Stabilization of The Promoter Nucleosomes in Nucleosome Free Regions by the Yeast Cyc8-Tup1 Corepressor

1 Stabilization of The Promoter Nucleosomes in Nucleosome Free Regions by the Yeast Cyc8Tup1 Corepressor Kaifu Chen*1,2, Marenda A Wilson*5,6,7, Calley Hirsch5,6,7, Anjanette Watson3, Shoudan Liang4,6, Yue Lu4,6, Wei Li§1,2,9, and Sharon Y.R Dent§5,6,7,8 Division of Biostatistics, Dan L Duncan Cancer Center and 2Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030 University of Vermont Bioinformatics Core,Burlington, VT 05405 4Department of Bioinformatics and Computational Biology, 5Program in Genes and Development, 6Center for Cancer Epigenetics 7Department of Molecular Carcinogenesis, Science Park, The University of Texas MD Anderson Cancer Center,1515 Holcombe Blvd., Box 1000, Houston, TX 77030 § Corresponding Authors 8Telephone: 512.237.9401; email: sroth@mdanderson.org Telephone: 713.798.7854; email: WL1@bcm.edu *These authors contributed equally to this work and are listed in alphabetical order SUPPLEMENTAL METHODS RNA isolation RNA was isolated from BY4742 and YSC1021-550429, and YMW130 strains by standard phenol-chloroform extraction procedures Purified RNA was then treated with the TURBO DNA-free kit (Ambion, Austin, TX) to remove contaminating any DNA in each sample Purified RNA was then normalized and subjected to qRT-PCR or Northern blot analyses Quantitative reverse transcription PCR (qRT-PCR) 10-20 µg of RNA was used for each sample in separate qRT-PCR reactions qRT-PCR was performed using Power SYBR Green RNA-to-CT 1-step kit (Applied Biosystems, Austin, TX) The reaction conditions were the following: X 48˚C, 30 min., X 95˚C, 10 min., 40 X (1 X 95˚C, 15 sec., X 60˚C, min.), 95˚C-60˚C (melt curve) The reactions were carried out using a 7500 Fast Real Time-PCR system (Applied Biosystems, Austin, TX) Chromatin immunoprecipitation (ChIP)/quantitative PCR (q-PCR) In order to determine the differences in enrichment in yeast between wild type (BY4742), Cyc8-TAP, Tup1-TAP strains, we isolated ChIP DNA from each strain as previously described with modifications Briefly, BY4741, YSC1178-7499311, and YSC1178-7499536 were grown to a final OD 600nm of 0.8 in 100 mL of YEP containing 2% Glucose Cells were chemically crosslinked for 15 minutes by adding formaldehyde solution to a final concentration of 2% The crosslinking reaction was then quenced for minutes following the addition Glycine to a final concentration of 125 mM Cells were then collected and washed two times in 20 mL of 1X PBS Next, each sample was resuspended in mL of lysis buffer/IP buffer [50 mM HEPES/KOH, 140 mM NaCl, mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate, and 2X Complete Protease Inhibitors (Roche, Indianapolis, IN)] Samples were lysed in a Bead Beater (Biospec) containing 750 µL of cold acid-washed glass beads with three beating cycles following by minutes of cooling on ice 600 µL of crude lysates were collected and divided into two eppendorf tubes where each sample was then sonicated using a tip sonicator (1.5 output, 60% duty) for three 10 minute cycles (30 seconds on/off, high) Cell debris was then removed from each sample by centrifugation for 10 minutes at 16,000 x g Clarified extracts from split samples were collected and pooled and protein amounts in each sample were normalized 10% (~50 µL) of the total chromatin samples were removed to be used as input samples and 250 µL of TES [TE/1%SDS (50 mM Tris/HCl, 10 mM EDTA, 1% SDS)] was added to input samples The remaining samples (~500 µL) were then pre-cleared with pre-equilibrated agarose beads for hour while rocking at 4˚C Next, lysates were centrifuged to collect the supernatant and incubated with 20 µL of pre-equilibrated IgG sepharose (GE Healthcare, Piscataway, NJ) overnight The next day, the samples were centrifuged and the beads were collected and washed 2X with mL of lysis buffer/IP buffer for minutes each Next, the beads were washed for minutes with mL of lysis buffer/ 500 mM NaCl [(50 mM HEPES/KOH, 500 mM NaCl, mM EDTA, 1% Triton X-100, 0.1% Nadeoxycholate, Complete Protease Inhibitors (Roche, Indianapolis, IN)] at room temperature The beads were then subjected to two five minute washes with mL of IP wash solution [(10 mM Tris-HCl, 0.25 M LiCl, 0.5% Nonidet P-40, 0.5% Na-deoxycholate, mM EDTA, and Complete Protease Inhibitors (Roche, Indianapolis, IN)] at room temperature Next, the beads were washed once with TE, pH 8.0 The inputs and immunoprecipitates were then eluted in 250 µL of TES [TE/0.67% SDS (50 mM Tris-HCl, 10 mM EDTA, 0.67% SDS)] containing 100 µg of Proteinase K at 65˚C overnight The next day, samples were then subjected to a PCR cleanup (Qiagen, Valencia, CA) and ran over a DNA binding column and eluted in 50 µL of ddH2O 4 The samples were then subjected to qRT-PCR Briefly, qRT-PCR was performed using Power SYBR Green-CT kit (Applied Biosystems, Austin, TX) The reaction conditions were the following: X 95˚C, 10 min., 40 X (1 X 95˚C, 15 sec., X 50˚C, min.), 95˚C-60˚C (melt curve) The reactions were carried out using a 7500 Fast Real Time-PCR system (Applied Biosystems, Austin, TX) Microarray RNA was isolated from biological triplicates of MATα (BY4742) strains containing deletions of CYC8 or TUP1 or a wild-type comparative isogenic strain grown in 250 mL of YPD media to a final cell density between 1.0-1.3 x 10 cells/ml 1.8 x 107 cells were then treated with Lyticase to from spheroplasts Guanidinium isothyocyanate was used to dissolve the cell membrane and total RNA was collected using an RNeasy spin column (Qiagen, Valencia, CA) The final recovered RNA was resuspended in DEPC-treated water RNA was quantified then analyzed using the Agilent Technologies 2100 expert bioanalyzer to assess quality and concentration Only those RNA preparations that passed quality control thresholds were further processed Oligonucleotide d(24T's) primer were hybridized to the polyA tails of total RNA to amplify mRNA Reverse transcriptase was added in order to synthesize first strand cDNA: the second cDNA strand was synthesized following the addition of RnaseH treatment and by the addition of DNA polyermase I to each sample Next, the cDNAs were ligated and subjected to standard phenol-chloroform purification The cDNAs were then in vitro transcribed using T7 RNA polymerase bound to the T7 promoter with biotinylated nucleotides to synthesize biotinylated antisense cRNAs A Qiagen RNeasy kit (Qiagen, Valencia, CA) was used to purify the biotinylated cRNAs cRNAs were eluted in DEPC-treated water, quantified, and reviewed for quality of product and concentration using the Agilent 2100 Bioanalyzer All samples passed quality control, were fragmented, and visually inspected via gel electrophoresis to ascertain the degree of fragmentation success All samples were sufficiently fragmented to proceed with microarray hybridization Subsequent hybridization and microarray processing steps were performed by the University of Vermont's Microarray Core Laboratory (http://vgn.uvm.edu/microarray/) Briefly, RNA from each sample of each strain was hybridized independently to Affymetrix Yeast Genome 2.0 Arrays Affymetrix recommends a number of quality control metrics be calculated for each array, each of these metrics was examined for each array using AffyQCReport 1.24.0 from within BioConductor and all passed established Affymetrix recommended minima thresholds Signal intensities were normalized using the Robust Microarray Algorithm The Limma package was then used to identify genes that were reliably differentially expressed between strains Solexa Sequencing First, sample ends were repaired from the 150 bp nucleosomal DNA by the addition of each sample to the following reaction: 30 µL of DNA sample (1 ng/µL), 10 µL ddH2O, 1X T4 DNA ligase buffer containing 10 mM ATP (5 µL), dNTP mix, T4 DNA polymerase (NewEngland Biolabs, Ipswich, MA), Klenow DNA polymerase I (NewEngland Biolabs, Ipswich, MA), and T4 Phosphonucleotide kinase (NewEngland Biolabs, Ipswich, MA) The samples were then incubated in the thermal cycler for 30 minutes at 20˚C Next, the samples were purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA) Samples were eluted by the addition of 34 µL of 39°C Buffer EB to the QIAquick membrane followed after minute by a minute centrifugation In order to add an “A” to the 3’ end of each sample, each DNA sample was inclubated with Klenow NEBuffer 2, dATP, and Klenow exonuclease (NewEngland Biolabs, Ipswich, MA) (3’ to 5’ exo-) and incubated for 30 minutes at 37˚C The samples were then subjected to a MinElute PCR Purfication (Qiagen Inc, Valencia, CA) and eluted in 10 µL of Buffer EB The adapters were ligated to each sample by the addition of each sample to a reaction mix containing Quick ligase buffer, Genomic Adapter oligo mix diluted 1:10 from its original concentration (Illumina, SanDiego, CA), and Quick T4 DNA ligase (NewEngland Biolabs, Ipswich, MA) The reactions were then incubated for 15 minutes at room temperature and purified using the MinElute PCR Purification Kit (Qiagen Inc, Valencia, CA) DNA samples were separated in a 2% agarose gel after a 10 minute incubation with EZVision one buffer (Amresco Inc., Solon, OH) DNA samples that were 250 ± 25 basepairs were excised DNA was purified from gel slices using a QIAGEN MinElute Gel Extraction kit (Qiagen Inc, Valencia, CA) and eluted in 20 µL of BufferEB DNA samples were enriched by PCR in a solution containing the DNA samples, Phusion DNA Polymerase Master Mix(NewEngland Biolabs, Ipswich, MA) and primers under the following conditions: 30s at 98˚C, 18X (10s at 98˚C, 30s at 65˚C, 30s at 72˚C), minutes at 72˚C, with a hold at 4˚C Samples were then purified using an Agencourt AMPure Kit (Beckman Coulter Genomics, Danvers, MA) and eluted in 40µL of BufferEB Samples were then quantified using PicoGreen (Invitrogen, Carlsbad, CA) and diluted to 10 nM for each sample to be used for paired-end Solexa sequencing The Illumina Genome Analyzer sequences by synthesis of short sequence fragments hybridized to the surface of a flowcell with a matrix containing complimentary sequences to the adapters added to both ends of the DNA fragment A 100 µl of a pM solution in Hybridization Buffer of each sample was hybridized to a single lane of a Paired End GAII flowcell using the Illumina Cluster Station running a standard paired end sequencing program using the reagents in a PE203-1002 Cluster generation kit (Illumina, San Diego, CA) One lane of each flowcell had a PhiX lane to use to create the matrix file for analysis of the other lanes Once the clusters were grown in about 4.5 hr, the flowcell was cleaned with HPLC grade Methanol (Fisher Scientific,) to remove oil & dust The flowcell was loaded within 30 minutes of cluster generation onto Genome Analyzer II (GA) primed with SBS reagents for 36 cycles of sequencing The flowcell was checked for leaks by pumping Incorporation buffer through the flowcell If no leaks were detected, a layer of Immersion Oil TYPE A (Cardinal Health) was carefully wicked between the bottom of the flowcell and the prism The st cycle incorporation of nucleotides was begun on the GA When the 1st base was incorporated into the sequencing tags, the bottom surface of the flowcell was focused to maximize the fluorescence intensity of all bases and minimize background Once this was completed initial sequencing of tiles/lane was done to produce a First base report to determine if cluster densities & focus metrics were within Illumina specified parameters When the specifications were met, a paired end 36 cycle sequencing program was started to sequence the samples After the sequencing of the first 36 bases, the clusters were regrown so that the opposite end of the DNA fragment could be sequenced SBS sequencing reagents were loaded on the GA II and the fragments were sequenced for 36 cycles After completion of sequencing, the sequences were aligned to the yeast genome using ELAND software allowing for mismatches in the sequence 8 SUPPLEMENTAL TABLES Supplementary table Strains used in this study Strain YSC1049 YSC1021- Genotype MAT alpha, his3∆1, lys2∆0, leu2∆0, ura3∆0 MAT alpha, his3∆1, lys2∆0, leu2∆0, ura3∆0, Source Open biosystems Open biosystems 550429 yMW130 tup1∆::KANMX3 MAT alpha, his3∆1, lys2∆0, leu2∆0, ura3∆0, This study yMW131 cyc8∆::KANMX3 MAT alpha, his3∆1, lys2∆0, leu2∆0, ura3∆0, This study yMW147 cyc8∆::KANMX3 MAT alpha, his3∆1, lys2∆0, leu2∆0, ura3∆0, This study yMW149 cyc8∆::KANMX3 MAT alpha, his3∆1, lys2∆0, leu2∆0, ura3∆0, This study BY4741 YSC1178- tup1∆::KANMX3 MATa his3∆1 leu2∆0 ura3∆0 met15∆0 MATa his3∆1 leu2∆0 ura3∆0 met15∆0 CYC8- Open biosystems Open biosystems 7499311 YSC1178- TAP::HIS3MX6 MATa his3∆1 leu2∆0 ura3∆0 met15∆0 TUP1- Open biosystems 7499536 TAP::HIS3MX6 Supplementary table Oligos used in this study Name oMW164 oMW165 oMW172 oMW173 oMW176 oMW177 oMW180 oMW181 oMW186 oMW187 oMW188 oMW189 oMW198 oMW199 oMW200 oMW201 Target FLO9 FW FLO9 RV HXT13 FW HXT13 RV YHL044W FW YHL044W RV SPS100 FW SPS100 RV MUC1 FW MUC1 RV SGA1 FW SGA1 RV PDR11 FW PDR11 RV DAN1 FW DAN1 RV Sequence GTTGTCTCTGCGACTACAGC ATGTGCCTGATGAACTAACA CGCAATCCTCTATTGATAGC ATACCACTATCCCAACCAGG CGCTTATTTCTTAAAACAGA CTTACAATCATCATCTAAAC CTTTACAAGAGGCAGAACGT GCCAGTTTGTGACGATTATA CATCAACCACCGCTCCTGCT GCAGAAGAACTTTCAGTAGT GGGCATTCTCGATCAAAGCT CGAAATAGACGGATACACGG CCAACTCTATCAATGGCAAA CATAATATTCACCTCTGGGA GCTCAAACGCTGCTTCCACC GTCTTTGTGACGGTGCTGTC oMW218 oMW219 oMW221 oMW222 oMW225 oMW226 oMW227 oMW228 oMW235 oMW236 oMW241 oMW242 oMW245 oMW246 oMW249 oMW250 oMW253 oMW254 oMW270 oMW271 oMW276 oMW277 oMW322 oMW323 oMW356 oMW357 oMW388 oMW389 oMW398 oMW399 oMW544 oMW545 oMW105 oMW106 oMW550 oMW551 oMW722 oMW723 oMW732 oMW733 oMW768 oMW769 oMW774 oMW775 oMW782 YMR279C FW YMR279C RV YNL234W FW YNL234W RV DSF1 FW DSF1 RV TIR4 FW TIR4 RV OYE3 FW OYE3 RV AQY1 FW AQY1 RV STE2 FW STE2 RV STE6 FW STE6 RV RNR2 FW RNR2 RV SPG4 FW SPG4 RV TKL2 FW TKL2 RV YIR035C FW YIR035C RV MPC54 FW MPC54 RV GAT2 FW GAT2 RV BNA2 FW BNA2 RV TUP1 FW TUP1 RV 7S SRP FW 7S SRP RV CYC8 FW CYC8 RV FLO9 qPCR FW FLO9 qPCR RV SGA1 qPCR FW SGA1 qPCR RV SRD1 FW SRD1 RV SAG1 FW SAG1 RV SST2 FW TCCCACAAATATTCATGGGC CGTCATTGCACGTGGTAGAA CTGCACTATTTTGTTCACAG ACTTCGAAACCAACGGTTTT TGACAGATGCTCCCGAGATT ATCCAGGCGGCGAATTTCTC CTAAAATCACATTACTAGCC TAGGAGTCATCACTTGGATT GACCAGAATGAGGGCCACTC CGACTGACAATCATGGATGG CGTTATGTGGGTTTCGCAGA GATGGGCAGCGCAGCCATAA GTCGATATCTTTCACTTTAG CTGCTTGAGACCAAGGAATC CTTCTGTGCCAGTAATGTGG TGGAAAGTTATGGCTGATGC GGATATCCATGACTGGAACA GTAAGTATCGATCAACAAGG GAAACCATAACAACACAGGA AACTCACCTTGCGACATGTT ACTTTCCGTTGACCAGGTGG CAAGTCCTCGATAGAGTAAT GACCAACGGTAACGTGGTAT TGCACTCATGGAGGAAGGCC TTCTCACGCGATTTCCCCT CCTTTTTCCCCTTGGTGACT TTCTGCTCCTCAGCGGCTGG CAGCACTTCATTCTGATTCG CCTGACGTCGCCCAAGATCG GAGACCACTACCAGTGCTAG CAACAGCAACAGCAGCAACA GCAAAGTGGTGGTAGGCAAC GAATCCGTCTCTCTGTCTGG GAGTAAATCCTGATGGCACC GCAGCAGTTCCTCAGCAGCC CATATAATTCTGCAGCTCTT CAGAGCGCATTAATGCATGT CTGCGAACGTTTTCTTTATG GTATTAGGGGTGAGGGTGAA CCCCTAATTTGTGACTCCAC TCCGAGAGACGTACGACTAG CGGGTCCACTACGCCATTGA CGCAAAGTTACAATGATACC CTAGTAGTCGAGAATTGCGT GGAAACATCGATATAAATGA 10 oMW783 oMW786 oMW787 oMW792 oMW793 oMW822 oMW823 oMW824 oMW825 oMW830 oMW831 oMW872 oMW873 oMW878 oMW879 oMW900 oMW901 oMW924 oMW925 oMW930 oMW931 oMW938 oMW939 SST2 RV FUS1 FW FUS1 RV UTR2 FW UTR2 RV RMD6 FW RMD6 RV YML003W FW YML003W RV DSE1 FW DSE1 RV ACT1 FW ACT1 RV ARO10 FW ARO10 RV IMD2 FW IMD2 RV HXT8 qPCR FW HXT8 qPCR RV IMA5 qPCR FW IMA5 qPCR RV ARO10 qPCR FW ARO10 qPCR RV GCATAATATCAGTACAGTCC CAATAATGCAGACGACAACA CCGATTGAAAGCCCAATTGT TACCGTTCTTTCCTCCACGA AGTAGTGGAAATATTGGCAG CAGTGATCTGGGCTTTGACA TGGTTTGTAGCCGATGGTTG GGTGATGATCCATCTAGAAG TTGAAATGTGTAGTAAGCCT GTGAGTTATCCATACCTTCA GGATTTATTTGAGAGCTGGG GCAAACCGCTGCTCAATC CGGACATCGACATCACAC ACGGATATTCCCGTTACTCT CCTTTAAAATTTGAATCATG CTCAAGTGGGTCAAAGAGAG GGCTGTACCTTGTGGCCTAC CGAGAATAATTCCGCGACCG GCTTCATCCCTTACAATGGT CCGGAAAAAGTAATTCACAC GCACTTTCTATATAGTCATC GTCACTACAGCGGCAGCTCA GTCAACTTGTTTTGAGTATC 11 SUPPLEMENTAL FIGURES Supplemental Figure Snapshots of the highly reproducible nucleosome maps Two genomic regions flanking the CYC8 (top) and TUP1 (bottom) gene bodies are shown Each of the nine tracks in each snapshot represent a nucleosome map from one sample, as is labeled at left Gene open reading frames (blue bars) are show below 12 Supplemental Figure The P nuclesome is more enriched in the wild type than in the cyc8∆ or tup1∆ strain Nucleosome count is plotted as function of distance to TSS The -1, P, and +1 nucleosomes were labeled on top Supplemental Figure The P nucleosome is observable in a nucleosome map generated from partially digested chromatin, whereas it is hard to observe in a map from completely digested chromatin Nucleosome count is plotted as function of distance to TSS The -1, P, and +1 nucleosomes were labeled on top 13 Supplemental Figure Count of nucleosome gain or loss events plotted as a function of distance to the TSS or TTS The nucleosome gain or loss events that happen only in cyc8∆ (a), only in tup1∆ (b), or in both cyc8∆ and tup1∆ strains (c) were plotted separately 14 Supplemental Figure qRT-PCR validation of genes regulated by Cyc8 or Tup1 Supplemental Figure Venn diagram showing the overlap of differentially expressed genes (Q value < 0.01; fold change > 2) between cyc8∆ and tup1∆ strains Overlap P value is estimated based Fisher’s exact test 15 Supplemental Figure Binding preference of chromatin-remodeling factors to TATAcontaining promoters Percentages of TATA-containing promoters in the top 1000 and bottom 1000 genes ranked by binding intensity are plotted for each chromatin-remodeling factor Black and gray stars mark the chromatin factors that show 5% higher percentage of TATA-containing promoters in the top and bottom groups, respectively  ... Figure Binding preference of chromatin-remodeling factors to TATAcontaining promoters Percentages of TATA-containing promoters in the top 1000 and bottom 1000 genes ranked by binding intensity... between the bottom of the flowcell and the prism The st cycle incorporation of nucleotides was begun on the GA When the 1st base was incorporated into the sequencing tags, the bottom surface of the. .. formaldehyde solution to a final concentration of 2% The crosslinking reaction was then quenced for minutes following the addition Glycine to a final concentration of 125 mM Cells were then collected and