Báo cáo khoa học: Outer sphere mutagenesis of Lactobacillus plantarum manganese catalase disrupts the cluster core pptx

Eur J Biochem 270, 1102–1116 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03459.x Outer sphere mutagenesis of Lactobacillus plantarum manganese catalase disrupts the cluster core Mechanistic implications Mei M Whittaker1, Vladimir V Barynin2,3, Takao Igarashi1 and James W Whittaker1 Department of Environmental and Biomolecular Systems, OGI School of Science and Engineering at OHSU, Oregon; The Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield; The Institute of Crystallography, Russian Academy of Sciences, Moscow, Russia X-ray crystallography of the nonheme manganese catalase from Lactobacillus plantarum (LPC) [Barynin, V.V., Whittaker, M.M., Antonyuk, S.V., Lamzin, V.S., Harrison, P.M., Artymiuk, P.J & Whittaker, J.W (2001) Structure 9, 725–738] has revealed the structure of the dimanganese redox cluster together with its protein environment The oxidized [Mn(III)Mn(III)] cluster is bridged by two solvent molecules (oxo and hydroxo, respectively) together with a l1,3 bridging glutamate carboxylate and is embedded in a web of hydrogen bonds involving an outer sphere tyrosine residue (Tyr42) A novel homologous expression system has been developed for production of active recombinant LPC and Tyr42 has been replaced by phenylalanine using sitedirected mutagenesis Spectroscopic and structural studies indicate that disruption of the hydrogen-bonded web significantly perturbs the active site in Y42F LPC, breaking one of the solvent bridges and generating an ÔopenÕ form of the dimanganese cluster Two of the metal ligands adopt alternate conformations in the crystal structure, both conformers having a broken solvent bridge in the dimanganese core The oxidized Y42F LPC exhibits strong optical absorption characteristic of high spin Mn(III) in low symmetry and lower coordination number MCD and EPR measurements provide complementary information defining a ferromagnetically coupled electronic ground state for a cluster containing a single solvent bridge, in contrast to the diamagnetic ground state found for the native cluster containing a pair of solvent bridges Y42F LPC has less than 5% of the catalase activity and much higher Km for H2O2 (%1.4 M) at neutral pH than WT LPC, although the activity is slightly restored at high pH where the cluster is converted to a diamagnetic form These studies provide new insight into the contribution of the outer sphere tyrosine to the stability of the dimanganese cluster and the role of the solvent bridges in catalysis by dimanganese catalases Catalases (E.C 1.11.1.6) are antioxidant defence enzymes that catalyze the redox disproportionation of the toxic oxygen metabolite, hydrogen peroxide, into dioxygen and water [1] Two distinct families of catalases are known, differing in both the architecture of the folded protein and in the nature of the catalytic redox cofactor, heme iron or nonheme manganese While the heme-containing catalase family has been well characterized both structurally [2,3] and biochemically [4], the alternative, nonheme dimanganese catalases or ÔpseudocatalasesÕ are less extensively studied, although they appear to be widespread among prokaryotes Manganese catalases have been isolated from bacteria (Thermus thermophilus [5], Thermoleophilum album [6], and Lactobacillus plantarum [7,8]) and a hyperthermophilic archeon (Pyrobaculum caldifontis [9]) X-ray crystal structures have been reported recently for the enzymes from T thermophilus (TTC) [10] and L plantarum (LPC) [11] Both enzymes are hexamers of identical subunits organized around a catalytic core of close-packed fourhelix bundle domains Each of these coiled-coil domains binds two manganese ions forming novel redox-active binuclear manganese complexes that serve as the catalytic active sites The dimanganese complexes of LPC and TTC are templated by their environment in the protein, being bound by five amino acid side chains arising within the four-helix bundles (Fig 1) A l1,3-bridging glutamate carboxylate (Glu66, LPC numbering) anchors the two ions in the binuclear cluster (Fig 2) Each Mn ion is further coordinated by one histidine (His69 to Mn1 and His181 to Mn2) and one glutamate (Glu35 to Mn1 and Glu148 to Mn2) bound to opposite faces of the cluster, and the manganese core is completed by two solvent-derived l1,1 Correspondence to J W Whittaker, Department of Environmental and Biomolecular Systems, OGI School of Science and Engineering at OHSU, 20000 NW Walker Road, Beaverton, Oregon 97006 Fax: + 503 748 1464; Tel.: + 503 748 1065; E-mail: jim@bmb.ogi.edu Abbreviations: LPC, Lactobacillus plantarum manganese catalase; TTC, Thermus thermophilus manganese catalase; LT-MCD, low temperature magnetic circular dichroism; MCD, magnetic circular dichroism; MPD, 2-methyl-2,4-pentanediol; ABS, optical absorption Enzyme: catalases (E.C 1.11.1.6) Note: Atomic coordinates for Y42F and Lactobacillus plantarum manganese catalase have been deposited in the Protein Data Bank (accession number, 1O9I) (Received 24 September 2002, revised 15 December 2002, accepted 10 January 2003) Keywords: manganese; redox; catalase; spectroscopy; X-ray structure Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur J Biochem 270) 1103 Fig Subunit structure for Lactobacillus plantarum manganese catalase The ribbon diagram (left) illustrates the organization of a single subunit from the hexameric protein Secondary structural elements are color-coded: a-helix (magenta); b-sheet (yellow) The dimanganese catalytic core (cyan) is embedded in the center of a coiled-coil a-helical domain (Right) Stereoview of dimanganese active site embedded in the interior of the four-helix bundle catalytic domain (Based on PDB ID 1JKU) Rendered using MIDASPLUS [12] Fig The active site of Lactobacillus plantarum manganese catalase Manganese ions (Mn1, Mn2) and coordinated solvent molecules (W1, W2, W3) are labeled Dashed lines define the hydrogen bond network surrounding the active site (Based on PDB ID 1JKU) The structure was rendered using ORTEP-3 [13] oxygen atom bridges Analysis of the metal-ligand bond distances and hydrogen-bonding patterns in the crystalline complex shows that the two solvent bridges are structurally distinct, one (W2, trans to the coordinated histidine imidazoles) occurring as a protonated (aquo/hydroxo) group in the oxidized (3,3) state of the cluster, while the other (W1, trans to the pair of coordinated carboxylates) occurs as an unprotonated oxo ion (O2–) The glutamate coordinated to the Mn2 subsite is bidentate in LPC, chelating the metal center, while the Mn1 subsite has a monodentate glutamate ligand which allows a third, terminal solvent molecule to bind in the apical position A nonligating glutamate Glu178 is poised above the cluster, forming a hydrogen bond to the apical water The binuclear active site is embedded in a web of hydrogen bonds that radiate from the metal cluster into the outer sphere protein environment Arg147 anchors a network of hydrogen bonds on the side trans to the coordinated histidines, with the guanidinium NH2 group bound to Glu148 and the bridging hydroxide (W2), while the guanidinium NH1 is hydrogen bonded to Glu35 In addition, the phenolic hydroxyl of Tyr42 is a hydrogen bond acceptor to the NE of Arg147 and a donor to Glu148 The arginine residue is unique to LPC but the same hydrogen bonding pattern involving tyrosine and a glutamate ligand is observed in TTC [10] and corresponding residues can be identified in a number of sequence homologs [11], suggesting that this interaction is a conserved feature of manganese catalase structures This conserved outer sphere interaction between a tyrosine residue and a glutamate ligand is particularly interesting in the context of related motifs that are important functional elements in other, more distantly related enzymes [14] For example, the E coli Class I ribonucleotide reductase (RNR) is based on a similar fourhelix bundle domain architecture templating a binuclear iron (rather than manganese) active site complex The outer sphere of this redox active metal center includes a tyrosine residue (Y122) that forms a catalytically essential free radical [15] Likewise, the manganese cluster of the photosynthetic oxygen evolving complex is associated with a redox-active outer sphere tyrosine (YZ) which is involved in electron transfer and hydrogen atom abstraction steps of the oxygen synthesis reactions [16,17] While there is no evidence for involvement of free radicals in manganese catalase turnover, the conservation of the outer sphere tyrosine within this family of enzymes [10,11], as well as the occurrence of a redox-active outer-sphere tyrosine in the heme catalases [18], suggests that this residue may make essential contributions to the stability or reactivity of the manganese active site Attempts to express active manganese catalase in E coli have been unsuccessful [19] Development of a novel homologous expression system for recombinant manganese catalase (using a catalase-negative strain of L plantarum) has made possible the dissection of the active site structure and function by site-directed mutagenesis In this study we describe the detailed spectroscopic, biochemical and structural characterization of recombinant Y42F L plantarum manganese catalase, Ó FEBS 2003 1104 M M Whittaker et al (Eur J Biochem 270) exploring the role of Tyr42 in stabilizing the dimanganese cluster and implications for the involvement of the bridging ligands in the catalytic mechanism Materials and methods Molecular biology and biochemical preparations Genomic DNA was isolated from Lactobacillus plantarum (ATCC 14431) and Lactobacillus brevis (ATCC 8727) by standard methods The pG+host5 plasmid [20,21] was kindly provided by Emmanuelle Maguin, INRA, France The Mn catalase structural gene with its native promoter was PCR amplified from L plantarum genomic DNA (using the primers 5¢-GCGAGGATCCAACCGACTATT GACTGGTAAAAAAGCAGTTACCCCTAACCAG-3¢ and 5¢-GAGCGAATTCCCACCTCCAATTTGAAATA GCCACCGCC-3¢), BamHI/EcoRI digested and ligated into similarly digested pG+host5 plasmid The pG+host5LPC product was recovered from an E coli transformant and transformed into a kat– strain of L plantarum (NCDO 1193) by electroporation Electrocompetent L plantarum cells were prepared as previously described [22] The protein expression level was subsequently improved by construction of a second expression vector based on the pMG36e plasmid [23], using the L brevis surface layer protein promoter (PslpA) [23,24] in place of the native katM promoter A 267 nucleotide fragment of the 5¢ UTR for L brevis slpA including the dual slpA promoter was PCR amplified from genomic DNA using the primers 5¢-CGTGAATTCGATTACAAAGG CTTTAAGCAGGTTAGTGACGTTTTAG-3¢ and 5¢-C GTTCTAGACATATGCTTTCTTCCTCCAAACATAA AATATGTAATTTATCAAGCAAG-3¢, the latter providing a convenient NdeI/XbaI linker site for ligating inserts for expression, precisely aligning the start codon under the ribosomal binding site in the slpA 5¢ UTR The PCR product was digested (EcoRI/XbaI) and ligated to similarly digested pMG36e to form pMG36ePslpA A single NdeI site occurring in the transcriptional repressor gene (repA) coding region in the vector arms was eliminated by silent mutagenesis using the QuikChange site directed mutagenesis procedure (Stratagene, La Jolla) using the primer 5¢-GT TGAGATACTTGATTATATCAAAGGTTCTTATGA ATATTTGACTCATGAATC-3¢ and its complement The LPC structural gene (katM) was PCR amplified from pG+host5LPC using the primers 5¢-CCGCATATGTTC AAACATACAAGAAAACTGCAATACAACGCAAA ACC-3¢ and 5¢-CGCTCTAGATTATTAACCTTGGTGG TTGTGTAATCTAGGATCACCCG-3¢, the latter including a double terminator sequence (TAATAAT) The instability of the pMG36ePslpA plasmid that has been observed in E coli [25] was eliminated by reversing the orientation of the expression cassette in the plasmid (details to be reported elsewhere) The latter plasmid (pVMG36PslpA-LPC) was used for all protein expression described in this study The Y42F mutation was introduced in this plasmid by QuikChange site directed mutagenesis using the mutagenic primer 5¢-CCACTGGGATGATG TCTTTTCTCTCACAAGGTTGGGCG-3¢ and its complement Protein expression L plantarum was grown at 37 °C in a New Brunswick Scientific BioFlo 3000 Bioreactor equipped with a 14-L fermentation vessel The culture medium was 10 L of MRS medium supplemented with 2% glucose, 1% L-(–)-malic acid, mM MnSO4, 0.5 mM CaSO4, g Tween 80, 30 mg thiamine hydrochloride, and 50 mg erythromycin The pH of the culture was regulated (pH 5.5) by addition of 15% NH4OH and sparged with air to maintain 20% dissolved oxygen level Cells were collected by centrifugation at late log phase (D600 > 10) yielding approximately 400 g of slimy wet cells Manganese catalase was isolated as previously described [7,8,26] The Y42F mutant protein was detected in chromatographic fractions and its purity estimated during purification by electrophoresis (SDS/ PAGE) The Mn content of the purified protein was determined by atomic absorption analysis using a Varian Instruments SpectrAA 20B graphite furnace atomic absorption spectrometer Catalase activity was measured by the optically detected decomposition of hydrogen peroxide [8] and the Km for H2O2 was determined using a Clark oxygen electrode [7] The homogeneous reduced (2,2) state of manganese catalase was prepared by treating the protein with a five-fold excess of (NH2OH)2ỈH2SO4 for a half hour followed by desalting on a gel filtration column To convert the enzyme to the homogeneous (3,3) state, a solution of the reduced protein (10 mgỈmL)1 in 50 mM potassium phosphate buffer pH 7, total volume 5% change between WT and Y42F LPC structures; b PDB ID 1JKU; c PDB ID 1O9I ˚ shift (0.28 A) away from the cluster, perturbing its hydrogen bonding interactions with the solvent bridge (W2) and one of the metal ligands (Glu35) The latter side chain is slightly ˚ displaced away from the cluster (by 0.33 A) along the cluster axis The nonligand carboxylate Glu178 headgroup ˚ also shifts away from the cluster (by 0.63 A) through a small (11°) twist in the extended sidechain In spite of these significant perturbations of the active site environment, both ligating histidine residues (His69 and His181) as well as Glu66, which contributes the bridging carboxylate for metal binding, are nearly invariant between the WT and Y42F 1108 M M Whittaker et al (Eur J Biochem 270) LPC More surprisingly, the Glu148 ligand, which loses one of its hydrogen bonding interaction in the mutant, remains rigidly fixed relative to the polypeptide framework in the major conformation present in the crystal (An alternate conformation of the Glu35/Glu148 pair is also detected in the crystal structure.) Although the position of Glu148 in the major conformer is not significantly affected by Y42F mutagenesis, its altered reactivity is reflected in dramatic changes in the cluster core (Fig 5) Only one of the solvent molecules (W1) associated with the dimanganese core remains bridging in the Y42F LPC cluster The solvent (W2), which formed a second bridge in the WT structure, is terminally bound to Mn1 in the mutant complex to form an octahedral coordination polyhedron for this subsite The position of W2 in Y42F Fig The active site of Y42F Lactobacillus plantarum manganese catalase Manganese ions (Mn1, Mn2) and coordinated solvent molecules (W1, W2, W3) are labeled and hydrogen bonds inferred from the structure are shown Conformations A (top) and B (bottom) are shown (based on PDB ID 1O9I) The structures were rendered using ORTEP-3 [13] Ó FEBS 2003 LPC is roughly the same as found for the corresponding atom in WT LPC, but the second manganese ion (Mn2) is displaced towards Glu148 ligand in the Y42F LPC complex, allowing it to be more symmetrically chelated by the carboxylate headgroup In the WT enzyme, the OE1 oxygen of Glu148 is closest to Mn2, while in Y42F LPC the OE2 oxygen is closest, resulting in distorted trigonal bipyramidal coordination for the Mn2 subsite, the OE2-Mn2-W1 direction defining the trigonal axis This change in coordination chemistry for Glu148 suggests that an increase in ligand basicity resulting from loss of the tyrosine hydrogen bond underlies the reorganization of the cluster core The detailed metric features of the dimanganese core for Y42F LPC are indicated in Scheme In addition to the active site conformation (A) which closely resembles the organization of the WT LPC active site, the ligating glutamate residues Glu35 and Glu148 are found to adopt a second conformation (B) in the crystal (Fig 5), based on a distinct pattern of hydrogen bonds In conformation B, both carboxylate head groups are rotated approximately 90° [with OW3-Mn1-OE2-OE135 dihedral changing from 89.12° (A) to )15.3° (B) and N181-Mn2OE2-OE1148 dihedral changing from )96.3° (A) to 167.4° (B)], allowing the OE2 oxygen of Glu148 to serve as a hydrogen bond acceptor to both the NE and NH2 nitrogens of Arg147, substituting for the missing Y42 phenolic oxygen This structural variation is reminiscent of the carboxylate shift isomerism observed in the diiron carboxylate family of proteins [39–42] The change in binding mode of Glu148 from bidentate chelating to monodentate syn coordination lowers the coordination number of the Mn2 subsite to four, with distorted tetrahedral geometry Metalligand bond distances for Glu35 and Glu148 OE2 carboxylate donor atoms are slightly longer in conformation B ˚ ˚ [Mn1-O35(B) 2.23 A, Mn2-O148 (B) 2.22 A] Reorientation of Glu35 allows a hydrogen bond to be formed with the terminally bound solvent (W3) Conformation A is expected to be stabilized relative to conformation B by two additional hydrogen bonds in the outer sphere of the cluster, which may account for its slight predominance in the mixture (a 60 : 40 ratio based on occupancy estimates in the crystallographic analysis) The uniform behavior of Y42F LPC in spectroscopic measurements and active site titration experiments (see below) suggests that it is not possible to distinguish these two conformers in solution samples Scheme Metric parameters of the Y42F LPC dimanganese core Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur J Biochem 270) 1109 spectrum (Fig 6, spectrum 2) resembles that of the WT enzyme but with higher absorptivity (e480 ¼ 350 M)1Ỉcm)1 compared to 200 M)1cm)1 for WT LPC) (Fig 6, spectrum 3) Spectroscopic characterization – optical absorption spectroscopy The optical absorption spectrum of Y42F LPC in the (3,3) state (Fig 6, spectrum 1) exhibits an absorption maximum near 480 nm with an extinction coefficient of 1100 M)1Ỉcm)1 at pH (e480 ẳ 700 M)1ặcm)1 per Mn) and weaker absorption maximum at 750 nm (Table 4) The stronger absorption band includes a shoulder near 560 nm and fine structure features between 500 and 530 nm arising from spin-forbidden electronic transitions A quantitative stoichiometric redox titration of the O2 re-oxidized Y42F mutant protein with (NH2OH)2ỈH2SO4 demonstrates a uniform reduction process yielding an estimate of 0.88 ± 0.03 sites in the (3,3) state per LPC monomer (Fig 6, inset) The optical extinction coefficient for the visible absorption bands decrease with increasing pH, and at pH 10 the Fig Optical absorption spectra for Lactobacillus plantarum manganese catalase (3,3) complexes (1) Native Y42F LPC (0.25 mM active sites) in 50 mM potassium phosphate pH 6; (2) Y42F LPC (0.25 mM active sites) in 50 mM Caps/KOH pH 10; (3) Native WT LPC manganese catalase (1 mM active sites) in 50 mM Mops pH (Insert) Stoichiometric redox titration of Y42F (3,3) LPC (0.23 mM active sites in 50 mM potassium phosphate pH 7) under argon was titrated with aliquot addition of an anaerobic aqueous solution of (NH2OH)2ỈH2SO4 CD and MCD Spectra The CD spectrum (data not shown) of Y42F LPC ligandfree enzyme in the (3,3) state shows a doublet pattern of negatively signed intensity at 490 and 560 nm as well as weaker positively signed ellipticity near 750 nm (Table 4) The high pH complex exhibits dramatically lower CD intensity near 500 nm and loss of the doublet splitting pattern At low temperatures (5 K) and high magnetic fields (4 T) (3,3) Y42F LPC complex exhibits unusually strong MCD spectra, with well-resolved features at 460 and 560 nm and a pair of weak, sharp features at 505 and 515 nm (Fig 7) Fig Magnetic circular dichroism data for Y42F Lactobacillus plantarum manganese catalase (Left) MCD data for native Y42F LPC (top) Variable-magnetic field MCD spectra for (3,3) Y42F LPC (1.2 mM active sites) in 50 mM potassium phosphate pH 6, 50% glycerol glass, T ẳ K (ặặặ) 4T LT-MCD spectrum for WT LPC (3,3) complex included for comparison (Insert) Saturation-magnetization profiles for low temperature (2–8 K) variable magnetic field (0–5 T) MCD A splitting diagram for non-Kramers ground state with large fine structure splitting (d) is shown Table Spectroscopic properties of Y42F LPC (3,3) complexes ABS CD MCD k (nm) e (M)1Ỉcm)1) k (nm) De (M)1Ỉcm)1) k (nm) De (M)1Ỉcm)1) 480 750 Y42F LPC 1100 100 490 560 750 )8.3 )9.8 +1.7 350 395 460 505 515 560 735 )9.7 )4.7 +47.8 )3.5 +8.5 )32.4 +2.1 475 490 450 500 550 +2.8 )2.5 )3.4 – pH pH 10 – 1110 M M Whittaker et al (Eur J Biochem 270) Ó FEBS 2003 A saturation profile for the 460 nm MCD feature (Fig 7, insert) reveals strongly nested magnetization curves for temperatures between and K The high pH form of the (3,3) Y42F LPC complex shows virtually no paramagnetic MCD over the entire UV-vis-NIR absorption range (Fig 8), although a pattern of weak features closely resembling the oxidized (3,3) complex of WT LPC [27] in both transition energies and intensities remains: DeL-R ẳ )2.4 M)1ặcm)1ặT)1 (350 nm); +3.1 M)1Ỉcm)1ỈT)1 (430 nm); )1.5 M)1Ỉcm)1ỈT)1 (495 nm); )1.6 M)1Ỉcm)1ỈT)1 (550 nm) EPR spectra of the (3,3) complex Low temperature (10 K) EPR spectra for oxidized (3,3) Y42F LPC (Fig 9) exhibit an intense, extremely low-field resonance (geff ¼ 20) extending to the zero-field limit of the spectrum This feature appears in both perpendicular (Fig 9, solid line) and in parallel (Fig 9, dashed line) EPR polarization In parallel polarization, extended hyperfine modulation of the resonance is partly resolved, with an average effective hyperfine splitting aMn ¼ 37 G In addition to this dominant resonance feature, a number of other spectral components centered near geff ¼ (sextet), geff ¼ 4.3 (complex multiplet) and g ¼ (sextet) are also observed in perpendicular polarization, consistent with the presence of several minority species in the enzyme sample The weakest component, near geff ¼ 6, is observed in both parallel and perpendicular polarization, and the modulation pattern is consistent with an average hyperfine coupling aMn ¼ 85 G A complex pattern of hyperfine features centered near geff ¼ 4.3 in perpendicular polarization appears to be comprised of two overlapping subspectra of similar intensity (Fig 9, A and A¢), each exhibiting a sextet multiplet splitting (aMn ¼ 93 G) An EPR signal near g ¼ present in the spectrum of Y42F LPC also clearly exhibits sextet multiplet splittings, and neither the geff ¼ 4.3 nor g ¼ spectra are observed in parallel polarization Thus, polarization experiments allow the even-electron systems [mononuclear Mn(III), and homovalent (2,2) and (3,3) Fig Magnetic circular dichroism data for Y42F Lactobacillus plantarum manganese catalase (3,3) high pH form Variable-magnetic field MCD spectra for native Y42F LPC (1 mM active sites) in 30 mM Caps/KOH pH 10, 50% glycerol glass, T ¼ K Dashed line, 10 · expansion (right hand scale) Fig EPR polarization spectra for Lactobacillus plantarum manganese catalase (3,3) complex Native Y42F LPC (3,3) (2.5 mM active sites) in 50 mM potassium phosphate pH A, A¢ denote sextet components Solid line, perpendicular polarization; dashed line, parallel polarization Instrumental parameters: microwave frequency, 9.68 GHz (perpendicular) or 9.41 GHz (parallel); microwave power, 10 mW; modulation amplitude, G; modulation frequency, 100 kHz; temperature 8.5 K complexes] to be distinguished from mononuclear Mn(II) sites in the protein High pH converts the (3,3) Y42F LPC to a distinct complex, with relatively weak low-field EPR resonances in both parallel and perpendicular polarizations (Fig 10) In parallel polarization a distinct hyperfine pattern is resolved in the low-field resonance, with an average aMn ¼ 32 G Fig 10 EPR polarization spectra for Y42F Lactobacillus plantarum manganese catalase (3,3) hydroxide complex Native Y42F LPC (3,3) (2.3 mM active sites) in 50 mM Caps/KOH pH 10 Solid line, perpendicular polarization; dashed line, parallel polarization Instrumental parameters: microwave frequency, 9.68 GHz (perpendicular) or 9.41 GHz (parallel); microwave power, 10 mW; modulation amplitude, G; modulation frequency, 100 kHz; temperature 8.5 K Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur J Biochem 270) 1111 The A + A¢ multiplet persists in this sample, and the region near g ¼ appears to be a superposition of the sextet feature observed at neutral pH and the multiline spectrum from a minor mixed-valent (3,4) component Discussion Conserved tyrosine residues are present in the outer sphere of metal centers in a wide range of metalloproteins, including ribonucleotide reductase (RNR), the oxygen evolving complex (OEC) of photosystem II, prostaglandin H synthase, catalase, ferritin, and superoxide dismutase In some cases (e.g the Tyr122 in RNR [43]; YZ, assigned to Tyr161 of the D1 protein in the OEC [44]; Tyr385 of ovine prostaglandin H synthase-1 [45]) the tyrosine residues are redox active, forming tyrosyl phenoxyl free radicals that serve as hydrogen atom abstraction sites storing oxidation equivalents in the protein The function of conserved tyrosines in other metalloproteins is less clear In ferritin [46], Tyr34, a residue adjacent to the binuclear iron ferroxidase active site, has been proposed to serve an electron transfer role in analogy to RNR where Tyr122 appears in a similar context In iron and manganesecofactored superoxide dismutases, the conserved tyrosine residue occupies a position at the base of the substrate access funnel [47,48], and may contribute to substrate interactions, facilitate proton transfer steps, or serve as a safety valve preventing permanent oxidative damage to the protein through reversible formation of a phenoxyl species Conservative substitution of phenylalanine for tyrosine in ferritin [46] and manganese SOD [49,50] has negligible effects on turnover under physiological conditions, suggesting that evolution may have selected the conserved tyrosines for function under extreme or unusual conditions Sequence correlations within the manganese catalase family of enzymes have revealed a highly conserved tyrosine (Tyr42 in LPC sequence numbering) preceding the first EXXH metal binding motif by approximately 25 residues X-ray crystallography of both Thermus thermophilus [10] and Lactobacillus plantarum [11] manganese catalases has shown that this tyrosine is intimately associated with the dimanganese core, lying in the outer sphere of the metal cluster and forming a hydrogen bond with one of the manganese ligands The significance of this interaction is unknown, and we have prepared Y42F LPC using site directed mutagenesis and expressed the mutant protein in a homologous expression system in order to address the function of Tyr42 and investigate the role of the outer sphere tyrosine in manganese catalase structure and reactivity Replacement of Tyr42 by phenylalanine does not interfere with the assembly of the dimanganese center in LPC, and recombinant Y42F LPC has only slightly less metal content than recombinant WT LPC X-ray crystallography reveals that mutagenesis perturbs the structure of the binuclear active site, breaking one of the solvent bridges (W2) This loss of a bridge from the cluster core may be traced, in turn, to a disruption of the hydrogen bonding web around the active site Deletion of the Tyr42 phenolic hydroxyl in Y42F LPC removes the hydrogen bonding contact with the Glu148 ligand to Mn2, altering the basicity of the carboxylate group and significantly affecting its coordination behavior (Fig 5) This contributes to the ˚ expansion of the intermanganese distance from 3.03 A in ˚ the (3,3) state of the WT enzyme to 3.33 A in the corresponding state of Y42F LPC, as Mn2 is drawn toward the chelating Glu148 headgroup (Scheme 1) The W2 bridge is further destabilized in the mutant by the loss of the Arg147-Tyr42 hydrogen bond that rigidly anchors Arg147 in WT LPC, allowing W2 to dissociate as the Mn-O-Mn angle is opened from 101.6° to 116.1°, resulting in extremely asymmetric coordination of the W2 solvent in an ÔopenÕ form of the cluster An open, single-atom-bridged dimanganese cluster has previously been proposed to be the catalytically active form of LPC and the major form of LPC in solution [51], although the closed form of the cluster (containing two atom bridges) has been reported for in the WT LPC crystal structure [11] consistent with detailed spectroscopic characterization of the WT LPC in solution [27] These effects of Y42F mutagenesis demonstrate a clear role for Tyr42 in stabilizing the native bridged manganese cluster structure in LPC Alteration of the dimanganese core structure in Y42F LPC has dramatic effects on both the electronic structure of the cluster (as reflected in the perturbed spectra) and its catalytic reactivity Although the open form of the cluster can be readily converted between the (2,2) and (3,3) oxidation states that form the basis for the catalytic reaction cycle in the WT enzyme [52,53], Y42F LPC supports