int J Parasitol 23, 423–425 Agatsuma, T., Arakawa, Y., Iwagami, M., Honzako, Y., Cahyaningsih, U., Kang, S.Y., Hong, S.J., 2000 Molecular evidence of natural hybridization between Fasciola hepatica and F gigantica Parasitol Int 49, 231–238 Alasaad, S., Huang, C.Q., Li, Q.Y., Granados, J.E., Garcı´a-Romero, C., Pe´rez, J.M., Zhu, X.Q., 2007 Characterization of Fasciola samples from different host species and geographical localities in Spain by sequences of internal transcribed spacers of rDNA Parasitol Res 101, 1245–1250 Ashrafi, K., Valero, M.A., Panova, M., Periago, M.V., Massoud, J., MasComa, S., 2006 Phenotypic analysis of adults of Fasciola hepatica, Fasciola gigantica and intermediate forms from the endemic region of Gilan, Iran Parasitol Int 55, 249–260 Blair, D., 2005 Ribosomal DNA variation in parasitic flatworms In: Maule, A.G., Marks, N.J (Eds.), Parasitic Flatworms: Molecular Biology, Biochemistry, Immunology and Control CABI, Wallingford, Oxfordshire, pp 96–123 Bowles, J., Blair, D., McManus, D.P., 1995 A molecular phylogeny of the human schistosomes Mol Phylogenet Evol 4, 103–109 Bowles, J., McManus, D.P., 1993 Rapid discrimination of Echinococcus species and strains using a PCR-based RFLP method Mol Biochem Parasitol 57, 231–239 Bui, K.L., Do, T.T., Le, N.M., Osamu, S., Shinobu, Y., 2003 Application of agar gel diffusion test to the diagnosis of fasciolosis in cattle and buffaloes in the Red River delta in Vietnam Jpn Ag Res Quart 37, 201–205 Dowling, T.E., Secor, C.L., 1997 The role of hybridization and introgression in the diversification of animals Ann Rev Ecol Syst 28, 593–620 Fletcher, H.L., Hoey, E.M., Orr, N., Trudgett, A., Fairweather, I., Robinson, M.W., 2004 The occurrence and significance of triploidy in the liver fluke, Fasciola hepatica Parasitology 128, 69–72 Huang, W.Y., He, B., Wang, C.R., Zhu, X.Q., 2004 Characterisation of Fasciola species from mainland China by ITS-2 ribosomal DNA sequence Vet Parasitol 120, 75–83 Itagaki, T., Kikawa, M., Sakaguchi, K., Shimo, J., Terasaki, K., Shibahara, T., Fukuda, K., 2005a Genetic characterization of parthenogenetic Fasciola sp in Japan on the basis of the sequences of ribosomal and mitochondrial DNA Parasitology 131, 679–685 Itagaki, T., Kikawa, M., Terasaki, K., Shibahara, T., Fukuda, K., 2005b Molecular characterization of parthenogenic Fasciola sp in Korea on the basis of DNA sequences of ribosomal ITS1 and mitochondrial NDI gene J Vet Med Sci 67, 1115–1118 Le, T.H., Blair, D., McManus, D.P., 2001 Complete DNA sequence and gene organization of the mitochondrial genome of the liverfluke, Fasciola hepatica L (Platyhelminthes; Trematoda) Parasitology 123, 609–621 Le, T.H., De, N.V., Agatsuma, T., Blair, D., Vercruysse, J., Dorny, P., Nguyen, T.G.T., McManus, D.P., 2007 Molecular confirmation that Fasciola gigantica can undertake aberrant migrations in human hosts J Clin Microbiol 45, 648–650 Le, T.H., Nguyen, V.D., 2002 Molecular-based identification of Fasciola gigantica in Vietnam using mitochondrial-encoded nad1 sequence as genetic markers J Malaria Parasit Dis Control 3, 41–48 Lin, R.Q., Dong, S.J., Nie, K., Wang, C.R., Song, H.Q., Li, A.X., Huang, W.Y., Zhu, X.Q., 2007 Sequence analysis of the first internal transcribed spacer of rDNA supports the existence of the intermediate Fasciola between F hepatica and F gigantica in mainland China Parasitol Res 101, 813–818 Marcilla, A., Bargues, M.D., Mas-Coma, S., 2002 A PCR-RFLP assay for the distinction between Fasciola hepatica and Fasciola gigantica Mol Cell Probes 16, 327–333 Mas-Coma, S., Bargues, M.D., Valero, M.A., 2005 Fascioliasis and other plant-borne trematode zoonoses Int J Parasitol 35, 1255–1278 Mas-Coma, S., Funatsu, I.R., Bargues, M.D., 2001 Fasciola hepatica and lymnaeid snails occurring at very high altitude in South America Parasitology 123, 115–127 Posada, D., Crandall, K.A., 1998 MODELTEST: testing the model of DNA substitution Bioinformatics 14, 817–818 Semyenova, S.K., Morozova, E.V., Vasilyev, V.A., Gorokhov, V.V., Moskvin, A.S., Movsessyan, S.O., Ryskov, A.P., 2005 Polymorphism of internal transcribed spacer (ITS-2) sequences and genetic relationships between Fasciola hepatica and F gigantica Acta Parasitol 50, 240–243 Terasaki, K., Akahane, H., Habe, S., Moriyama, N., 1982 The geographical distribution of common liver flukes (the genus Fasciola) with normal and abnormal spermatogenesis Jpn J Vet Sci 44, 223– 231 Terasaki, K., Noda, Y., Shibahara, T., Itagaki, T., 2000 Morphological comparisons and hypotheses on the origin of polyploids in parthenogenetic Fasciola sp J Parasitol 86, 724–729 Tran, V.H., Tran, T.K., Nguyen, H.C., Pham, H.D., Pham, T.H., 2001 Fascioliasis in Vietnam SE Asian J Trop Med Pub Health 32 (Suppl 2), 48–50 Xuan, L.T., Hung, N.T., Waikagul, J., 2005 Cutaneous fascioliasis: a case report in Vietnam Am J Trop Med Hyg 72, 508–509 ... Code of samples DNA Extracted from Host Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam... spa spa sp hepatica hepatica hepatica hepatica hepatica hepatica hepatica hepatica hepatica gigantica gigantica gigantica gigantica gigantica gigantica gigantica gigantica gigantica gigantica... because of their geographical origins, It is clear that hybridisation and/ or introgression has occurred in Vietnam involving both of the common species of Fasciola In every case in that country, the