Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx

Eur J Biochem 270, 1746–1758 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03533.x Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors Hans O Andersson1, Kerstin Fridborg1, Seved Lowgren1, Mathias Alterman2, Anna Muhlman4, ă ă Magnus Bjorsne4, Neeraj Garg2, Ingmar Kvarnstrom3, Wesley Schaal2, Bjorn Classon4, ă ă ă ă Anders Karlen2, U Helena Danielsson5, Goran Ahlsen5, Ullrika Nillroth5, Lotta Vrang6, Bo Oberg6, ă Bertil Samuelsson4, Anders Hallberg2 and Torsten Unge1 Institute of Cell and Molecular Biology, Uppsala, University, Sweden; 2Department of Organic Pharmaceutical Chemistry, Uppsala University, Sweden; 3Department of Chemistry, Linkoăping University, Sweden; 4Department of Organic Chemistry, Stockholm University, Sweden; 5Department of Biochemistry, Uppsala University, Sweden; 6Medivir AB, Lunastigen 7, Huddinge, Sweden HIV-1 protease is an important target for treatment of AIDS, and efficient drugs have been developed However, the resistance and negative side effects of the current drugs has necessitated the development of new compounds with different binding patterns In this study, nine C-terminally duplicated HIV-1 protease inhibitors were cocrystallised ˚ with the enzyme, the crystal structures analysed at 1.8–2.3 A resolution, and the inhibitory activity of the compounds characterized in order to evaluate the effects of the individual modifications These compounds comprise two central hydroxy groups that mimic the geminal hydroxy groups of a cleavage-reaction intermediate One of the hydroxy groups is located between the d-oxygen atoms of the two catalytic aspartic acid residues, and the other in the gauche position relative to the first The asymmetric binding of the two central inhibitory hydroxyls induced a small deviation from exact C2 symmetry in the whole enzyme–inhibitor complex The study shows that the protease molecule could accommodate its structure to different sizes of the P2/P2¢ groups The structural alterations were, however, relatively conservative and limited The binding capacity of the S3/S3¢ sites was exploited by elongation of the compounds with groups in the P3/P3¢ positions or by extension of the P1/P1¢ groups Furthermore, water molecules were shown to be important binding links between the protease and the inhibitors This study produced a number of inhibitors with Ki values in the 100 picomolar range An absolute necessity for the assembly and production of infectious HIV-1 particles is the proteolytic processing of the gag and gag-pol polyproteins into functional enzymes and structural proteins [1–3] The pol-gene-encoded protease, which is responsible for this key function, has been selected as a target for intervention of the HIV-1 infection with antiviral drugs [4–7] Numerous competitive inhibitors of the protease have been prepared [8,9] The Food and Drug Administration (FDA) has approved six inhibitors: amprenavir, indinavir, lopinavir, nelfinavir, ritonavir and saquinavir [10] The side effects of these inhibitors and the clinical emergence of resistant mutants in HIV-1 means that new protease inhibitors need to be developed [11,12] The HIV-1 protease is a C2 symmetric homodimer [13,14] The protein monomer consists of 99 amino acids The active site, with the two catalytic aspartate residues Asp25 and Asp125, is located at the interface between the two monomers Two b-hairpin structures, called ÔflapsÕ, are positioned over the active site They undergo structural changes on binding of the inhibitor molecule In the unliganded protease structure, the conformation of the flaps is open, thereby exposing the active site, whereas in the ligand complex, the flaps form a roof over the active site and the ligand The flaps cover to a large extent the bound ligand This arrangement is advantageous for the design of inhibitors, because it offers a large number of tight interactions between the enzyme and the inhibitor The active site contains eight C2-symmetric subsites (S4, S3, S2, S1, S1¢, S2¢, S3¢, and S4¢) [15] These are the binding sites for the P4, P3, P2, P1, P1¢, P2¢, P3¢, and P4¢ residues of an octapeptide substrate [16] Thus the N-terminal and C-terminal parts of a bound substrate, or the corresponding parts of the inhibitor, will interact with structurally similar subsites To exploit the C2 symmetry of the protease– substrate complex, N-terminally or C-terminally duplicated C2-symmetric inhibitors have been designed [17–20] The finding that a point mutation could completely abolish the inhibitory activity of the symmetric compounds highlights the weakness of this type of compound [21] Drug-resistant Correspondence to T Unge, Institute of Cell and Molecular Biology, BMC, Box 590, Uppsala University, SE-751 24, Uppsala, Sweden Tel.: + 46 18 471 49 85, e-mail: Torsten.Unge@icm.uu.se Enzyme: HIV-1 protease, POL_HV1B1 (P03366) (EC 3.4.23.16) Note: The refined co-ordinates of HIV-1 protease in complex with compounds 1–9 have been deposited in the RCSB Protein Data Bank under the file names, 1EBW, 1EBY, 1EBZ, 1D4I, 1D4H, 1D4J, 1EC1, 1EC2 and 1EC3 (Received December 2002, revised 18 February 2003, accepted 21 February 2003) Keywords: AIDS; drug; HIV; protease; X-ray Ó FEBS 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1747 forms of the protease have been studied with respect to kinetic and resistance properties [22] New generations of mainly asymmetric compounds have been developed with high inhibitory activity against resistant variants of the protease [23–25] We here report crystallographic studies of C-terminally duplicated C2-symmetric and asymmetric inhibitors in complex with the HIV-1 protease These compounds, including the C2-symmetric ones, were found to bind in an asymmetric fashion Ki values in the 100 picomolar range were obtained for a number of these inhibitory compounds [26,27] Materials and methods Expression of HIV-1 protease The plasmid pBH10 containing the pol gene of the HIV-1 BH10 isolate was a gift from R Gallo (National Cancer Institute, Bethesda, MD, USA) The protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG The annealing site for the upstream primer corresponds to 12 amino acids before the protease sequence These extra amino acids were added to make autolytic processing of the precursor protein possible, enabling confirmation that the N-terminus was correct Through PCR, the protease DNA fragment was provided with an NdeI restriction site at the 5¢ end and a BamHI site at the 3¢ end These sites were used for the ligation to the pET11a expression vector The Escherichia coli strains XL-1 and HB101 were used as hosts for cloning Protein was expressed in the E coli strain BL21 (DE3) Bacteria were grown in Luria–Bertani medium to an D550 of 1.0 before induction with 0.5 mM isopropyl thio-b-D-galactoside Cells were harvested after h of induction precipitated with (NH4)2SO4 The precipitate was collected by low-speed centrifugation and dissolved in 50 mM Mes, pH 6.5, containing 10 mM dithiothreitol, 100 mM 2-mercaptoethanol and mM EDTA The solution was desalted on a PD-10 column (AP Biotech AB, Uppsala, Sweden) and concentrated by ultrafiltration with Centricon Centrifugal Filter Units to mgỈmL)1 Enzyme activity and inhibition studies Enzyme activity/inhibition studies were performed as described by Nillroth et al [28] The method includes active-site titrations Briefly, a fluorimetric assay was used to determine the effects of the inhibitors on HIV-1 protease This assay used an internally quenched fluorescent peptide substrate, DABSYL-c-Abu-Ser-Gln-Asn-Tyr-Pro-Ile-Val-GlnEDANS (Bachem, Bubendorf, Switzerland) The measurements were performed in 96-well plates with a Fluoroscan plate reader (Labsystems, Helsinki, Finland) Excitation and emission wavelengths were 355 nm and 500 nm, respectively Anti-HIV activity was assayed in vitro in MT4 cells using the vital dye XTT to monitor the cytopathogenic effects [29] Crystallization Crystallization was performed at °C with the hanging drop vapour-diffusion method Protease (5 lL) at a concentration of 2.0 mgỈmL)1 in buffer consisting of 50 mM Mes, pH 6.5, 10 mM dithiothreitol and mM EDTA was mixed with an equal volume of the reservoir solution The reservoir solution contained 50 mM Mes, pH 5.5, and 0.5 M NaCl The drops were microseeded after days with seeds from protease/inhibitor crystals belonging to space group P21212 Crystals appeared after week, and grew to a final size of 0.3 · 0.3 · 0.05 mm in 3–4 weeks Purification of HIV-1 protease Data collection and processing The chromatographic steps were performed at °C SDS/ PAGE was used after each chromatographic step to monitor the purification Cells were suspended in lysis buffer (20 mM Tris/HCl, pH 7.5, 10 mM dithiothreitol, mM phenylmethanesulfonyl fluoride) and lysed in a French press The lysate was centrifuged for 30 at 12 100 g The insoluble inclusion body fraction, which contained more than 90% of the expressed material, was dissolved in buffer (8 M urea, 20 mM Tris/HCl, pH 8.5, 10 mM NaCl, 10 mM dithiothreitol, mM EDTA) and centrifuged for h at 48 200 g The supernatant was applied to a POROS Q column (Roche) The flow-through fraction was collected and diluted to a final protein concentration of 0.3 mgỈmL)1 Refolding was performed by dialysis against 20 mM sodium phosphate buffer, pH 6.5, containing 10 mM dithiothreitol and mM EDTA The refolded protein was diluted with an equal volume of 50 mM Mes, pH 6.5, containing mM dithiothreitol and mM EDTA, applied to a POROS HS column (Roche), and eluted with a linear gradient of 0–0.6 M NaCl in Mes buffer The pooled fractions were X-ray data were recorded on MAR-imaging plates on the synchrotron beam lines 9.5 DRAL at Daresbury, UK, DL41 and DW32 at Lure, France, and I711 at MAX-lab Lund, Sweden The programs DENZO and SCALEPACK were used for processing and scaling [30,31] A summary of data collection statistics is given in Table Structure refinement Refinement was performed using the program package CNS [32] The protease model co-ordinates from 1AJV were used for molecular replacement calculations The starting model was refined with rigid-body refinement and simulated annealing The difference Fourier map (Fo–Fc) clearly showed the position and orientation of the inhibitor together with a large number of water molecules The inhibitor was built into the electron density with the help of the program O [33] Water molecules were added to the structures determined from the difference Fourier maps at chemically acceptable sites Only solvent molecules with B ˚ values less than 50 A2 were accepted Several cycles of Ó FEBS 2003 1748 H O Andersson et al (Eur J Biochem 270) Table Crystallographic structure determination statistics Rmerge ¼ SjIi)/SIi, where Ii is an observation of the intensity of an individual reflection and is the average intensity over symmetry equivalents Rcrystal ¼ SjjFoj)jFcjj/SjFoj, where Fo and Fc are the observed and calculated structure factor amplitudes, respectively Rfree is equivalent to Rcrystal but calculated for a randomly chosen set of reflections that were omitted from the refinement process Ideal parameters are those defined by Engh & Huber [55] Data collection details Space group ˚ Wavelength (A) No of crystals ˚ Cell dimensions (A) a¼ b¼ c¼ ˚ dmin (A) No of observations No of unique reflections Completeness (%) Rmerge (%) Reflections I >2 r (%) Reflections I >2 r in highest resolution shell (%) ˚ Bin resolution (A) Refinement statistics ˚ Resolution range (A) Rcryst (%) Rfree (%) No of atoms ˚ Mean B factors (A2) Protein Inhibitor All Deviation from ideality ˚ Bond lengths (A) Angles (°) Dihedrals (°) Impropers (°) P21212 0.920 P21212 1.386 P21212 0.970 P21212 1.375 P21212 1.375 P21212 1.375 P21212 0.970 P21212 0.958 P21212 0.958 59.04 86.83 46.98 1.80 42993 16613 69.7 9.4 63.0 9.4 59.15 86.98 47.16 2.30 28849 10685 93.8 4.6 84.1 74.2 58.84 86.66 46.87 2.00 55336 15626 95.9 7.5 83.4 70.1 58.62 86.32 46.69 1.81 95666 21735 97.5 11.1 84.6 60.8 58.46 86.31 46.57 1.81 61625 20047 90.5 8.9 79.7 52.5 58.78 86.52 46.58 1.81 92684 21687 97.2 11.2 80.5 51.1 58.12 86.11 46.11 2.10 35374 13120 93.1 7.5 77.1 63.1 58.48 86.67 46.52 2.00 44926 15612 92.9 11.6 72.5 61.0 58.89 86.70 46.70 1.90 62391 18784 95.7 8.1 90.4 79.2 1.86–1.80 2.40–2.30 2.07–2.00 1.87–1.81 1.87–1.81 1.87–1.81 2.18–2.10 2.07–2.00 1.97–1.90 24.6–1.81 19.0 21.8 1677 24.0–2.30 18.1 20.0 1662 24.6–2.01 18.0 20.3 1647 27.9–1.81 18.8 222.4 1697 22.6–1.81 19.4 23.4 1694 15.0–1.81 20.1 23.1 1655 24.3–2.10 20.4 23.7 1676 24.7–2.00 20.7 23.9 1688 24.3–2.10 20.4 23.7 1688 19.6 16.8 20.4 20.2 12.9 20.5 20.2 18.1 21.0 20.2 16.5 21.1 20.4 20.0 21.9 25.6 23.8 26.3 18.3 14.0 19.8 17.4 13.4 18.7 23.4 23.3 19.8 0.006 1.3 25.7 0.79 0.008 1.2 25.4 0.77 0.006 1.3 25.5 0.76 0.006 1.2 25.4 0.79 0.006 1.2 25.3 0.82 0.006 1.2 25.2 0.85 0.007 1.4 25.4 0.77 0.007 1.3 25.4 0.75 0.007 1.4 25.4 0.77 minimization, simulated annealing, and B-factor refinement were performed for each complex, accompanied by manual rebuilding The Rcrystal and Rfree factors were used to monitor the refinement [34,35] The refinement statistics are shown in Table Graphics All the figures were drawn with the programs SWISS-PDBVIEWER [36] (http://www.expasy.ch/spdbv/) and POV-RAY (http://www.povray.org/) Results and Discussion Inhibitor properties The linear C-terminally duplicated inhibitors in this study encompass a central six-carbon skeleton derived from L-mannaric acid (Table 2) Five of the inhibitors [1,2,7–9] are chemically C2 symmetric Seven of these nine compounds exhibit Ki values in the nanomolar or lownanomolar range, with antiviral effects (ED50) ranging from >75 lM (compound 6) to 0.04 lM [7] Crystallographic calculations The crystal structures of the nine inhibitors in complex with HIV-1 protease were determined to high resolution (Table 1) All the complexes were crystallized in the orthorhombic space group P21212 The asymmetric unit contained the whole protease molecule This means that even though the crystal packing contains twofold axes, these not impose twofold symmetry on the inhibitor– protease complex In the database of HIV and simian immunodeficiency virus protein–complex structures (http://www.ncifcrf.gov/HIVdb), there are examples of structures in which the inhibitors are uniquely oriented, but also structures in which the corresponding electron density represents two orientations of the inhibitor [37,38] For the structures presented here, the electron densities of the inhibitors, especially the densities of the side groups of the asymmetric compounds, indicate a unique orientation of the protease–inhibitor complex in the crystal lattice (Fig 1) The orientation of the two central hydroxy groups influences the positioning of the inhibitor in the active site and thereby the structure of the protease Ó FEBS 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1749 Table Inhibitor structure, enzyme inhibition and antiviral activity in MT4-cell culture ED50 values for reference substances tested in the same assay: ritonavir (ED50 0.06 lM), indinavir (ED50 0.06 lM), saquinavir (ED50 0.01 lM) and nelfinavir (ED50 0.04 lM) Compound was synthesized with only one central hydroxy group Compound no A B C Ki (nM) ED50 (lM) 0.90 1.24 0.20 0.11 0.40 0.15 1.40 1.49 0.10 3.39 4.40 >75 1.20 0.04 0.10 2.47 0.92 0.75 The inhibitors in this study (excep compound 4) contain two central hydroxy groups that mimic the geminal hydroxy groups of an intermediate in the cleavage reaction [39] A completely symmetric arrangement of these inhibitors in the active site would require a twofold symmetrical arrangement of the two hydroxyls and consequently identical binding patterns to the catalytic residues (Asp25/Asp125) However, a symmetrical arrangement of the central hydroxyls was not found for either the symmetric or the asymmetric compounds Instead, one of the hydroxy groups ˚ was placed at hydrogen-bonding distance (2.7 A) between the d-oxygen atoms of the two aspartic acid residues (Figs 1750 H O Andersson et al (Eur J Biochem 270) Ó FEBS 2003 Fig Orientation of the inhibitor in the active site and arrangement of the central vicinal hydroxyls (stereo view) The figure shows the structure of the asymmetric compound as it is arranged in the HIV-1 protease active site The electron density map indicates a unique orientation of the inhibitor and the whole protease–inhibitor complex in the crystal lattice The density also indicates an  90% unique orientation of the central vicinal ˚ hydroxy groups in the complex with this compound The Fo–Fc electron density map was calculated at 2.0 A resolution with the inhibitor compound omitted, and contoured at 2.5 r Fig Positioning of the inhibitor in the active site and hydrogen-bond network One of the inhibitor hydroxyls has extensive contacts with the ˚ catalytic Asp25/Asp125 The hydrogen-bond distances are short (2.7–2.8 A) The gauche hydroxy group is hydrogen-bonded to one of the catalytic aspartate residues Gly27/Gly127 contribute to the active-site hydrogen-bond network by donation of hydrogens via the main-chain amide groups These two compounds and represent the two groups of inhibitors in this study Compound (A) has 10 and compound (B) has hydrogenbond donors/acceptors In the latter case, two water molecules remain co-ordinated to the G48/G148 carbonyl groups after complex formation and 2), and the other hydroxy group was in gauche position relative to the first, hydrogen-bonded to one of the ˚ aspartates (2.8 A) and had van der Waals interaction with ˚ Cb of Ala28 (Ala128) at a distance of 3.9 A The same arrangement has been observed for other C2-symmmertric diol-containing inhibitors [40] As a direct consequence of this arrangement, the twofold symmetry axis of the inhibitor will not coincide with the protease twofold axis Despite the ability of the protease to adapt to differences in the size of the inhibitor side groups, a comparison between the left and right binding sites reveals small but significant differences in bond lengths This is exemplified by the observation that the distance between the P1 benzyl group of compound to ˚ Arg8 was 4.0 A whereas the distance from P1¢ to Arg108 ˚ The significance of this discrepancy is apparent was 3.6 A from a comparison with the HIV-1 protease–inhibitor structure 4phv, which contains an inhibitor homologous to compound but with only one central hydroxy group and which is also shorter by one carbon in the central part of the inhibitor [41] In this structure, the distances between the P1/ P1¢ benzyl groups and Arg8/Arg108 were 4.0 and 3.9, respectively Thus, like the natural protein substrate, the inhibitors, including the symmetric ones, tend to bind in an asymmetric fashion [40,42] Compounds 3, and were made in order to exploit the asymmetric binding Electron density maps revealed a preference for the same arrangement of the central hydroxyls for compounds 1, and 5–8 (see Figs 1, and 4) Compound 4, with only one central hydroxyl, had it arranged as in compounds 1,3 and 5–8 Preference for the opposite arrangement was found for compound (see Fig 6) However, the central hydroxyls were not completely uniquely arranged in any of the structures of compounds 1–3 or 5–9 Degrees of uniqueness varied from 75 to 90% For the asymmetric compound 3, the density indicated a 90% unique orientation (Fig 1) Small but significant deviations from exact C2 symmetry were also observed in parts of the protease structure connected with movement of the flaps Application of a Ó FEBS 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1751 least-squares superimpositioning of chain A on B showed ˚ an average difference of 0.9 A between Ca atoms in the flap region and in the b-strands with amino acids 15–18, 37–41, 59–64 and 71–74 (not shown) Consequently, significant differences in the binding pattern were observed for the chemically identical P1/P1¢, P2/P2¢ and P3/P3¢ groups The asymmetric positioning of the inhibitor in the protease substrate-binding site, especially the interactions between the inhibitor and the flaps, may be the major reason for these structural differences However, crystal-packing interactions, which in this space group are different for the two peptide chains, may contribute to the asymmetry of the protease Interactions between the central inhibitor hydroxy groups and the active-site aspartate residues The oxygen atom of the hydroxy group, which is positioned symmetrically above the catalytic Asp25/Asp125, is hydrogen-bonded to the carboxylate oxygens of the aspartates at ˚ distances between 2.63 and 2.89 A (Fig 2, Table 3) This ˚ position is 1.4 A away from the position of the catalytic water as suggested by the structure of the hydrated difluoroketone inhibitor A79285 (1DIF) [39] The active site of the inhibitor complex is rich in hydrogen bonds In addition to the abundant hydrogen-bond network involving the inhibitor, the main-chain amide nitrogen atoms of Gly27 and Gly127 are hydrogen-bonded to the carboxylate oxygens Asp25 OD1 and Asp125 OD1, respectively, at ˚ distances of 2.8–2.9 A The position and orientation of G27/G127 is to a large extent determined by the stabilizing hydrogen-bond network, which involves the second member of the catalytic triad T26/T126 [43] The close packing of the central hydroxy group between the aspartic carboxylates is a common property of not only the compounds in this series but also of other linear inhibitors [44] The positioning of the inhibitor in the active site results in a tight interaction between the inhibitor’s hydroxy group and the catalytic residues This close positioning of the inhibitor’s hydroxyl to the carboxylate oxygens is not only caused by the attraction between these groups, but also by the interactions between the inhibitor’s side chains and the S1-S3 site residues This was revealed by a comparison with the position of a homologous inhibitor that lacked the co-ordinating central hydroxy group (unpublished data) Binding contribution by the gauche hydroxy group The central gauche hydroxy group of these compounds mimics the gauche position of the hydrated peptide carbonyl in a cleavage-reaction intermediate (Fig 2) Its ˚ position is an average distance of 0.3 A from the gauche hydroxyl in compound A79285, which mimics a hydrated peptide intermediate [39] To evaluate the binding contributions of this gauche hydroxy group, compound was synthesized, in which the gauche hydroxy group was replaced with a hydrogen atom Superimposition of the compound and protease–inhibitor complexes with lsq_explicit in the program O resulted in an r.m.s.d value ˚ of 0.18 A for the protein Ca atoms The same magnitudeof-distance deviations were observed between identical inhibitor atoms There were, however, asymmetric discrepancies Table Hydrogen bonds between the protease and the inhibitor compounds 1, 2, and Atom Compound 25 Asp 25 Asp 27 Gly 29 Asp 48 Gly 125 Asp 125 Asp 125 Asp 127 Gly 129 Asp 148 Gly Compound 25 Asp 25 Asp 27 Gly 29 Asp 125 Asp 125 Asp 125 Asp 127 Gly 129 Asp 129 Asp Compound 25 Asp 25 Asp 27 Gly 29 Asp 48 Gly 125 Asp 125 Asp 125 Asp 127 Gly 129 Asp Compound 25 Asp 25 Asp 27 Gly 125 Asp 125 Asp 125 Asp 127 Gly 129 Asp 129 Asp Atom Protease–inhibitor ˚ distance (A) Od1 Od2 O N O Od1 Od2 Od2 O N O O27 O27 N18 O24 N25 O27 O27 O28 N8 O14 N15 2.71 2.89 3.13 2.88 2.93 2.74 2.68 2.70 3.12 2.92 2.96 Od1 Od2 O N Od1 Od2 Od2 O N Od2 O6 O6 N1 O50 O6 O6 O8 N12 O60 O60 2.64 2.85 3.13 3.02 2.90 2.65 2.71 3.21 3.07 2.86 Od1 Od2 O N O Od1 Od2 Od2 O N Residue O6 O6 N1 O46 N47 O6 O6 O8 N12 O60 2.75 2.83 3.16 2.89 2.92 2.72 2.64 2.70 3.13 3.12 Od1 Od2 O Od1 Od2 Od2 O N Od2 O32 O32 N44 O32 O02 O32 N14 O24 O24 2.63 2.88 3.19 2.82 2.66 2.63 2.97 3.10 2.97 in the P1/P1¢ positions The positions of P1 atoms in ˚ compound agreed within 0.1 A with the corresponding atoms of compound 2, as opposed to atoms of P1¢, which ˚ were within 0.3 A This led us to conclude that the hydroxy group could be exchanged for a hydrogen atom without any major effects on the positioning of the inhibitor in the active site However, the modification had a negative effect on the Ki value, which was seven times higher for compound (1.4 nM) than for compound (0.2 nM) Thus, the gauche hydroxy group contributes significantly to the binding capability The contribution, which is complex, includes hydrogen-bonding to Asp25/Asp125, van der Waals Ó FEBS 2003 1752 H O Andersson et al (Eur J Biochem 270) interactions with Ala28, as well as energy contributions from restriction of the rotational freedom around the C4 carbon Overall hydrogen-bond pattern between the inhibitors and the protease The compounds in this series contain several hydrogenbond donors and acceptors (Fig and Table 3) The number of hydrogen bonds between the protease and the inhibitors varies between and 12 (Table 4) The fact that these inhibitors are all based on the same skeleton is reflected in the conserved hydrogen-bond pattern between the different compounds (Table 3) The asymmetric substitutions in the P2 positions not significantly alter the pattern of the retained groups All polar groups in the inhibitors, except the ether link in P1/P1¢, are involved in hydrogen bonding to the protein, either directly or indirectly through water molecules Compared with the substrate-like peptide bond in the P2/P3 positions of compounds 1, and 7–9, substitutions with the indanyl and benzyl groups in P2 led to loss of the hydrogen bond to the carbonyls of Gly48 As expected, because of its position close to the entrance of the binding site, a water molecule co-ordinates Gly48 in these complexes (Fig 2B) According to a study by Ala et al [45], hydrogen bonds contribute less than hydrophobic interactions to the binding energy However, the overview of the number of hydrogen bonds and other contacts in Table indicates that hydrogen bonds, as well as the closepacking interactions, contribute to the inhibitory efficacy of the compounds (Table 4) The variations in bond distances indicate potential variation in energy content in the established hydrogen bonds (Table 3) Hydrogen bonds to co-ordinating water molecules are not included in Tables and These are discussed below Optimization of the P1/P1¢ side chains The HIV-1 protease cleaves the precursor protein at nine positions In seven of these, the P1 or P1¢ amino acid is a phenylalanine or tyrosine By homology, it is natural to use benzyl groups as P1/P1¢substituents on the C2/C5 carbons, as is the case in a large number of inhibitors In this series of compounds, however, benzyloxy groups are used Through ˚ the ether linkage the side chain is elongated by 1.45 A This permits positioning of P1/P1¢ in a position that is almost identical with that in the homologous compound L-700,417, which has only one central hydroxyl and P1/P1¢ benzyl side chains (4PHV [41]) (Fig 3) Even though the ether linkage increases the potential degrees of rotational freedom of the P1/P1¢ side chains, this is not the outcome Rather, the inhibitor becomes more compact The elongation enables close packing of the side chain to the inhibitor backbone and to P2/P2¢ [27] The position of the P1/P1¢ side chains is conserved among these compound complexes of compounds 1–8 The oxygen atom in the ether linkage shows only weak interaction with the protein The closest atoms are the Od2 atoms of Asp25/Asp125 at distances of 3.4/ ˚ ˚ 3.7 A The P1/P1¢ benzyloxy side groups are within a 3.7-A radius of the S1/S1¢ site atoms O of Gly27/Gly127, CG of Table Summary of the inhibitor/protease interactions Buried surface area was calculated with programs within the CNS package [32] Hydrogen ˚ ˚ bonds were calculated with a maximum distance of 3.5 A between acceptors and donors An atom/pair distance of less than 3.9 A was used as criterion for a contact Compound Molecular mass (Da) Buried surface ˚ area (A2) No of hydrogen bonds No of inhibitor/ protease contacts Ki (nM) 642.791 652.743 633.740 636.743 610.705 663.141 778.977 768.908 768.908 1400.48 1426.56 1369.16 1394.59 1398.39 1391.54 1528.61 1572.11 1551.03 11 10 10 11 11 12 39 52 52 48 51 52 53 47 61 0.90 0.20 0.13 1.40 0.10 4.40 1.20 0.10 0.92 Fig Comparison between the 3D structures of our compound and compound L-700, 417 (in blue) (4PHV [41]) (stereo view) The two compounds and L-700, 417 have similar C2-symmetric scaffolds, but the scaffold of L-700, 417 is one carbon atom shorter Through the elongation with an ether link in compound 2, the P1/P1¢ benzyl groups superimpose well The two compounds form notably compact structures when bound to the protease Ó FEBS 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1753 Pro81/Pro181, CG1 of Val82/Val182, and CD1 of Ile84/ ˚ Ile184 Within a distance of 4.0 A is CD2 of Leu23/Leu123 Two water molecules in each side of the protease molecule interacts with P1/P1¢ In the complex with compound 9, the ˚ benzyloxy group is shifted upward by  1.5 A on one of the sides leading to loss of the interaction with O of Gly127 but instead making contact with C and O of Gly149 Optimization of the P2/P2¢ side chains The chemical properties of the natural substrate P2/P2¢ amino-acid residues vary more than these of the P1/P1¢ residues The S2/S2¢ sites contain the hydrophobic amino acids Ala28/Ala128, Val32/Val132, Ile47/Ile147, Ile84/ Ile184 and Ile150/Ile50, as well as the polar Asp30/Asp130 [16] The P2/P2¢ side chains of the compounds studied here are manly hydrophobic Thus, the lipophilic groups valinyl (the side chain of valine) [3,7–9], isoleucinyl (the side chain of isoleucine) [1], indanyl [2–6], benzyl [5] and 2-chloro-6fluorobenzyl [6] were explored (Table 2) The interacting S2/S2¢ ligands were Ala28/Ala128, Asp30/Asp130, Val32/ Val132, Ile47/Ile147 and Ile84/Ile184 Even though the sizes of the P2/P2¢ side chains differ significantly and penetrate ˚ the binding site with a difference of 2.1 A, the positions of the contacting S2/S2¢ amino acids are relatively conserved except for those in the 30s and 80s loops The side chain of ˚ ˚ Asp30 and Val32 moves as much as 2.0 A and 0.6 A, respectively, to accommodate the benzyl and 2-chloro-6fluorobenzyl groups of compounds and (Fig 4) Fig shows a summary of the shifts in the Ca positions In addition to the shifts around amino-acid position 30, ˚ significant shifts of the order of 0.2–0.7 A are observed around positions 18, 67 and 81 Only the peptide chain harbouring the S2 site was used in the calculations The change in position of Asp30 leads to small changes in the hydrogen-bond networks involving this residue A comparison with compounds 1, and indicate how the side chains valinyl, isoleucinyl and indanyl gradually fill out the S2/S2¢ sites, resulting in the expected improvements in the Ki values (Table 2) However, the chlorine-substituted and fluorine-substituted benzyl group of compound created a P2 group that was too large, as reflected by the high Ki value of 4.4 nM Because of steric hindrance by the main-chain carbonyl group of Gly48, the Cl atom had to be positioned ÔinwardÕ against the S2 site and in close contact with Cb of V28 and Cd of I84 The close packing ˚ against A28 forces this P2 side chain upward by 0.6 A As a consequence, the hydrogen bond with the inhibitor backbone amide and Gly27 is broken and replaced by co-ordination of a water molecule This water molecule is co-ordinated by the NH group of the inhibitor, O of Gly27, and N of Asp29 The close packing between the chlorine atom and Cd of I84 displaces the phenyl ring ˚  A closer to the 30s loop compared with the phenyl group of compound and the six-carbon ring of the indanyl group of compound This leads to repositioning ˚ of the 30s loop and Asp30 by 0.4 and 1.0 A, respectively, compared with their positions with the smaller P2¢ groups The electronegative fluorine is within van der Waals radius ˚ (3.3 A) of the similarly electronegative carbonyl oxygen of Gly84 The most serious problems with this P2 group are the breaking of the hydrogen bond and repulsion between the dipoles In compound 5, one of the indanyl groups was exchanged for a benzyl group to investigate the requirements for optimal asymmetric binding to the S2/S2¢ site The benzyl group is coplanar with the six-carbon ring of the indanyl ˚ group but its position is shifted by  0.3 A Thus, the hydroxy group is not necessary for the orientation of the plane of the aromatic moiety A bound water molecule (B ¼ 39.6) positioned in contact with the phenyl planes of ˚ the P1¢ and P2¢ side chains and 0.5 A from the position of the indanyl oxygen atom replaces the function of the indanyl hydroxy group as hydrogen-bond donor (Fig 6) Interestingly, compounds and have about the same Ki values, which indicates the value of the bridging water molecule for specific and efficient interactions between ligand and enzyme Calculation of accessible area in the protease buried by the compounds in the complex showed that compound 1, with a relatively low molecular mass, buried an area of equivalent size to the bigger compound (Table 4) A comparison of the number of contacts and hydrogen bonds for these compounds revealed inefficient utilization of area in the case of compound This was also reflected in a higher Ki value for compound Fig Accommodation of S2/S2¢ residue to different P2/P2¢ groups (stereo view) Whereas the positions and orientations of Ala28, Val32, Ile47, ˚ Ile84 are conserved, Asp30 and Val32 as well as the entire loop containing these residues adopt to the different P2 side chains as much as 2.1 A for ˚ the side chain and 0.2–0.7 A for the main-chain atoms Colour code: light blue (1), magenta (2), dark blue (3), black (5) and red (6) Ó FEBS 2003 1754 H O Andersson et al (Eur J Biochem 270) Fig Ca plot analysis [56] of the inhibitor complexes 1–9 (here labelled A-J) The mRMSD panel shows the combined distance deviation for all pairs of A subunits (containing the S2 site) Values were calculated with LSQMAN [57] Optimization of the P3/P3¢ side chains In addition to extension of the inhibitor by addition of a new peptide bond and P3/P3¢ ligands, the S3/S3¢ sites can be reached by substituents on the P1/P1¢ ligands To test this, compounds 7–9 were synthesized Compounds and are substituted with thienly and pyridyl groups at the para position of the P1/P1¢ benzyl groups, and inhibitor contains pyridyl groups in the P3/P3¢ positions (Fig 7) The structures of compounds and have previously been briefly described by Alterman et al [46] Compound has a significantly better binding parameter (Ki ¼ 0.1 nM) than compounds and (1.2 nM and 0.92 nM, respectively) (Table 2) The electron density of the thienyl ring of compound was low, which indicated undefined binding, whereas the densities for the pyridyl rings of compounds and were well defined The significantly lower Ki value for compound is explained by the van der Waals interactions of the pyridyl rings with Phe53/Phe153, Pro181/Pro81 and Gly48/Gly148, where Pro packs against the plane of the pyridyl ring Furthermore, the pyridyl nitrogens are co-ordinated to Arg8/108 via water molecules (Fig 7) The pyridyl ring of compound interacts with Gly48/148 and Arg8/108 However, the orientations of the two pyridyl rings as well as their binding patterns are different There are not, as for compound 8, any apparent co-ordinating ligands to the pyridyl nitrogens Only in one side of the S3 sites is it possible to find water molecules within binding distances Loosely bound water molecules at the entrance to the S3/ S3¢ sites are displaced by the extending pyridyl and thienyl rings Water molecules located in the active site Several water molecules are located in the active site and bound to the protein as well as to inhibitor compounds Similar to other linear HIV-1 protease inhibitors, in these inhibitor complexes also a structural water molecule acts as a link between the inhibitor and the flap residues Ile50/ Ile150 Considerable effort has been expended on designing inhibitors that include this water molecule in their structure [47–50] However, in these compounds, co-ordinating hydrogen-bond-accepting carbonyl groups were designed Ó FEBS 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1755 Fig Value of a water molecule in the interface between inhibitor and protein (stereo view) A bound water molecule in the compound protease complex (A) fulfils the function of the indanyl hydroxyl in compound (B) The two compounds have comparable inhibitory activity, 0.1 and 0.2 nM, respectively The hydrogen-bond distances between the water molecule ˚ and the Ile50/Ile150 N atoms are in the range 2.7–2.9 A The tetrahedral arrangement of the ligands to this water molecule is slightly distorted This water oxygen atom has a ˚ low-temperature factor (15 A2) Two water molecules are positioned between the P1/P2 arms and hydrogen-bonded by the P3 carbonyl oxygen atom and at the corresponding symmetry-related sites (Fig 2) Water molecules at these positions have been found in several inhibitor complexes [51] Also these water molecules have low-temperature factors Their role is not clear, but their position, just below the inhibitor, indicates that water molecules may serve as lubricant between movable parts in a protein molecule, increase the promiscuity of the interactions, and add to the enthalpy energy term by contributing additional bonds to the protein– inhibitor complex [52–54] In support of this role of water molecules in enzyme–ligand complexes is the finding that compounds and inhibit the protease activity with similar efficacy although one of the indanyl groups of compound was exchanged for a benzyl and a co-ordinating water molecule in compound (Fig and Table 2) Conclusions We have exploited the technique of structure-aided drug design to improve the inhibitory efficacy of HIV-1 protease lead compounds The flexibility of the target molecule complicates prediction of the effect of a modification of the inhibitor and necessitates structural analysis of each complex In this case, the HIV-1 protease, the flexibility was relatively conservative The asymmetric binding of the two central inhibitor hydroxyls to the active-site aspartates induced a small deviation from the exact C2 symmetry in the whole enzyme–inhibitor complex This study shows that, even without changing the chemistry of the inhibitor scaffold but with modifications limited to the side groups, several potent compounds can be designed The most active compounds in this series had the highest number of contacts (bonds) between the protease and the inhibitor 1756 H O Andersson et al (Eur J Biochem 270) Ó FEBS 2003 Fig Extension of the inhibitors to the S3/S3¢ sites (stereo view) Extension to the S3/S3¢ sites was accomplished in compound by elongation of the P1/P1¢ benzyl groups with pyridyl groups (A) In compound 9, the S3/S3¢ sites were reached by elongation of the compound with pyridyl groups at the P3 positions (B) The van der Waals interaction with the S3 site residues G48,G49, F53 and P181 is more extensive to the pyridyl group of compound than to the pyridyl group in compound In addition, whereas in compound the pyridyl group only has van der Waals close packing interactions with R108, the pyridyl group in compound is co-ordinated to R108 through a hydrogen-bond network including water molecules compound for a given area in the protease-active site This area is characterized as accessible area buried by the compound in the complex The study shows that these parameters are useful guides in the optimization of inhibitor compounds Firmly bound water molecules were found to be important components of the efficient inhibitors These results will be used in the development of new HIV-1 protease inhibitors in general and new compounds with significantly different resistance profiles in particular Acknowledgements We thank Mrs Terese Bergfors for reading the manuscript and Dr Mats Sandgren for preparation of Fig We thank Professor Sherry Mowbray and Professor Alwyn Jones for fruitful discussions This work was supported by the Swedish Medical Research Council (MFR, K79-16X-09505-07A), the Swedish National Board for Industrial and Technical Development (NUTEK), the Swedish Research Council for Engineering Sciences (TFR), and Medivir AB, Huddinge Sweden References Kohl, N.E., Emini, E.A., Schleif, W.A., Davis, L.J., Heimbach, J.C., Dixon, R.A., Scolnick, E.M & Sigal, I.S (1988) Active human immunodeficiency virus protease is required for viral infectivity Proc Natl Acad Sci USA 85, 4686–4690 Peng, C., Ho, B.K., Chang, T.W & Chang, N.T (1989) Role of human immunodeficiency virus type 1-specific protease in core protein maturation and viral infectivity J Virol 63, 2550–2556 Gottlinger, H.G., Sodroski, J.G & Haseltine, W.A (1989) Role of capsid precursor processing and myristoylation in morphogenesis and infectivity of human immunodeficiency virus type Proc Natl Acad Sci USA 86, 5781–5785 Debouck, C., Gorniak, J.G., Strickler, J.E., Meek, T.D., Metcalf, B.W & Rosenberg, M (1987) Human immunodeficiency virus protease expressed in Escherichia coli exhibits autoprocessing and specific maturation of the gag precursor Proc Natl Acad Sci USA 84, 8903–8906 Graves, M.C., Lim, J.J., Heimer, E.P & Kramer, R.A (1988) An 11-kDa form of human immunodeficiency virus protease expressed in Escherichia coli is sufficient for enzymatic activity Proc Natl Acad Sci USA 85, 2449–2453 Hansen, J., Billich, S., Schulze, T., Sukrow, S & Moelling, K (1988) Partial purification and substrate analysis of bacterially expressed HIV protease by means of monoclonal antibody EMBO J 7, 1785–1791 Debouck, C (1992) The HIV-1 protease as a therapeutic target for AIDS AIDS Res Hum Retroviruses 8, 153–164 Wlodawer, A & Vondrasek, J (1998) Inhibitors of HIV-1 protease: a major success of structure-assisted drug design Annu Rev Biophys Biomol Struct 27, 249284 ă Bishofberger, N & Oberg, B (1999) Antivirals (HIV) editorial overview Curr Opin Anti-Infect Invest Drugs 1, 125–126 10 Richman, D.D (2001) HIV chemotherapy Nature (london) 410, 995–1001 Ó FEBS 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1757 11 Carr, A & Cooper, D.A (1998) Images in clinical medicine Lipodystrophy associated with an HIV-protease inhibitor N Engl J Med 339, 1296 12 Ridky, T & Leis, J (1995) Development of drug resistance to HIV-1 protease inhibitors J Biol Chem 270, 29621–29623 13 Wlodawer, A., Miller, M., Jaskolski, M., Sathyanarayana, B.K., Baldwin, E., Weber, I.T., Selk, L.M., Clawson, L., Schneider, J & Kent, S.B (1989) Conserved folding in retroviral proteases: crystal structure of a synthetic HIV-1 protease Science 245, 616– 621 14 Navia, M.A., Fitzgerald, P.M., McKeever, B.M., Leu, C.T., Heimbach, J.C., Herber, W.K., Sigal, I.S., Darke, P.L & Springer, J.P (1989) Three-dimensional structure of aspartyl protease from human immunodeficiency virus HIV-1 Nature (London) 337, 615–620 15 Schechter, I & Berger, A (1967) On the size of the active site in proteases I Papain Biochem Biophys Res Commun 27, 157– 162 16 Wlodawer, A & Erickson, J.W (1993) Structure-based inhibitors of HIV-1 protease Annu Rev Biochem 62, 543–585 17 Kempf, D.J., Norbeck, D.W., Codacovi, L., Wang, X.C., Kohlbrenner, W.E., Wideburg, N.E., Paul, D.A., Knigge, M.F., Vasavanonda, S., Craig-Kennard, A et al (1990) Structurebased, C2 symmetric inhibitors of HIV protease J Med Chem 33, 2687–2689 18 Erickson, J., Neidhart, D.J., VanDrie, J., Kempf, D.J., Wang, X.C., Norbeck, D.W., Plattner, J.J., Rittenhouse, J.W., Turon, ˚ M., Wideburg, N et al (1990) Design, activity, and 2.8 A crystal structure of a C2 symmetric inhibitor complexed to HIV-1 protease Science 249, 527–533 19 Erickson, J & Kempf, D (1994) Structure-based design of symmetric inhibitors of HIV-1 protease Arch Virol Suppl 9, 19–29 20 Kempf, D.J (1994) Design of symmetry-based, peptidomimetic inhibitors of human immunodeficiency virus protease Methods Enzymol 241, 334–354 21 Ho, D.D., Toyoshima, T., Mo, H., Kempf, D.J., Norbeck, D., Chen, C.M., Wideburg, N.E., Burt, S.K., Erickson, J.W & Singh, M.K (1994) Characterization of human immunodeficiency virus type variants with increased resistance to a C2-symmetric protease inhibitor J Virol 68, 2016–2020 22 Mahalingam, B., Louis, J.M., Reed, C.C., Adomat, J.M., Krouse, J., Wang, Y.F., Harrison, R.W & Weber, I.T (1999) Structural and kinetic analysis of drug resistant mutants of HIV-1 protease Eur J Biochem 263, 238–245 23 Weber, J., Mesters, J.R., Lepsik, M., Prejdova, J., Svec, M., Sponarova, J., Mlcochova, P., Skalicka, K., Strisovsky, K., Uhlikova, T., Soucek, M., Machala, L., Stankova, M., Vondrasek, J., Klimkait, T., Kraeusslich, H.G., Hilgenfeld, R & Konvalinka, J (2002) Unusual binding mode of an HIV-1 protease inhibitor explains its potency against multi-drug-resistant virus strains J Mol Biol 324, 739–754 24 Yoshimura, K., Kato, R., Kavlick, M.F., Nguyen, A., Maroun, V., Maeda, K., Hussain, K.A., Ghosh, A.K., Gulnik, S.V., Erickson, J.W & Mitsuya, H (2002) A potent human immunodeficiency virus type protease inhibitor, UIC- 94003 (TMC-126), and selection of a novel (A28S) mutation in the protease active site J Virol 76, 1349–1358 25 Hidaka, K., Kimura, T., Hayashi, Y., McDaniel, K.F., Dekhtyar, T., Colletti, L & Kiso, Y (2003) Design and synthesis of pseudosymmetric HIV protease inhibitors containing a novel hydroxymethylcarbonyl (HMC)-hydrazide isostere Bioorg Med Chem Lett 13, 93–96 26 Alterman, M., Bjorsne, M., Muhlman, A., Classon, B., Kvarnstrom, I., Danielson, H., Markgren, P.O., Nillroth, U., Unge, T., Hallberg, A & Samuelsson, B (1998) Design and synthesis of new potent C2-symmetric HIV-1 protease inhibitors Use of 1-man- 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 naric acid as a peptidomimetic scaffold J Med Chem 41, 3782– 3792 Alterman, M., Andersson, H.O., Garg, N., Ahlsen, G., Lovgren, S., Classon, B., Danielson, U.H., Kvarnstrom, I., Vrang, L., Unge, T., Samuelsson, B & Hallberg, A (1999) Design and fast synthesis of C-terminal duplicated potent C(2)-symmetric P1/P1¢modified HIV-1 protease inhibitors J Med Chem 42, 3835–3844 Nillroth, U., Vrang, L., Markgren, P.O., Hulten, J., Hallberg, A & Danielson, U.H (1997) Human immunodeficiency virus type proteinase resistance to symmetric cyclic urea inhibitor analogs Antimicrob Agents Chemother 41, 2383–2388 Weislow, O.S., Kiser, R., Fine, D.L., Bader, J., Shoemaker, R.H & Boyd, M.R (1989) New soluble-formazan assay for HIV-1 cytopathic effects: application to high-flux screening of synthetic and natural products for AIDS: antiviral activity J Natl Cancer Inst 81, 577–586 Otwinowski, Z & Minor, W (1997) Processing of x-ray diffraction data collected in oscillation mode Methods Enzymol 276, 307–326 Gewirth, D & Otwinowski, Z (1995) The SCALEPACK Manual, available from http://www.dl.ac.uk/SRS/PX/jwc_external/ abs_denzo_suite.html Brunger, A.T., Adams, P.D., Clore, G.M., Delano, W.L., Gros, ă P., Grosse-Kunstleve, R.W., Jiang, J.-S., Kuszewski, J., Nilges, N., Pannu, N.S., Read, R.J., Rice, L.M., Simonson, T & Warren, G.L (1998) Crystallography and NMR system (CNS): a new software system for macromolecular structure determination Acta Crystallogr D54, 905–921 Jones, T.A., Zou, J.-Y., Cowan, S.W & Kjeldgaard, M (1991) Improved methods for building protein models in electron density maps and the location of errors in these models Acta Crystallogr A 47, 110–119 Brunger, A.T., Kuriyan, J & Karplus, M (1987) Crystallographic ă R factor renement by molecular dynamics Science 235, 458–460 Kleywegt, G.J & Brunger, A.T (1996) Checking your imaginaă tion: applications of the free R value Structure 4, 897–904 Guex, N & Peitsch, M.C (1997) SWISS-MODEL and the SwissPdbViewer: an environment for comparative protein modeling Electrophoresis 18, 2714–2723 Vondrasek, J., van Buskirk, C.P & Wlodawer, A (1997) Database of three-dimensional structures of HIV proteinases Nat Struct Biol 4, Wlodawer, A & Gustchina, A (2000) Structural and biochemical studies of retroviral proteases Biochim Biophys Acta 1477, 16–34 Silva, A.M., Cachau, R.E., Sham, H.L & Erickson, J.W (1996) Inhibition and catalytic mechanism of HIV-1 aspartic protease J Mol Biol 255, 321–346 Dreyer, G.B., Boehm, J.C., Chenara, B., DesJarlais, R.L., Hassell, A.M., Meek, T.D., Tomaszek, T.A Jr & Lewis, M (1993) A symmetric inhibitor binds HIV-1 protease asymmetrically Biochemistry 32, 937–947 Bone, R., Vacca, J.P., Anderson, P.S & Holloway, M.K (1991) X-ray crystal structure of the HIV protease complex with L-700,417, an inhibitor with pseudo C2 symmetry J Am Chem Soc 113, 9382–9384 Turner, B.G & Summers, M.F (1999) Structural biology of HIV J Mol Biol 285, 1–32 Mager, P.P (2001) The active site of HIV-1 protease Med Res Rev 21, 348–353 Ren, S & Lien, E.J (2001) Development of HIV protease inhibitors: a survey Prog Drug Res Spec No 1–34 Ala, P.J., DeLoskey, R.J., Huston, E.E., Jadhav, P.K., Lam, P.Y., Eyermann, C.J., Hodge, C.N., Schadt, M.C., Lewandowski, F.A., Weber, P.C., McCabe, D.D., Duke, J.L & Chang, C.H (1998) Molecular recognition of cyclic urea HIV-1 protease inhibitors J Biol Chem 273, 12325–12331 Ó FEBS 2003 1758 H O Andersson et al (Eur J Biochem 270) 46 Alterman, M., Sjobom, H., Safsten, P., Markgren, P.O., Danielson, U.H., Hamalainen, M., Lofas, S., Hulten, J., Classon, B., Samuelsson, B & Hallberg, A (2001) P1/P1¢ modified HIV protease inhibitors as tools in two new sensitive surface plasmon resonance biosensor screening assays Eur J Pharm Sci 13, 203– 212 47 Lam, P.Y.S., Jadhav, P.K., Eyermann, C.J., Hodge, C.N., Ru, Y., Bacheler, L.T., Meek, J.L., Otto, M.J., Rayner, M.M., Wong, Y.N., Chang, C.-H., Weber, P.C., Jackson, D.A., Sharpe, T.R & Erickson-Viitanen, S (1994) Rational design of potent, bioavailable, nonpeptide cyclic ureas as HIV protease inhibitors Science 263, 380–384 48 Lam, P.Y., Ru, Y., Jadhav, P.K., Aldrich, P.E., DeLucca, G.V., Eyermann, C.J., Chang, C.H., Emmett, G., Holler, E.R., Daneker, W.F et al (1996) Cyclic HIV protease inhibitors: synthesis, conformational analysis, P2/P2¢ structure-activity relationship, and molecular recognition of cyclic ureas J Med Chem 39, 3514– 3525 49 Hulten, J., Bonham, N.M., Nillroth, U., Hansson, T., Zuccarello, G., Bouzide, A., Aqvist, J., Classon, B., Danielson, U.H., Karlen, A., Kvarnstrom, I., Samuelsson, B & Hallberg, A (1997) Cyclic HIV-1 protease inhibitors derived from mannitol: synthesis, inhibitory potencies, and computational predictions of binding affinities J Med Chem 40, 885–897 50 Hulten, J., Andersson, H.O., Schaal, W., Danielson, H.U., Classon, B., Kvarnstrom, I., Karlen, A., Unge, T., Samuelsson, B & 51 52 53 54 55 56 57 Hallberg, A (1999) Inhibitors of the C(2)-symmetric HIV-1 protease: nonsymmetric binding of a symmetric cyclic sulfamide with ketoxime groups in the P2/P2¢ side chains J Med Chem 42, 4054–4061 Wang, H & Ben-Naim, A (1996) A possible involvement of solvent-induced interactions in drug design J Med Chem 39, 1531–1539 Mattos, C (2002) Protein–water interactions in a dynamic world Trends Biochem Sci 27, 203–208 Bhat, T.N., Bentley, G.A., Boulot, G., Greene, M.I., Tello, D., Dall’Acqua, W., Souchon, H., Schwarz, F.P., Mariuzza, R.A & Poljak, R.J (1994) Bound water molecules and conformational stabilization help mediate an antigen–antibody association Proc Natl Acad Sci USA 91, 1089–1093 Ladbury, J.E (1996) Just add water! The effect of water on the specificity of protein-ligand binding sites and its potential application to drug design Chem Biol 3, 973–980 Engh, R.A & Huber, R (1991) Accurate bond and angle parameters for X-ray protein structure refinement Acta Crystallogr A 47, 392–400 Kleywegt, G.J & Jones, T.A (1999) Software for handling macro molecular envelopes Acta Crystallogr D55, 941–944 Kleywegt, G.J & Jones, T.A (1997) Detecting folding motifs and similarities in protein structures Methods Enzymol 277, 525–545  ... natural protein substrate, the inhibitors, including the symmetric ones, tend to bind in an asymmetric fashion [40,42] Compounds 3, and were made in order to exploit the asymmetric binding Electron... in? ??uences the positioning of the inhibitor in the active site and thereby the structure of the protease Ó FEBS 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1749 Table Inhibitor... 2003 Optimization of HIV-1 protease inhibitors (Eur J Biochem 270) 1747 forms of the protease have been studied with respect to kinetic and resistance properties [22] New generations of mainly asymmetric