Functionallyactivefusionproteinofthenovelcomposite cytokine
CLC/soluble CNTF receptor
Catherine Guillet
1
, Eric Lelie
`
vre
1
,He
´
le
`
ne Plun-Favreau
1
, Josy Froger
1
, Marie Chabbert
1
, Jacques Hermann
1
,
Amelie Benoit de Coignac
2
, Jean-Yves Bonnefoy
2
, Hugues Gascan
1
, Jean-Franc¸ois Gauchat
2
and Greg Elson
2,
*
1
INSERM U564, CHU d’Angers, Angers, France;
2
Centre dı
´
Immunologie Pierre Fabre, St-Julien-en-Genevois, France
The h eterodimeric c ytokine composed ofthe soluble ciliary
neurotrophic factor receptor (sCNTFR) and the IL-6
family member cardiotrophin-like c ytokine (CLC) w as
recently identified as a new ligand for gp130–leukemia
inhibitory factor receptor (LIFR) complex [Plun-Favreau,
H., Elson, G., Chabbert, M., Froger, J., deLapeyriere, O.,
Lelievre, E., Guillet, C., Hermann, J., Gauchat, J. F.,
Gascan, H. & Chevalier, S. (2001) EMBO J. 20, 1692–
1703]. This heterodimer shows overlapping biological
properties with LIF. Although CLC contains a putative
signal peptide and therefore should enter into the classical
secretory pathway, the p rotein has been shown t o be
retained within transfected mammalian cells, unless coex-
pressed with either sCNTFR or cytokin e like factor ( CLF)
[Elson, G. C., Lelievre, E., Guillet, C., Chevalier, S., Plun-
Favreau, H., Froger, J., Suard, I ., de Co ignac, A. B.,
Delneste, Y., Bonnefoy, J. Y., Gauchat, J. F. & Gascan,
H. (2000) Nat. Neurosci. 3, 867–872]. In the present study,
we demonstrate t hat a fusionprotein comprising CLC
covalently coupled through a glycine/serine linker to
sCNTFR (CC–FP) is efficiently secreted from transfected
mammalian cells. CC–FP shows enhanced activities in
respect to the CLC/sCNTFR native complex, on a number
of cells expressing gp130 and LIFR on their surface. In
addition, CC–FP is able to compete with CNTF for cell
binding, indicating that b oth cytokines s hare binding
epitope(s) expressed by their receptor c omplex. Analysis of
the downstream signaling events revealed the recruitment
by CC–FP ofthe signal transducer and activator of tran-
scription (STAT)-3, Akt and mitoge n-activated protein
(MAP) kinase pathways. The monomeric bioactive CLC/
sCNTFR fusionprotein is therefore a powerful tool to
study the biological role o f the recently described c ytokine
CLC.
Keywords: C LC; s CNTFR; fusion protein.
Ciliary n eurotrophic f actor (CNTF) was named based on its
ability t o maintain t he survival of parasympathetic neurons
of chick ciliary ganglions [1,2]. Subsequent stud ies have
revealed that CNTF also enhances the survival of sensory
[3], motor [4], cerebellar and hippocampal neurons [5,6]. It
can also prevent lesion-induced degeneration of motor
neurons and s lows disease progression in mice with
inherited neuromuscular deficits [7–9]. CNTF is also known
to be a trophic factor for skeletal muscles [10,11].
CNTF belongs to a family of structurally related
cytokines t hat i ncludes leukemia i nhibitory factor (LIF),
interleukin-6 ( IL-6), interleukin-11 (IL-11), oncostatin M
(OSM), cardiotrophin-1 (CT-1) [12–14] and cardiotrophin-
like cytokine (CLC) [15,16]. These cytokines share one or
both ofthereceptor signal transducing subunits gp130 or
LIF rec eptor ( LIFR) i n t heir respe ctive rece ptor complexes
[17–20]. The functional CNTF r eceptor i s a ternary
complex, that in addition to gp130 and LIFR also includes
a specificity-determining binding component called CNTF
receptor (CNTFR) anchored to the membrane through a
glycosylphosphatidylinositol motif [21–25]. Binding of the
cytokine to the membrane-bound, nonsignaling a chain
(CNTFR; [21]), l eads to the recruitment of t he sha red
signaling subunits gp130 a nd the LIFR with the formation
of the high-affinity functional receptor complex [22,23]. The
subsequent s ignaling cascade implicates activation of the
Janus kinase 1 ( JAK1)/STAT3 pathway [26–30].
We recently identified a second ligand for the tripartite
CNTF receptor as a complex formed between the IL-6
family cytokine CLC (also known as novel neurotrophin-1/B
cell s timulatory factor-3) [15,16], and the soluble t ype-I
cytokine receptor CLF [31,32]. We initially observed that
CLC, although containing a signal peptide, was inefficiently
secreted when expres sed in mammalian cells. This secretion
could be induced upon coexpression with CLF, with the
two proteins forming a heterodimer (CLF/CLC). This
was the first demonstration of such a secretion mechanism
for a cytokineofthe IL-6 family and shares certain
similarities with the formation ofthe functional IL-12
heterodimer [33]. Like CNTF, CLF/CLC recruits cells
Correspondence to H. Gascan: INSERM U564, CHU d’Angers,
4 rue Larrey, 49033 Angers, France.
Fax: + 33 241 73 16 30, Tel.: + 33 241 35 47 29,
E-mail: hugues.gascan@univ-angers.fr or
J F. Gauchat Centre dı
´
Immunologie Pierre Fabre,
5 Avenue Napole
´
on III, 74164 St-Julien-en-Genevois, France.
Fax: + 33 450 35 35 90, Tel.: + 33 450 35 35 55,
E-mail: jean.francois.gauchat@pierre-fabre.com.
Abbreviations: sCNTFR, soluble ciliary neurotrophic factor receptor;
CLC, cardiotrophin-like cytokine; LIFR, leukemia inhibitory factor
receptor; CLF, cytokine like factor; IL, interleukin; MCS, multiple
cloning site; PVDF, poly(vinylidene difluoride); JAK, janus kinase.
*Presen t address: NovImmune, G eneva, Switzerland.
(Received 8 November 2001, accepted 20 February 2002)
Eur. J. Biochem. 269, 1932–1941 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02850.x
expressing on their surface the tripartite CNTF receptor,
induces the tyrosine phosphorylation of gp130, LIFR and
STAT3 in neuroblastoma cells and acts as a survival factor
for motor neurons cultured in vitro [32,34].
We subsequently observed that CLC could also form a
secreted compositecytokine when associated with
sCNTFR. Similarly to LIF, CLC/sCNTFR displays activ-
ities on cells which are negative for the expression of surface-
bound CNTFR, but expressing gp130 and LIFR [35].
The a ssociation of CLC w ith s CNTFR is similar t o
the situation reported previously for CNTF/sCNTFR,
IL-6/sIL-6R and IL-11/sIL-11R, w here composite cyto-
kines implicating a soluble r eceptor alpha component in
their structure display functional activities mediated
through the appropriate signaling subunits [23,36,37]. A
closely related situation also exists for the IL-12 and IL-23
heterodimeric cytokines, composed of an a-recep tor-like
chain (p40), respectively associated to p35 or p19 [33,38].
These studies revealed an interesting degree of binding
promiscuity between the IL-6 and IL-12-type ligands and
their multichain receptor complexes.
Previous studies have demonstrated that the addition of a
flexible glycine/serine link er between the two subunits of
such composite cytokines allows the expression of a single
chain fusionprotein retaining functional activity [38–41].
For example, a fusionprotein between IL-6 and soluble
IL-6R, and named ÔHyper IL-6Õ, was shown to be
functionally active in cells where IL-6 alone had no effect
(i.e. lacking the membrane-bound form of IL-6R) [39].
These designer molecules display an increased stability
compared with their respective composite cytokines pre-
sumably because thecytokine and its cognate a receptor
component are covalently associated, and both components
remain bound to the signaling receptor subunits for a longer
period of time.
In an attempt to f acilitate the func tional characterization
of the n ovel neurotrophic co mplex CLC/sCNTFR, we have
generated a soluble fusion protein. CLC is irreversibly
associated to its cognate receptor, the sCNTFR subunit, via
a 10-amino-acid glycine/serine linker. We demonstrate that
the CLC/sCNTFR fu sion protein is efficiently secreted from
transfected mammalian cells and is highly active on c ell
types expressing gp130 and LIFR on their s urface.
MATERIALS AND METHODS
Reagents
Human IL-2, CNTF and L IF were purch ased from R & D
Systems (Minneapolis, MN, USA). T he 4G10 monoclonal
anti-phosphotyrosine Ig was bought from Upstate Biotech-
nology (Lake Placid, NY, USA) and the 9E10 antic-myc
epitope mAb was obtained from the ATCC (Rockville,
MD, U SA). The antibody raised against STAT3 was
purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Antibodies detecting phospho-ERK1/ERK2, phospho-
STAT3 (Tyr705) and phospho-AKT were purchased from
New England Biolabs (Beverly, MA, USA). The monocl-
onal antibodies d irected against t he human forms of LIFR
(AN-E1, IgG1), gp130 (AN-HH1, IgG2a) and CNTFR
(AN-B2, AN-C2, IgG2a) were generated in t he laboratory
[35]. T he 4–68 monoclo nal anti-CNTF Ig was bought from
Roche diagnostics (Meylan, France).
Cell cultures
Ba/F3 cells modified to e xpress functional receptors for
LIF, CNTF or IL-6 were a kind gift from K. J. Kallen,
University of Kiel, Germany. Cells were grown in RPMI
1640 medium supplemented with 10% fetal bovine serum
and 5 ngÆmL
)1
recombinant LIF, CNTF or IL-6. HepG2
hepatoma cells, KB epidermoid c arcinoma, HEK 293 cells
and SK-N-GP neuroblastoma cells (ATCC, Rockville,
MD, USA) were maintained in RPMI 1640 supplemented
with 10% fetal bovine serum.
Construction of a single chain CLC/sCNTFR fusion
protein (CC–FP)
The cDNA encoding a soluble form of CNTFR (sCNTFR)
was amplified b y PCR using the primers 5¢-CCGGAATTC
GCCAGTGGTGAAGAGATG-3¢ and 5¢-CCGCTCGAG
GTCACAGATCTTCGTGGT-3¢, a nd cloned i nto the
EcoRI and XhoI restriction sites of pcDNA3. The oligonu-
cleotides encoding the (G
4
S)
2
flexible polypeptide 5¢-TCG
AAGGCGGAGGCGGGAGCGGCGGGGGCGGAAG
CGGAGGCGGGGGAAGCCTCGAGT-3¢ and 5¢-CTA
GACTCGAGGCTTCCCCCGCCTCCGCTTCCGCCCC
CGCCGCTCCCGCCTCCGCCT-3 ¢, w ere a nnealed and
cloned into the XhoIandXbaI restriction sites of the
afore mentioned pcDNA3 vector containing the sCNTFR
cDNA. T he cDNA encoding a derative of CLC containing
the c-myc epitope was amplified from CLC cDNA using the
primers 5¢-CCGCTCGAGCTCAATCGCACAGGGGAC
CC-3¢ and 5¢-CCGCTCGAGTCAGAGGTCCTCCTCG
GAGA-3¢ and cloned into pcDNA3 containing the mod-
ified sCNTFR cDNA.
Protein purification and Western blotting
HEK 293 cell line was stably transfected with pcDNA3
expression vector encoding CC–FP. Cell culture medium
containing CC–FP was concentrated approximately 10-fold
using Centricon-30 units (Millipore, Bedford, MA, USA)
and thefusionprotein subsequently purified by affinity
chromatography using an anti-(c-myc) Ig affinity matrix.
Bound protein was eluted with 100 m
M
Glycine-HCl
(pH 2 .75). A neutral pH was immediately restored using
1
M
Tris base. Protein concentrations were determined by
SDS/PAGE and silver staining using a BSA protein
standard. Western-blotting of CC–FP was performed after
SDS/PAGE and transfer onto a nylon membrane using a
peroxidase coupled anti-(c-myc) Ig.
Gel filtration
Sample containing CC–FP was fractionated on a Superose
12 size exclusion column. Fractions were then analysed by
Western-blotting as described before. Column calibration
was performed using standard purified proteins.
Protein modeling
CC–FP has been modeled from the molecular models of
CLC and CNTFR. CLC was modeled f rom residues 7 to
181 by homology with human CNTF (PDB accession
number 1CNT) [42] and with mouse LIF (PDB accession
Ó FEBS 2002 Bioactive CLC/sCNTFR fusionprotein (Eur. J. Biochem. 269) 1933
number 1LKI) [43], as described previously [35]. R esidues
1–286 of CNTFR were modeled by homology with gp130
(PDB accession numbers: 1BQU for the cytokine-binding
domain of gp130 and 1I1R for the Ig-like and the CBD
domains of gp130 i n the complex with v iral IL-6) [44,45]. A
flexible loop including the C-terminal part of CNTFR
(residues 287–316), the linker joining the t wo proteins
(LEGGGGSGGGGSLE) and the N-terminal part of CLC
(residues 1–6) was generated and refined by simulated
annealing. Computations were carried out with the model-
ing program
MODELER
Ò [46], as implemented in
INSIGHT
(MSI, San Diego, USA) on a SGI Octane workstation. The
quality ofthe model was checked with
PROFILE
3
D
[47].
Tyrosine phosphorylation analysis
After a 24-h serum s tarvation, cells were stimulated for
10 min in the presence ofthe indicated c ytokine. Cells were
lysed in 10 m
M
Tris/HCl pH 7.6, 5 m
M
EDTA, 50 m
M
NaCl, 30 m
M
sodium pyrophosphate, 50 m
M
sodium flu-
oride, 1 m
M
sodium orthovanadate, proteinase inhibitors
(1 lgÆmL
)1
pepstatin, 2 lgÆmL
)1
leupeptin, 5 lgÆmL
)1
aprotinin, 1 m
M
phenylmethanesulfonyl fluoride) and 1%
NP40 or Brij 96 depending on the experiments [35]. After
pelleting insoluble material and protein standardization, the
supernatants were immunoprecipitated overnight. The
complexes were t hen isolated w ith beads coupled to protein
A,submittedtoSDS/PAGEandtransferredontoan
Immobilon m embrane ( Millipore, Bedford, MA, U SA).
The membranes were subsequ ently incubated with t he
relevant primary antibody before being incubated with the
appropriate secondary antibody lab eled with peroxidase for
60 min. The r eaction was visualized on an X-ray film using
ECL reagents (Amersham, Les Ullis, France) according t o
the manufacturer’s instructions. In some experiments, the
membranes were stripped overnight in 0.1
M
glycine-HCl,
pH 2.7, and n eutralized in 1
M
Tris/HCl, pH 7.6, before
reblotting.
Cell proliferation assays
BAF GL (gp130, LIFR ), BAF G LC (gp130, LIFR,
CNTFR), BAF gp130/IL-6R or TF1 cells were seeded at
5 · 10
3
cellsÆwell
)1
(in 96-well plates) in RPMI 1 640 m edium
supplemented with 5% fetal bovine serum containing the
indicated amount of recombinant cytokine. Following a
72-h incubation period, a [
3
H]thymidine pulse was
performed for 4 h and t he incorporated radioactivity
determined as described previously [48].
KB cell IL-6 production assay
KB cells were plated in 96-well plates at a conce ntration o f
5 · 10
3
cells per well in culture medium containing serial
dilutions of recombinant c ytokines as indicated. After 4 8 h,
the supernatants were harvested, an d their IL-6 conten t
determined by ELISA as described previously [32].
Gene reporter assay
Transient transfection of KB cells were carried out in
24-well culture plates using t he lipid reagent Fugene 6 from
Roche Diagnostics. Cells were transfected with 300 ng
SIEM-luciferase reporter gene, as described p reviously [32].
Forty-eight hours a fter transfection, cells were incubated
with IL-2, LIF, CLC/sCNTFR or CC–FP for an additiona l
18 h . Transfected cells were washed with ice cold NaCl/P
i
,
and 100 lL of lysis buffer was added to the wells (0.1
M
KH
2
PO
4
,pH7.8,0.1%TritonX-100).Extractswerethen
used directly to measure the luciferase activity by integrating
total light emission over 10 s using a Packard Topcount
luminometer (Meriden, CT, USA). Luciferase activity was
normalized based on protein concentrations.
FACS analysis and cytokine displacement
BAF GLC and SK-N-GP cells were incubated in the
presence of increasing concentrations of putative competitor
(CC–FP, IL-11, IL-4) and a fixed amount ofCNTF (2 ng in
a20-lL final volume). After a 2-h incubation period, cells
were washed and i ncubated with the 4–68 monoclonal a nti
CNTF Ig, or with an IgG1 control antibody, for 30 min.
After washing, cells were fu rther incubated with a phy-
coerythrin-conjugated anti-(mouse IgG) I g. Fluorescence
was subsequently analyzed on a FACScan flow cytometer
from Becton & Dickinson (Mountain View, CA, U SA).
RESULTS
The bioactive designer cytokine hyper-IL-6 (H-IL-6) [39]
was used as a model to generate a functional CLC/
sCNTFR complex through monocistronic expression of a
CLC/sCNTFR fusionprotein (hereafter noted as CC–FP).
H-IL-6 is composed of a soluble form ofthe IL-6 receptor
(IL-6R) connected to the mature IL-6 protein via a flexible
polypeptide consisting ofthe glycine/serine linker (G
4
S)
2
.
The first 16 N -terminal amino acids of IL-6 are nonhelical
and therefore presumably flexible, thus contributing to the
connecting loop. As CNTFR share a high level of s equence
homology with IL-6R and CLC shares significant structural
homology with IL-6 [15,16], we hypothesized that sCNTFR
connected to CLC in a similar f ashion would also b e
functional. In contrast to the sIL-6R portion of H-IL-6, the
N-terminal signal peptide and Ig-like domain of t he
sCNTFR precursor protein were maintained in the fusion
protein with CLC in order to allow f or the secretion of the
protein in mammalian cells. A c-myc epitope tag was
introduced at the C-terminus ofthe f usion p rotein for
detection and purification purposes (Fig. 1A).
HEK 293 cells were stably transfected with an expres-
sion vector encoding thefusion protein. CC–FP was
purified from the culture supernatant to apparent homo-
geneity with an a nti-(c-myc) Ig affinity column (Fig. 1B,
left panel). SDS/PAGE analysis r evealed a single band
displaying an ap parent m olecular weight o f 85 kDa, which
was quantified based on known concentrations of BSA run
on neighboring lanes. W estern blotting was e mployed in
order to formally demonstrate that the detected single
chain fusionprotein effectively was the observed protein
(Fig. 1B, right panel).
To further check the integrity and folding ofthe protein,
CC–FP was immunoprecipitated with several monoclonal
anti-CNTFR Ig, submitted to SDS/PAGE and Western
blotted with an anti-(c-myc) Ig. As presented in Fig. 2A, the
mAbs used were able to recognize the protein, indicating
that the purified CC–FP was correctly folded.
1934 C. Guillet et al. (Eur. J. Biochem. 269) Ó FEBS 2002
To determine whether theprotein could self associate to
generate dimers, CC–FP was submitted to a gel filtration
size exclusion column. Fractions were then studied by
western-blotting using an anti-(c-myc) I g. The large major-
ity of CC–FP appeared in fraction 17 corresponding to a
molecular mass of 60–75 kDa (Fig. 2B). This result indi-
cates that CC–FP preferentially stays a s a monomer in
solution.
We then tried to determine a molecular model of CC–FP
according to the model of both proteins. The immunoglob-
ulin-like domain and the two cytokine b inding domains of
CNTFR are represented at the N-terminal side, followed by
a loop containing the glycine linker and, at the C-terminal
end, the fou r helices of CLC (Fig. 2C). In this model, the
putative sites of interaction o n CNTFR and CLC are
highlighted in green and red, r espectively.
The f unctional properties of CC–FP were tested in
proliferation a ssays using derivatives ofthe IL-3-dependent
Ba/F3 cell line, rendered responsive to cytokines of t he IL-6
family by transfection o f cDNAs e ncoding the appropriate
receptor chains [48]. The CC–FP complex induced a robust
proliferation of Ba/F3 ce lls expressing LIFR and gp130
(BAF GL), whereas the response observed in the presence
of the CLC/sCNTFR compositecytokine was 10-fold
weaker (Fig. 3A). T he specific activities were
5 · 10
6
UÆmg
)1
and 5 · 10
5
UÆmg
)1
, respectively. Higher
specific activities were observed when using the B AF GLC
cells as test cell line (Fig. 3B). This is likely to reflect the fact
that membrane bound CNTFR is more potent in mediating
CLC signaling than its soluble counterpart [34].
Similar experiments were carried out on Ba/F3 cells
expressing only gp130, or gp130 and IL-6R on their surface,
with no detectable signal being measured in response to
either the CLC/sCNTFR composite cytokine, or CC–FP
(Fig. 3C, and data not shown). This demonstrates an
absolute requirement for the LIFR subunit to mediate the
signaling response to CLC/sCNTFR or to CC–FP. The
involvement of gp130 in CC–FP signaling was further
confirmed by the inhibition ofthe BAF GLC proliferative
response following the addition to the culture of a neutral-
izing monoclonal anti-gp130 Ig (Fig. 3D).
We then tested thefusionprotein in a second functional
assay using the TF1 cell line. This is a human erythroleu-
kemia cell line known to coexpress LIFR and gp130 on its
membrane, but not CNTFR [23]. T he experiments per-
formed revealed a proliferative response to CC–FP similar
to that observed with LIF (Fig. 4A). Surprisingly, and i n a
reproducible manner, we failed to detect any functional
effect ofthe CLC/sCNTFR compositecytokine on TF1
cells. This was interpreted a s a weaker sensitivity of the
gp130–LIFR pathway in the TF1 cell line compared to
other LIF-sensitive c ell lines. In agreement with t his
observation, the LIF spe cific activity displayed in TF1
assay was 1.5 · 10
6
UÆmg
)1
whereas it is known to reach
4 · 10
7
UÆmg
)1
using mouse DA1.a cells [49]. T he CC–FP
fusion protein displayed a specific activity of 1 · 10
6
UÆmg
)1
in the TF1 erythroleukemia assay.
The KB carcinoma cell line, which expresses gp130 a nd
LIFR, h as been well characterized for its ability to produce
IL-6 in response to cytokines signaling via gp130 and LIFR,
such as LIF or OSM [32,50]. We therefore use d KB cells to
further characterize the functional activity of CC–FP. In
accordance with the results obtained in experiments using
transfected Ba/F3 cells and TF1 cells, w e found CC–FP to
be more potent than CLC/sCNTFR in inducing IL-6
production in KB cells (Fig. 4B).
Cytokines s ignaling t hrough gp130/LIFR can usually
compete, at least to some extent, for binding to the same
receptor complex [51,52]. We examined whether CC–FP
and CNTF could be mutually displaced from the cell
membrane. CNTF binding to BAF GLC and SK-N-GP
neuroblastoma cells was monitored by flow cytometry u sing
a mAb recognizing CNTF (Fig. 5A,B). Increasing concen-
trations of CC–FP were added with a fixed amount of
CNTF. A dose-dependent competition for receptor binding
was observed using CC–FP, whereas no displacement of
CNTF binding was observed with either IL-11 or IL-4 in
control experiments. These results show that CC–FP and
CNTF share binding epitope(s) expressed b y their receptor
complexes.
We next studied the induction of downstream signaling
components by the single chain fusionprotein following
receptor engagement. The ability of CC–FP to transduce a
signal in cells expressing on their s urface the functional L IF
receptor co mplex was subseq uently demonstrated. The role
of gp130 and LIFR as signaling components for CC–FP
was reinforced when analysing their tyrosine phosphoryla-
tion following activation by CC–FP in HepG2 hepatoma
Fig. 1. Generation of secreted CLC/sCNTFR fusion protein. (A)
Schematic representation ofthe CC–FP fusion protein. A cDNA
adaptor e ncoding a glycine/serine linker (GGGGS)
2
was p ositioned
between cDNA encoding the sCNTFR protein and CLC. sp, signal
peptide. (B) Detection of recombinant CC–FP purified from HEK 293
transfected cells. In the left panel, purified CC–FP was analyzed by
SDS/PAGE and silve r staining of th e gel using a BSA protein stan-
dard. In the right panel the presence of c-myc epitope-tagged proteins
(CLC/sCNTFR and CC–FP) was detected by Western blotting using
the anti-(c-myc) Ig.
Ó FEBS 2002 Bioactive CLC/sCNTFR fusionprotein (Eur. J. Biochem. 269) 1935
Fig. 2. Biochemical and structural characterization o f the CLC/sCNTFR fusion protein. (A) P urified CC–FP was immunoprecipitated w ith anti-
CNTFR I g (AN-B2, AN-C2), anti-(c-myc) Ig or control mAb as indicated, submitted to SDS/PAGE and Western blotting as described in F ig. 1 .
(B) CC–FP was submitted to a Superose 12 size exclusion column. Fractions were analysed by Western blotting using an anti-(c-myc) Ig. Column
calibration was performed using standard purified proteins. (C) Ribbon model of CC–FP: the immunoglobulin-like domain and the two cytokine
binding domains of CN TFR are link ed to the four h elices of CLC by a loop containing the glycine linker (cyan). The putative binding sites of
CNTFR and CLC a re highlighted in gr een and red, resp ectively.
Fig. 3. The CLC/sCNTFR fusionprotein induces the proliferation of transfected Ba/F3 cells. BAF GL (A) and BAF GLC (B) cells were cultured in
the presence of s erial dilutions of indicated re combinant cytokines. Proliferation was measured by [
3
H]thymidine incorporation and experiments
were performed in triplicate. Error bars represent the SEM. (C) BAF gp130/IL-6R cells were cultured in the presence of serial dilutions of
recombinant IL-6, CLC/sCNTFR, CC–FP or IL-2, as c ontro l. (D) Transfected Ba/F3 cells were incub ated in triplicate in culture medium alone
(marked as 0), o r containing 1 n gÆmL
)1
CNTF or CC–FP. T he AN-HH1 Ig (black bars) or a control IgG2a Ig (grey bars) was added at a final
concentration of 30 lgÆmL
)1
.
1936 C. Guillet et al. (Eur. J. Biochem. 269) Ó FEBS 2002
and i n SK-N-GP neuroblastoma cells. In response to
CC–FP, CLC/sCNTFR and LIF, a clear induction of
tyrosine phosphorylation was detected for gp130 and LIFR
(Fig. 6).
A similar result was also observed when analyzing the
activation levels of STAT3 in response t o CC–FP and
CNTF (Fig. 7A). The transcriptional activity o f STAT3
was measured in the KB ce ll line, w hich can e asily be
transfected in a transient manner. For this, cells were
transfected with a reporter construct containing two STAT3
consensus binding sites located upstream of a thymidine
kinase minimal p romoter [53]. Two days after transfection,
cells were serum starved and stimulated for an additional
15-h with 20 ngÆmL
)1
of the indicated cytokines. Whereas
the CLC/sCNTFR compositecytokine very weakly stimu-
lated STAT3 transcriptional activity, a twofold increase was
observed with both CC–FP and LIF (Fig. 7B). These results
indicate that CC–FP recruits STAT3 to a similar extent
than LIF, for both s ignaling and transcriptional activation
of target genes.
It has been p reviously reported that t he PI3-kinase/Akt
pathway could regulate gp130 signaling [34]. PI3-kinase
pathway recruitment by CC–FP led to a marked increase in
the tyrosine phosphorylation content of AKT (Fig. 8).
Comparable results were obtained when treating the cells
with CNTF or CLC/ sCNTFR. In addition to the PI3-
kinase/AKT and STAT3 activation pathways, LIFR/gp130
signaling is also kn own to implic ate the GRAB2/Sos
adaptators and regulate the MAP kinase pathway [54–56].
ERK1 and ERK2, involved in the MAP kinase pathway,
have been shown to play important roles in mediating the
Fig. 4. Proliferation ofthe TF1 cells and induction of IL-6 production in
KB cells by CC–FP. (A) TF1 cells were cultured in the presence of
serial dilutions o f p urified recombinant human LIF, CLC/sCNTFR,
CC–FP, or IL-2, as a control. Proliferation was measured by
[
3
H]thymidine incorporation and e xperiments were performe d i n
triplicate. (B) KB cells were exposed to serial dilutions of CLC/
sCNTFR, CC–FP, LIF or IL-2 as control. After a 48-h culture period,
the supernatants were analyzed by ELISA for their IL-6 content.
Experiments were performed in triplicate.
Fig. 5. CC–FP and CNTF compete for receptor complex binding. BAF
GLC and SK-N-GP cells were incubated with 2 ng CNTF and
increasing concentrations of CC–FP, IL-11 or IL-2. Detection of
CNTF binding was monitored by m easuring the mean fluorescence by
flow cytometry using an a nti-CNTF Ig.
Ó FEBS 2002 Bioactive CLC/sCNTFR fusionprotein (Eur. J. Biochem. 269) 1937
mitogenic effects of IL-6 family members. ERK1 and
ERK2 activation was determined b y measuring their
tyrosine phosphorylation levels. Stimulation o f the SK-N-
GP neuroblastoma cell line with C C–FP quickly increased
basal values (Fig. 8). These results demonstrate the involve-
ment ofthe PI3-kinase/AKT and MAP kinase signaling
pathways in functional responses to the CC–FP fusion
cytokine.
DISCUSSION
We have demonstrated that thefusionof CLC to the
C-terminus of sCNTFR via a flexible linker leads to the
generation of a bioactive fusion protein. Whereas CLC is
inefficiently secreted when expressed in the absence of CLF
or CNTFR [32,35], CC–FP i s e fficiently e xpressed a nd
secreted in mammalian cells.
Similar a pproaches have been successfully used to gener-
ate a number ofcomposite cytokines. The first described
example r eported the generation of a protein consisting of
IL-3fusedtoGM-CSF,whichdisplayedanincreased
activity when compared to the respective i ndividual cytokin-
es [57]. The discovery ofthecomposite n ature of IL-12,
encompassing a cytokine-like component (p35) associated to
Fig. 8. Analysis of AKT and ERK1, ERK2 tyrosine phosphorylation
induced by CC–FP. SK-N-GP cells were incubated either with or
without 5 0 ngÆmL
)1
of CNTF, CLC/sCNTFR and CC–FP for
10 m in. After l ysis in 1% N P-40, lysate s were s ubjected to i mmun oblot
analysis with antibodies specific for ac tivated AKT (AKT-P) or
recognizing activated forms o f ERK1 and ERK2 (ERK1-P and
ERK2-P).
Fig. 7. Analysis of STAT3 tyrosine phosphorylation and transcriptional
activation induced by CC–FP. (A) CC–FP induces STAT3 tyrosine
phosphorylation in SK-N-GP n euroblastoma and HepG2 cells. Fol-
lowing a 10-min exposure to either NaCl/P
i
(marked as 0), CNTF
(50 n gÆmL
)1
), CLC/sCNTFR (50 ngÆmL
)1
), or p urified CC –FP
(50 n gÆmL
)1
), cells were lysed a nd subject to Western blotting using an
anti-(STAT3-P) mAb. (B) Effect of CC–FP stimulation on STAT3
transcriptional activity. KB carcinoma cells were transiently trans-
fected with a reporter plasmid gene (SIEM-luciferase). 48 h later, cells
were treated with 20 ng ÆmL
)1
of LIF, CLC/sCN TFR, CC–FP or IL-2
as a control, for an additional 18 h. Cellular extracts were prepared
and used t o directly measure luciferase activity.
Fig. 6. Analysis of gp130 and LIFR t yrosine
phosphorylation i nduced by CC–FP. CC–FP
induces gp130 and LIFR t yrosine phospho-
rylation in SK-N-GP neuroblastoma and in
HepG2 cells. Following a 10-min exposure to
either NaCl/P
i
(marked as 0), LIF
(50 ngÆmL
)1
), CLC/sCNTFR (50 ngÆmL
)1
),
or purified CC–FP (50 ng ÆmL
)1
), cells were
lysed and subject to immunoprecipitation (IP)
using an anti-LIFR Ig an d Western blotting
(WB).
1938 C. Guillet et al. (Eur. J. Biochem. 269) Ó FEBS 2002
a soluble receptor-like subunit (p40), opened the possibility
of fusing the two components, or even adding an immuno-
globulin portion to fused IL-12 to reinforce the targeting of
the cytokine towards a defined cell type [41,58,59]. Designed
IL-12 fusion proteins do not display any increase in their
specific activity, when compared to the wild type protein.
This is in part explained by the fact that p35 and p40
components are already covalently a ssociated through a
disulfide bridge leading to a stable association.
Many examples ofcytokine receptors existing in soluble
form in vivo have been reported. Almost all o f these solu ble
receptors are able to interfere with the activity of their
ligands. An interesting feature ofthe a receptor components
belonging to the IL-6 family is their ability t o promote
the action of their ligands. These have been described in
detail for IL-6/IL-6R, CNTF/CNTFR and IL-11/IL-11R
[23,36,37]. For this cytokine family the ligand–receptor
interaction i s m ainly governed b y t he dissociation rate,
suggesting t hat the average half-life ofthe cytokine–solub le
receptor complex may be shorter than the time required to
recruit the larger signaling receptors, gp130, LIFR or
OSMR. Accordingly, fused proteins interacting with their
cognate receptor show a lower off-rate leading to a stronger
recruitment ofthe signaling subunits.
As the CC–FP fusionprotein represents an irreversibly
bound and therefore stabilized derivative of its respective
complex, it is noteworthy that CC–FP displays enhanced
biological activity relativ e to CLC/sCNTFR. On cells
expressing gp130 and LIFR, t he CC–FP fusion protein
was shown to be 10- to 100-fold more poten t w hen compared
to the unlinked composite cytokine. This result corroborates
previous studies showing that single-chain fusion proteins
between cytokines and their nonsign aling binding receptors
exhibit enhanced functional activity with respect to their
native cytokine/receptor complexes [39,60–63].
In the p resent study we analyzed the proliferative
potential of CC–FP in cells displaying a hematopoietic
background (TF1 and Ba/F3 cells). CC–FP also activates
these cells by increasing their t ranscriptional m achinery
leading to specific protein synthesis, such as acute phase
protein synthesis for hepatocytes [64], or IL-6 production in
the case ofthe KB e pidermoid carcinoma [50]. Collectively,
these results support t he idea that CC–FP should be able to
substitute for LIF in a large number of situations. It is worth
underlining t he synergistic potential of gp130 activating
cytokines together with SCF, GM-CSF and erythropoie-
tin in increasing the maintenance and proliferation of
CD34+CD38– or CD34+Thy1+ hematopoietic stem
cells in vitro [65,66]. Therefore, the involvement of CC–FP
in hematopoietic stem cell expansion is currently under
investigation.
CNTF promotes the differentiation and s urvival of a
wide range of cell t ypes in the nervous system [1–6]. We can
therefore assume t hat composite C LC-containing cytokines
will display overlapping functions. A lthough CLC uses th e
same functional receptor as CNTF, it differs from the latter
in that it is apparently naturally secreted under nontrau-
matic conditions [32,35]. Recent studies reported the
possibility of expanding human central nervous system
stem cells by in v itro growth [67,68]. D eveloped cultures can
continuously propagate a heterogeneous population of
early neural stem and/or progenitor cells. E xperiments have
been carried out with neurosphere c ultures, requiring a
cocktail of cytokines. Among them, L IF was shown to p lay
an important role for correct culture d evelopment. The
availability of a CLC/sCNTFR fusionprotein using the
LIF signaling receptor complex should b e of g reat interest in
this context.
Due to its neuroprotective effects, much investigation has
been made in to the potential utility o f CNTF i n the
treatment of neurodegenerative disorders such as a myo-
trophic lateral sclerosis and Huntington’s disease. Indeed,
promising preclinical studies have led to clinical trials with
varying success [69–72]. The high level of toxicity upon
systemic injection ofthe prote in has led to t he targeted
administration ofCNTF to the CNS via i ntrathecal
implantation of encapsulated transfected cells. For this
reason, similar studies should be performed to determine the
ability of CLC/sCNTFR to convey neuroprotective effects
whilst assessing its toxicity. The availability of a monomeric
bioactive CC–FP fusionprotein should t herefore allow the
production of sufficient purified protein and facilitate the
generation of stable transfected cell lines and vectors for
alternative gene therapy approaches.
ACKNOWLEDGEMENTS
He
`
le
`
ne Plun-Favreau and Catherine Guillet were funded by grants
from the city of Angers and the Departement du Maine et Loire,
respectively. The project w as supported b y a grant from the Association
Franc¸ aise contre les Myopathies.
REFERENCES
1. Stockli, K.A., Lottspeich, F., Sendtner, M., Masiakowski, P.,
Carroll, P., Gotz, R., Lindholm, D. & Thoenen, H . (1989)
Molecular cloning, expression and regional distribution of rat
ciliary neurotrophic factor. Nature 342, 9 20–923.
2. Lin, L.F., Mismer, D., Lile, J.D., Armes, L.G., B utler, E.T., 3rd,
Vannice, J.L. & Collins, F. (1989) Purification, cloning, and
expression of ciliary neurotrophic factor (CNTF). Science 246,
1023–1025.
3. Simon, R., Thier, M ., Kruttgen, A., Rose-John, S., W eiergrabe r,
O., Heinrich, P.C., Schroder, J.M. & Weis, J. (1995) Human
CNTF and related cy tokines: effe cts on DRG n eurone surviv al.
Neuroreport 7, 153–157.
4. Oppenheim, R.W., Prevette, D., Yin, Q.W., Collins, F. &
MacDonald, J. (1991) Control of embryonic motoneuron survival
in vivo by ciliary neurotrophic factor . Science 251, 1616–1618.
5. Larkfors, L., Lindsay, R.M. & Alderson, R.F. (1994) Ciliary
neurotrophic factor enhances the survival of Purkinje cells in vitro.
Eur. J. Neurosci. 6, 1015–1025.
6. Ip, N.Y., Li, Y.P., van de Stadt, I., Panayotatos, N ., Alderson,
R.F. & Lindsay, R.M. (1991) Ciliary neurotrophic factor
enhances neuronal s urvival in emb ryonic rat h ippocamp al
cultures. J. Neurosci. 11, 3 124–3134.
7. Sendtner, M., Gotz, R., Holtmann, B. & Thoenen, H. (1997)
Endogenous ciliary neurotroph ic factor is a lesion factor for
axotomized motoneurons in adult mice. J. Neurosci. 17 ,
6999–7006.
8. Sendtner, M., Schmalbruch, H., Stockli, K.A., Carroll, P.,
Kreutzberg, G.W. & Thoenen, H. (1992) Ciliary neurotrophic
factor preve nts degeneration o f motor neurons in mouse mutant
progressive motor neuronopathy. Nature 358, 502–504.
9. Mitsumoto, H., Ikeda, K., Klinkosz, B., C e darbaum, J.M.,
Wong, V. & Lindsay, R.M. (1994) Arrest of motor neuron disease
in wobbler mice cotreated with CNTF and BDNF. Science 265 ,
1107–1110.
Ó FEBS 2002 Bioactive CLC/sCNTFR fusionprotein (Eur. J. Biochem. 269) 1939
10. Helgren, M.E., Squinto, S.P., Davis, H.L., Parry, D.J., Boulton,
T.G., Heck, C.S., Zhu, Y., Yancopoulos, G.D., Lindsay, R.M. &
DiStefano, P.S. (1994) T rophic effec t of ciliary n eurotrophic facto r
on denervated skeletal muscle. Cell 76, 493–504.
11. Guillet, C., Auguste, P., Mayo, W., Kreher, P. & Gascan, H.
(1999) Ciliary neurotrophic factor is a regulator of muscular
strength in aging. J. Neurosci. 19, 1257–1262.
12. Heinrich, P.C., Behrmann, I., Muller-Newen, G., Schaper, F. &
Graeve, L. (1998) Interleukin-6-type cytokine signalling through
the gp130/Jak/STAT pathway. Biochem. J. 334 , 297–314.
13. Bravo, J. & Heath, J.K. (2000) Receptor recognition by gp130
cytokines. EMBO J. 19, 2399–2411.
14. Bazan, J.F. (1991) Neuropoietic cytokines in the hematopoietic
fold. Neuron 7, 197–208.
15. Shi, Y., Wang, W., Yourey, P.A., Gohari, S., Zukauskas, D.,
Zhang, J., Ruben, S. & Alderson, R.F. (1999) Computational
EST database analysis identifies a novel member ofthe neuro-
poietic cytokine family. Biochem. Biophys. Res. Commun. 262,
132–138.
16. Senaldi,G.,Varnum,B.C.,Sarmiento,U.,Starnes,C.,Lile,J.,
Scully, S., Guo, J., E lliott, G ., McNinch, J., S haklee, C.L. et al.
(1999) Novel neurotrophin-1/B cell-stimulating factor-3:
a cytokineofthe IL-6 family. Proc. Natl Acad. Sci. USA 96,
11458–11463.
17. Hibi, M., Murakami, M., Saito, M., Hirano, T., Taga, T. &
Kishimoto, T. (1990) Molecular cloning and expression of an IL-6
signal transducer, gp130. Cell 63, 1149–1157.
18. Gearing, D.P., T hut, C.J., VandeBos, T., Gimpel, S.D.,
Delaney,P.B.,King,J.,Price,V.,Cosman,D.&Beckmann,
M.P. (1991) Leuk emia inhibitory factor receptor is structur ally
related to the IL-6 signal transducer, g p130. EMBO J. 10,
2839–2848.
19. Gearing , D.P., Comeau, M.R., F riend, D.J., Gimpel, S.D.,
Thut, C.J., McGourty, J., Brasher, K.K., King, J.A., Gillis, S.,
Mosley, B. et al. (1992) The IL-6 signal transducer, gp130: an
oncostatin M receptor and affinity con verter for the LIF receptor.
Science 255, 1 434–1437.
20. Murakami, M ., Hibi, M., Nakagawa, N., Nakagawa, T.,
Yasukawa,K.,Yamanishi,K.,Taga,T.&Kishimoto,T.(1993)
IL-6-induced homodimerization of gp130 and associated a ctiva-
tion of a tyrosine kinase. Science 260 , 1808–1810.
21. Davis, S., A ldrich, T.H., Valenzuela, D.M., Wong, V.V., Furth,
M.E., Squinto, S.P. & Yancopoulos, G.D. (1991) The r eceptor for
ciliary neurotrophic factor. Science 253, 59–63.
22. Davis, S., Aldrich, T.H., Stahl, N., Pan, L., Taga, T., Kishimoto,
T., Ip, N.Y. & Yancopoulos, G.D. (1993) LIFR beta and gp130 as
heterodimerizing signal transducers ofthe tripartite CNTF
receptor. Science 260, 1805–1808.
23. Davis, S., Aldrich, T.H., Ip, N.Y., Stahl, N., Scherer, S.,
Farruggella, T., DiSt efano, P.S., C urtis, R., Panayotatos, N.,
Gascan, H. et al. (1993) Released form of CNT F receptor alpha
component as a soluble mediator ofCNTF responses. Science 259,
1736–1739.
24. Baumann, H., Ziegler, S.F., Mosley, B ., Morella, K.K., Pajovic, S.
& Gearing, D .P. ( 1993) Re constitut ion ofthe response to l euke mia
inhibitory factor, oncostatin M, and ciliary neurotrophic factor in
hepatoma cells. J. Biol. Chem. 268, 8 414–8417.
25. Gearing, D.P., Ziegler, S.F., Comeau, M.R., Friend, D ., Thoma,
B., Cosman, D., Park, L. & Mosley, B. (1994) Proliferative
responses and binding propertie s of hemato poietic cells trans-
fected with low-affinity receptors for leukemia inhibitory factor,
oncostatin M, and ciliary neurotrophic factor. Proc. N atl Acad.
Sci. USA 91, 1 119–1123.
26. Stahl, N., Boulton, T.G., Farruggella, T., Ip, N.Y., Davis, S.,
Witthuhn, B.A., Quelle, F.W., Silvennoinen, O., Barbieri, G.,
Pellegrini, S. et al. (1994) Association and activation of Jak-Tyk
kinases by C NTF-LIF-OSM-IL-6 beta receptor components.
Science 263, 9 2–95.
27. Stahl, N., F arruggella, T.J., Boulton, T.G., Zhong, Z., Darnell,
J.E. Jr & Yancopoulos, G.D. (1995) Choice o f STATs and other
substrates specified by modular tyrosine-based motifs in cytokine
receptors. Science 267, 1349–1353.
28. Lutticke n, C., Wegenka, U.M., Yuan, J., Buschmann, J.,
Schindler, C., Ziemiecki, A ., Harpur, A.G., Wilks, A.F., Yasuk-
awa, K., Taga, T. et al. (1994) Association of transcription factor
APRF and protein k inase Jak1 wit h the interleukin-6 signal
transducer gp130. Science 263 , 89–92.
29. Narazaki, M., Witthuhn, B.A., Yoshida, K., Silvennoinen, O.,
Yasukawa, K., I hle, J .N., Kishimoto, T. & Taga, T. (1994)
Activation of JAK2 kinase mediated by the interleukin 6
signal transducer gp130. Proc.NatlAcad.Sci.USA91, 2285–
2289.
30. Guschin, D., Rogers, N ., Briscoe, J., Witth uhn , B ., Watling, D.,
Horn, F., Pellegrini, S., Y asukawa, K., Heinrich, P., Stark, G.R.
et a l. (1995) A major role for theprotein tyrosine kinase JAK1 in
the JAK/STAT signal transduction pathway in response t o in-
terleukin-6. EMBO J. 14 , 1421–1429.
31. Elson, G.C., Graber, P., Losberger, C., Herren, S., Gretener, D.,
Menoud, L.N., Wells, T .N., Kosco-V ilbois, M.H. & Gauchat, J.F.
(1998) Cytokine-like factor-1, a n ovel soluble protein, shares
homology with members ofthecytokine type I receptor family.
J. Immunol. 161, 1 371–1379.
32. Elson, G.C., Lelievre, E., Guillet, C., Chevalier, S., Plun-Favreau,
H.,Froger,J.,Suard,I.,deCoignac,A.B.,Delneste,Y.,Bonne-
foy, J.Y., Gauchat, J.F. & Gascan, H. (2000) CLF associates with
CLC to form a functional heteromeric ligand for the CNTF
receptor complex . Nat. Neurosci. 3, 867–872.
33. Trinchieri, G . (1995) Interleukin-12: a proinflammatory cytokine
with immunoregulatory functions that bridge innate resistance
and antigen-specific adaptive i mmunity. Annu . Rev. Immunol. 13,
251–276.
34. Lelievre, E., P lun-Favreau, H., C hevalier, S., Froger, J., Guillet,
C., Elson, G.C., Gauchat, J.F. & Gascan, H. (2001) Signaling
pathways recruited b y t he c ardiotrop hin-like c ytokine/cytokine -
like f actor-1 co mposite cytokine. s pecific re quirement of the
membrane-bound form of ciliary neurotrophic factor receptor
alpha component. J. Biol. Chem. 276, 22476–22484.
35. Plun-Favreau , H., E lson, G ., C habbe rt, M ., F roger, J .,
deLapeyriere, O., Lelievre, E., Guillet, C., Hermann, J., Gauchat,
J.F., G ascan, H. & C hevalier, S. (2001) T he ciliary neurotrophic
factor receptor alp ha c omp onent in duces the secretion of and is
required for fun ctional responses to c ardio trophin-like c ytokine.
EMBO J. 20 , 1692–1703.
36. Peters, M., Muller, A.M. & Rose-John, S. (1998) Interleukin-6
and soluble interleukin-6 receptor: direct stimulation of gp130 and
hematopoiesis. Blood 92 , 3495–3504.
37. Karow, J., H udson, K.R., Hall, M.A., Vernallis, A.B., Taylor,
J.A., G ossler, A. & Heath, J.K. (1996) Mediation of interleukin-
11-dependent biological responses by a s oluble form ofthe inte r-
leukin-11 r eceptor. Biochem. J. 318, 489–495.
38. Oppmann,B.,Lesley,R.,Blom,B.,Timans,J.C.,Xu,Y.,Hunte,
B. & Vega, F., Yu, N., Wang, J., Singh, K. et al. (2000) Novel p19
protein engages IL-12p40 t o form a cytokine, IL-23, with biolo-
gical activities similar as well as distinct from IL-12. Immunity 13,
715–725.
39. Fischer, M., Goldschmitt, J., Peschel, C., Brakenhoff, J.P., Kallen,
K.J., Wollmer, A., Grotzing er, J. & R ose-John, S . (1997 ) I. A
bioactive designer c yt okine for human hematopoietic progenit or
cell ex pansion. Na t. Biotechnol. 15, 1 42–145.
40. Pflanz, S., T acken, I., G rotzinger, J., Jacques, Y., Minvielle, S.,
Dahmen, H., He inrich, P.C. & Muller-New en, G. ( 1999) A fusion
protein of interleukin-11 and soluble interleukin-11 receptor acts
1940 C. Guillet et al. (Eur. J. Biochem. 269) Ó FEBS 2002
as a superagonist on cells expressing gp130. FEBS Lett. 450, 117–
122.
41. Lieschke, G.J., Rao, P.K., Gately, M.K. & Mulligan, R.C. (1997)
Bioactive murine and human interleukin-12 fusion proteins which
retain antitumor a ctivity in vivo. Nat. Bio technol. 15, 35–40.
42. McDonald, N .Q., P anayotatos, N. & H endrickson, W.A . (1995 )
Crystal structure of dimeric human ciliary neurotrophic factor
determined by MAD phasing. EMB O J. 14, 2 689–2699.
43. Robinson , R.C., Grey, L.M., Staunton, D., Vankelecom, H.,
Vernallis, A.B., Moreau, J.F., Stuar t, D.I., Heath, J.K. & Jones,
E.Y. (1994) The crystal structure and biological f unction o f leu-
kemia inhibitory factor: implications for receptor binding. Cell 77,
1101–1116.
44. Bravo, J., Staunton, D., Heath, J.K. & Jones, E.Y. (1998) Crystal
structure of a cytokine-binding region of gp 130. EMBO J. 17,
1665–1674.
45. Chow,D.,He,X.,Snow,A.L.,Rose-John,S.&Garcia,K.C.
(2001) Structure of an extracellular gp130 cytokine rec eptor sig-
naling complex. Sc ience 291, 2150–2155.
46. Sali, A. & B lundell, T.L. (1993) Comparative protein modelling by
satisfaction of spatial r estraints. J. Mol. Biol. 234 , 779–815.
47. Luthy, R., Bowie, J.U. & Eisenberg, D. (1992) Assessment of
protein models with three-dimensional profiles. Natu re 356, 8 3–85.
48. Kallen, K.J., Grotzinger, J., Lelievre, E., Vollmer, P., Aasland, D.,
Renne, C., M ullbe rg, J., M ye r zum Buschenfelde, K.H., Gascan ,
H. & Rose-John, S. ( 1999) Receptor re cognitio n sites of cytokines
are organized as exchangeable modules. Transfer ofthe l eukemia
inhibitory factor receptor-binding site from ciliary neurotrophic
factor to interleukin-6. J. Biol. Chem. 274, 11859–11867.
49. Gascan, H., Godard, A., Ferenz, C., Naulet, J., Praloran, V.,
Peyrat, M.A., Hewick, R., Jacques, Y., Moreau, J.F. & Soulillou,
J.P. (1989) Characterization and NH
2
-terminal amino a cid
sequence of natural human interleukin for DA cells: leukemia
inhibitory factor. Differentiation i nhibitory activity s ecreted by a T
lymphoma cell line. J. Biol. Chem. 26 4 , 21509–21515.
50. Thoma,B.,Bird,T.A.,Friend,D.J.,Gearing,D.P.&Dower,S.K.
(1994) Onc ostatin M and leukemia inhibitory f actor trigger
overlapping and different signals through partially shared receptor
complexes. J. Biol. Chem. 269 , 6215–6222.
51. Robledo, O., Auguste, P., Coupey, L., Praloran, V., Chevalier, S.,
Pouplard, A. & Gascan, H . (1996) B inding interactions of leuke-
mia inhibitory factor and ciliary neurotrophic factor with the
different subunits of their high affinity receptors. J Neurochem. 66,
1391–1399.
52. Robledo, O., Fourcin, M., Chevalier, S., Guillet, C., Auguste, P.,
Pouplard-Barthelaix, A., P ennica, D. & Gascan, H. (1997) Sig-
naling ofthe cardiotrophin-1 receptor. E vidence for a third
receptor component . J. Biol. C hem. 272, 4855–4863.
53. Coqueret, O. & Gascan, H. (2000) Functional interaction of
STAT3 tran scription factor with the cell c ycle in hibitor
p21WAF1/CIP1/SDI1. J. Biol. Chem. 275 , 18794–18800.
54. Boulton, T.G., Stahl, N. & Yancopoulos, G.D. (1994) Ciliary
neurotrophic factor/leukemia inhibitory factor/interleukin 6/
oncostatin M family of c ytokines induces tyro sin e phosphorylation
of a common set of proteins ov erlapping those induced by other
cytokines and growth factors. J. Biol. Chem. 269, 11648–11655.
55. Kim, H. & Baumann, H. (1999) Dual signaling role of t he protein
tyrosine phosphatase SHP-2 in regulating expression of acute-
phase plasma proteins b y interleuk in-6 cytokin e receptors in
hepatic c ells. Mol. Cell. Biol. 19, 5326–5338.
56. Takahashi-Tezuka, M., Yoshida, Y., Fukada, T., Ohtani, T.,
Yamanaka, Y., Nishida, K., Nakajima, K., Hibi, M. & Hirano, T.
(1998) Gab1 acts as an adapter molecule linking the cytokine
receptor gp130 to E RK mitogen-activated protein kinase. Mol.
Cell. Biol. 18 , 4109–4117.
57. Curtis,B.M.,Williams,D.E.,Broxmeyer,H.E.,Dunn,J.,Farrah,
T., Jeffery, E., Cle venger, W., de Roos, P., Martin, U., Friend, D.
et al. (1991) Enhanced hematopoietic activity of a human g ranu-
locyte/macrophage colony-stimulating factor-interleukin 3 f usion
protein. Proc. Natl Acad. Sci. USA 88, 5809–5813.
58. Lode, H.N., Dreier, T., Xiang, R., Varki, N.M., Kang, A .S. &
Reisfeld, R.A. (1998) Gene therapy with a single chain interleukin
12 fu sion protein induces T cell-dependent protective im munity in
a syngeneic model of murine ne uroblastoma. Proc.NatlAcad.Sci.
USA 95, 2475–2480.
59. Peng, L.S., Penichet, M .L. & Morrison, S.L. (1999) A single-chain
IL-12 IgG3 a ntib ody f usion p ro tein retains antibody specificity
and IL-12 bioac tivity and demonstrates antitumor activity.
J. Immunol. 16 3 , 250–258.
60. Oh,J.W.,VanWagoner,N.J.,Rose-John,S.&Benveniste,E.N.
(1998) Role of IL-6 and the soluble IL-6 recept or in inhibition of
VCAM-1 gene expression. J. Immunol. 161, 4992–4999.
61. Peters, M., Blinn , G., Solem , F., Fischer, M., Meyer zum Bus-
chenfelde, K.H. & Rose-John, S . (1998) In vivo and in vi tr o
activities ofthe gp130-stimulating designer cytokine Hyper-IL-6.
J. Immunol. 16 1 , 3575–3581.
62. Rakemann, T., N iehof, M., Kubicka, S., Fischer, M., Manns, M .P.,
Rose-John, S. & Trautwein, C. (1999) The designer cytokine
hyper-interleukin-6 is a potent a ct ivator of STAT3-dependent
gene transcription in vivo and in vitro. J. Biol. Chem. 274, 1257–
1266.
63. Igaz, P., Horvath, A., Horvath, B., Szalai, C., P allinger, E.,
Rajnavolgyi, E., Toth, S., Rose-John, S . & Falus, A. (2000)
Soluble interleuk in-6 rec eptor (sIL -6R) makes I L-6R ne gative T
cell line respond t o IL-6; it inhibits TNF production. Immunol.
Lett. 71, 1 43–148.
64. Lai, C.F., Ripperger, J., Morella, K.K., Wang, Y., Gearing, D.P.,
Fey, G.H. & Baumann, H. (1995) Separate signaling mechanisms
are involved i n t he co ntrol of STAT protein activation and g ene
regulation via the interleukin 6 response element by the box 3
motif of g p130. J. Biol. C hem. 270, 14847–14850.
65. Shih, C.C., Hu, M.C., Hu, J., Medeiros, J. & Forman, S.J. (1999)
Long-term ex vivo maintenance and expansion of t ransplantable
human hematopoietic stem c ells. Blood 94 , 1623–1636.
66. Galy, A.H., Cen, D ., Travis, M., Chen, S. & Chen, B.P. (1995)
Delineation of T-progenitor cell acti vity within the CD34+
compartment o f adult bo ne marrow. Blood 85, 2770–2778.
67. Uchida, N., Buck, D.W., He, D., Reitsma, M.J., Masek, M.,
Phan, T.V., Tsukamoto, A.S., G age, F.H. & Weissman, I.L.
(2000) Direct isolation of human c entral nervous system stem ce lls.
Proc. Natl Acad. Sci. USA 97 , 14720–14725.
68. McKay, R. (1997) Stem cells in the central nervous system. Science
276, 66–71.
69. Miller, R.G., Petajan, J.H., Bryan, W.W., Armon, C ., Barohn,
R.J., Goodpasture, J.C., Hoagland, R.J., Parry, G.J., Ross, M.A.
& Stromatt, S.C. (1996) A placeb o-controlled trial of recombinant
human c iliary neurotrophic (rh CNTF) factor in am yotrop hic
lateral sclerosis. rhCNTF ALS Study Group. Ann. Neurol. 39,
256–260.
70. Penn, R.D., Kroin, J.S., York, M.M. & Cedar baum, J.M. (1997)
Intrathecal ciliary neurotrophic factor delivery for treatment of
amyotrophic lateral sclerosis (phase I trial). Neurosurgery 40 ,
94–100.
71. Aebischer, P., Schluep, M., Deglon, N., Joseph, J.M., Hirt, L.,
Heyd, B., Goddard, M., Hammang, J.P., Zurn, A.D., Kato, A.C.,
Regli, F. & Baetge, E.E. (1996) Intrathecal delivery of CNTF
using encapsulated genetically modified xenogeneic cells in
amyotroph ic lateral sclerosis patients. Nat. Med. 2, 696–699.
72. Mittoux, V., Joseph, J.M., Conde, F., Palfi, S., Dautry, C., Poyot ,
T., Bloch, J., Deglon, N., Ouary, S., Nimchinsky, E.A., Brouillet,
E., Hof, P.R., Peschanski, M., Aebischer, P. & Hantraye, P. (2000)
Restoration of cognitive and motor functions b y ciliary neuro-
trophic factor in a primate mod el of Hu ntingto n’s disease. Hu m.
Gene. Ther. 11, 1177–1187.
Ó FEBS 2002 Bioactive CLC/sCNTFR fusionprotein (Eur. J. Biochem. 269) 1941
. Functionally active fusion protein of the novel composite cytokine
CLC/soluble CNTF receptor
Catherine Guillet
1
, Eric Lelie
`
vre
1
,He
´
le
`
ne. have demonstrated that the fusion of CLC to the
C-terminus of sCNTFR via a flexible linker leads to the
generation of a bioactive fusion protein. Whereas CLC