Gidi thttang SV.NCKH-Eureka ldn thzi- 15 nenn 2013 Ky ye'u khoa hoc IN SILICO SURVEY — PRIMER DESIGN FOR MUTATION DETECTION OF LDLR AND APOB GENES CAUSED FAMILIAL HYPERCHOLESTEROLEMIA Nguyin TN) My, Li Thi Dan Dam, Le Huyb Ai Thar' Khoa Cling Nghe Sinh Hoc, Ttruong Doi hoc Mu Thenh HO Chi Minh De tai clot gi6i Khuyin khich Giiri Mitring Sinh vie'n nghien eau khoa hoc — Eureka art XV mkt 2013 *Email: lhathuve,gmaiLcom TOM TAT Tang cholesterol mau c6 tinh gia dinh (Familial Hypercholesterolemia FH) la r6i loan di truyan phO bien gen trOi tren nhiem sic the thuang quy dinh, he luy cua no la cac benh ly ve tim mach, dOt quy, Muc tieu chinh cua nghien cfru tim hien ye ca the phan tin benh cao cholesterol mau co yen to gia dinh tren nguari benh Viet Nam, tap trung a nhimg Wing ming (hot spot) hay cac clOt bien not trOi tren hai gen c6 vai tra quan tong dieu hem cholesterol, gen LDLR (Low Density Lipoprotein Receptor) va APOB (Apolipoprotein B) Kat qua khai that din lieu ghi nhan dart bien tren gen LDLR tit da clang va phut tap, exon co ty 14 dOt bien cao nhat; cac dOt bien tren gen APOB tap trung chit yeu a exon 26 va dOt bien not trOi nhit la R3500Q Tin do, chiing toi tien hanh thiet ke va danh gia cac bO moi cho cac phuang phap tiep can thirc nghiem: PCR — Giai trinh to (ling vai exon tren gen LDLR) va PCR dac hiau allele (ling yen 01 bien R3500Q tren gen APOB) Ch'ing toi da khuach dai thank ding exon gen LDLR, ghi nhin cac clOt bien nghi ngar va ket lu'in btrac du ve tinh phirc tap cua dOt bien ten exon Ding thai, chi:mg toi khuech dai ding exon 26 gen APOB, khing dinh dOt bien R3500Q xuit hien teen ca 20 miu benh phim thuOc benh vin Da khoa Khu Niue Thi, flirt cung cap (yeti cac chi s6 lam sang cho thy cao cholesterol mau) Vai nhimg kat qua buarc diu nay, chfing toi ghi nhan ca hai loaf dOt bien (tren exon gen LDLR va dot bien tren gen APOB) dau tit co the la mot dau thing phan to tiem nang cho viac chin doan, tam sok nguy ca din den benh FH a nguiri Viet Nam Ter khda: d¢t bien R3500Q, Familial Hypercholesterolemia (FH), gen APOB, gen LDLR, PCR clOc hieu allele, PCR — Gicii trinh tu MOI DAU Tang cholesterol mau co tinh gia dinh (Familial Hypercholesterolemia — FH) la tOi loan di fruyan (dOt bien gen) gen trOi tren nhiem sic the thtramg quy dinh, ph6 Wan nhit la dOt bien ten gen LDLR (Low Density Lipoprotein Receptor) va APOB (Apolipoprotein B) voi vai tr6 quan tong viac dieu haa cholesterol mau Cac dOt bien tren hai gen lam anh htrang den chic nang cua cac protein ma hai gen ma hoa, lam cho cholesterol mau khong duct hap thy vao to boo, gay tang cholesterol mau, din den tang cao nguy ca mac cac benh tim mach (Fard — Esfahani P et al., 2005; Zakharova FM et al., 2005) Nhiau ding trinh nghien cfru tren the giai ghi nhan viac tim soot cac dOt bien tren hai gen la tien quyat nghien dm dich to hoc cua benh, &Ong that g6p phin nghien ciru sau va rO han va cac phuang phap china benh FH (Al — Allaf FA et aL, 2010; Al — Khateeb A et al., 2011; Fard — Esfahani P et al., 2005) CS Viet Nam, hien tai van chtra ca, nghien ctiu mang tinh phan tin nao va benh, ding nhu la cac clich to hoc ye FH Trong do, ty la nguari Viet Nam mac benh tang cholesterol mau duce phat hien tang nhieu Vi vay, chi:mg toi xac dinh muc tieu cua nghien cuu buoy diu la: 1) Tim hiau thong tin the giai nghien eau phan to ve benh FH, tap trung tren hai gen LDLR va APOB: cac kieu dOt bien, Wing tap trung dOt bien, tinh dac trung ve chUng tOc, vung dia ly phan biat (neu co); 2) Buoy dau xay dung cac ca sa thuc nghiam nhatn tiep can nghien cuu phan tin va benh FH a Viet Nam VAT LIEU VA PHUONG PHAP Sir dung 20 mau mau cua cac benh nhan duct chin doin lam sang biau hien tang cholesterol mau bai Banh vin Da Khoa Khu vuc Thu Dire cung cap (vari cac chi so lam sang cho thiy cao cholesterol mau) de tach DNA bO gen dua theo phuang phip phenol/chloroform (Chomczynski P, Sacchi N, 1987), thou hien PCR hay PCR dac hiau allele San phim PCR duct giri giai tai Cong ty Nam Khoa, TP.HCM 160 Kj; y'Jzi khoa hoc Gidi thuong SV.NC KH-Eureka kin ilia 15 mini 2013 HET QUA VA THAO LUAN Ket qui khai thac dir lieu Viec khai that thong tin tren NCBI (http://www.ncbi.nlm.nih.gov/) va Pubmed (http://www.ncbi.nlm.nih.gov/nubmed) dirge thuc hien tir hon 190 ding trinh thuc nghiem (s6 lieu cap nhat den 1/ 2013) de cap den dot bien tren hai gen LDLR va APOB cho thay d6t bien LDLR va APOB rat da clang tren the giai vai Ioai mau sir dung phi bien nhAt IA mau mau D6i viii gen LDLR, dot hien trai ring tren man b6 trinh to 18 exon va 17 intron, exon c6 nhieu dot bien nhat (du lieu khong trinh bay) Exon IA exon dai nhat so vai cac exon khac ten gen LDLR, ma hem cho vimg chirc nang gin vai ph6i tir dm thu the LDLR vii clop trinh to lap lai giau cysteine, tich dien am de de clang gin vii cac ph6i tir (tich dien ducmg) Do vay, d6t bien tren exon gen LDLR can thiet phai dtroc kiem tra tien hanh tam ' soat phat hien som b'e'nh FH Ong ding Han ncra, exon co khoang 144 dot bien khac va khong tap trung vimg ma rai rac nen khip ca exon, da s6 la dot bien diem, lam sai nghia (missense) va dOt bien mat doan nho Vi vay, phtrang phap thuc nghiem tiep can de tim dot bien tren exon hieu qua nhit la giai trinh to town be exon D6i vai gen APOB, cac d6t bien hau nhu chi xuat hien tap trung a exon 26 cua gen, d6 dOt bien diem R3500Q Ia dot bien not tr6i nhat Day IA ket qua cua qua trinh thay the nucleotide CGG CAG a vi tri 10708 cua gen APOB, clan den su thay the acid amin arginine glutamine o vi tri 3500, lam thay dOi cau vile protein APOB, pha va hoan town su lien ket giaa thu the LDL vii LDLC, cac dot bien khac chi lam cho su lien ket yeu di Nhu vay, chi can co mOt d6t bien R3500Q tren gen APOB xuat hien thi qua trinh thu nhi'n cholesterol vao to bao se bi can ter, gay tich Iuy va tang cholestrol mau Do vay, chung toi chin thir nghiem phuong phap PCR dac hieu allele nhim phat hien 'Jet hien dot bien R3500Q, ben canh PCR ket hqp giai trinh ttr nham khatig dinh tinh dac hieu cua ket qua PCR dac hieu allele a boat dau Ket qui thitt ke/ danh gisi nuti Chimg toi tien hanh thiet ke cac be m6i cho phucrng phap PCR — giai trinh tu Wing exon gen LDLR va phuong phap PCR dac hieu allele phat hien dot bien diem R3500Q gen APOB Sau do, tien hanh khao sat dac hieu, cac th6ng so vat 1j, b6 mLi bet— nhang cong cu tin sinh hoc: chuang trinh Blast (htta://blast.ncbi.nlm.nih.gov/Blast.cai) IDT analyzer (http://www.idtdna.com/analyzer/aDolications/oligoanalyzer/) Qua qua trinh danh gia, so sanh va phan tich, chimg Val quyet dinh sir dung cac b6 moi trinh bay a BANG Bang Bang mOi sir dung nghien ciru Ten m8i Trinh tu, D-i APOB-F APOB-R1 APOB-R2 LDLR-F LDLR-R GACCACAAGCTTAGCTTGG GGGTGGCTTTGCTTGTATG TGCAGCTTCACTGAAGACT ACTGCGGCAGCGTCCCCGGC TGGGGGAGCCCAGGGACAGG 19 19 19 20 20 hiet er chay 53.6 54.3 53.9 70.7 66.7 Kc phLm 334 by 167 by 527bp Ktt qui PCR — giii trinh tv exon gen LDLR Tien hanh phin irng PCR khuech dai vimg trinh tu exon gen LDLR tren cac mau vai cap moi LDLR-F va LDLR-R vai nhiet lai 68°C, ket qui cho dung kich thuot 527 bp Vi vay chimg toi giri giai trinh tu (theo hai chieu nguoc vi xuoi) vi ghi nh(In dtrcyc met se (let bien kern tinh trrtng cua &A Nen dOng hey to ho4c di hop to (dir lieu khong trinh bay) Qua phan tich buoy dau, cac d6t bien tren exon gen LDLR kha da dang, co nhimg difa bien mai chua timg dugs ding bo tar& day tren the giai (S89P, 1101L, Cl 13L, ) va tong co mOt so dot bien da co cong bo tren the giai (D147H, C I 07R, C113W) Da so cite dot Wen clang dring hop tir cho nen kha nang di truyen benh cho the he sau la rat cao Ket qui phan sing PCR die hiOu allele phsit hiOn dot bien R3500Q gen APOB Chang toi thuc hien phan ang PCR dac hieu allele phat hien dot bien R3500Q tren gen APOB vai DNA tach chief tir 20 mau mau a tren vai be moi APOB (mOt cap mai khuech dal ben ngoai dot bien va met moi phat hien d6t 161 Gidi thuring SV.NCKH-Eureka lan thii 15 ncim 2013 Ky yeu khoa h9c bien, BANG 1) Ket qua cho thay 20 miu khao sat deu xuet hien dOt bien R3500Q Ket qui la hoan town bat nga bai du co mat' rat nho flitting dOt bien lai xuat hien qua cao, khac vii so lieu da ghi nhan ten the giot KET LUAN Qua trinh thus hien nghi'en eau, chung tai rat &or mOt s6 ket lino nhtr sau: (1) DOt bien tren gen LDLR rat da clang va phirc tap, exon co tY le dot bien cao nhat; dOt Wen not trOi Mat tren gen APOB la dOt bien R3500Q; (2) Khuech dai cong exon gen LDLR, ghi nhan cac dOt hien va ket luan btrac du ve tinh pink tap caa dqt bien tren exon nay; (3) Khuech dai cong exon 26 gen APOB, khAng dinh dOt bien R3500Q xuat hien tren ca 20 mau b'enh pharn Nhu vay ca hai loaf dOt bien (tren exon gen LDLR va dOt bien R3500Q tren gen APOB)deu rat co the la mOt dau chirng phan tir tiem nang cho viec char down, tam soat nguy ca dan den benh FH 'Toed Viet Nam Huong nghien cfru sip tai cua chang t8i la tien hanh tren ca mall Ion xac nhan tan silk xuat hien dm dot bien R3500Q gen APOB va dOt bien gen LDLR, tren cong ding nguoi Viet Nam TAI LIEU THAM KHAO Al — Allaf FA, Coutelle C, Waddington SN, David AL, Harbottle R, Themis M (2010) Gene therapy for familial hypercholesterolaemia problems, progress, and perspectives International Archives of Medicine 3: 36 Al — Khateeb A, Zahri MK, Mohamed MS, Sasongko TH, Ibrahim S, Yusof Z, Zilfalil BA (2011) Analysis of sequence variations in low — density lipoprotein receptor gene among Malaysian patients with familial hypercholesterolemia BMC Medical Genetics 12: 40 Chomczynski P, Sacchi N (1987) Single — step method of RNA isolation by acid guanidinium thiocyanate — phenol — chloroform extraction Anal Biochem 162: 156 —159 Fard — Esfahani P, Mohammadi — Torbati P, Khatami S, Zeinali S, Taghikhani M, Allahyari M (2005) Familial defective Apoliporrotein b 100: frequency of R3500Q mutation of Apoliporotein B gene in Iranian hypercholesterolemic patients Acta Medica Iranic 43: 193 —196 Fard — Esfahani P, Zeinali C, Dehboneh SR, Taghikhani M, and Khatami S (2008) A novel mutation in exon of the Low Density Lipoprotein (LDL) receptor gene in an Iranian familial hypercholesterolemia patient Iran Biomed J 9: 139 —142 Zakharova FM, Damgaard D, Mandelshtam MY, Golubkov VI, Nissen PH, Nilsen GG, Stenderup A, Lipovetsky BM, Konstantinov VO, Denisenko AD, Vasilyev VB, Faergeman (2005) Familial hypercholesterolemia in St — Petersburg the known and novel mutations found in the low density lipoprotein receptor gene in Russia BMC Medical Genetics 6: 162 Giai thuong SV.NCKH-Eureka lan th& 15 neim 2013 KY 0u khoa hoc IN SILICO SURVEY - PRIMER DESIGN FOR MUTATION DETECTION OF LDLR AND APOB GENES CAUSED FAMILIAL HYPERCHOLESTEROLEMIA Nguyen Tra My, Le Thi Dan Diem, Le Huyen Ai Thuy* Faculty of Biotechnology, Ho Chi Minh City Open University *Email lhathuvezmail.com SUMMARY Familial Hypercholesterolemia (FH) is the most common genetic disorder, autosomal dominant inheritance and the consequence of heart diseases, peripheral vascular and ischemic cerebrovascular diseases, etc The primary objective of this study was to find out the molecular mechanism of FH in Vietnam patients, to focus on hotspot or dominant mutations of two important genes which are responsible for the regulation of cholesterol metabolism as LDLR gene (Low Density Lipoprotein Receptor) and APOB gene (Apolipoprotein B) The results of data mining reported on the high diverse, complicated mutations of LDLR gene, the highest mutation frequency was in exon 4, the mutations of APOB gene turned on exon 26 and the dominant mutation of R3500Q Thereby, we carried out to design and evaluate the primer sets for the experimental approach including the combination of PCR and sequencing which corresponded with exon of LDLR gene and Allele Specific PCR method for identification of the R3500Q mutation of the APOB gene The results showed the successful amplification in exon of LDLR gene as confirmed the suspicious mutations and concluded that the complexity of mutations in exon In addition, we successfully amplified the exon 26 of the APOB gene, that affirmed the occurrence of R3500Q mutation in 20 samples of Thu Duc Hospital which had high levels of blood cholesterol Our initial results reported the mutations in exon of LDLR gene and R3500Q of APOB gene can be the potential molecular markers for the diagnosis, screening the risk of FH diseases in Vietnamese people Keywords:Allele Specific PCR, ApoB gene, Familial Hypercholesterolemia (F1V, LDLR gene, PCR and sequencing, R3500Q mutation 163 ... khoa hoc IN SILICO SURVEY - PRIMER DESIGN FOR MUTATION DETECTION OF LDLR AND APOB GENES CAUSED FAMILIAL HYPERCHOLESTEROLEMIA Nguyen Tra My, Le Thi Dan Diem, Le Huyen Ai Thuy* Faculty of Biotechnology,... complicated mutations of LDLR gene, the highest mutation frequency was in exon 4, the mutations of APOB gene turned on exon 26 and the dominant mutation of R3500Q Thereby, we carried out to design and. .. the primer sets for the experimental approach including the combination of PCR and sequencing which corresponded with exon of LDLR gene and Allele Specific PCR method for identification of the