Báo cáo khoa học: Subunit composition of the glycyl radical enzyme p-hydroxyphenylacetate decarboxylase doc

Subunit composition of the glycyl radical enzyme p -hydroxyphenylacetate decarboxylase A small subunit, HpdC, is essential for catalytic activity Paula I. Andrei 1 , Antonio J. Pierik 1 , Stefan Zauner 2 , Luminita C. Andrei-Selmer 3 and Thorsten Selmer 1 1 Laboratorium fu ¨ r Mikrobiologie, Fachbereich Biologie, Philipps-Universita ¨ t, Marburg, Germany; 2 Institut fu ¨ r Zellbiologie und angewandte Botanik, Fachbereich Biologie, Philipps-Universita ¨ t, Marburg, Germany; 3 Institut fu ¨ r Klinische Immunologie und Transfusionsmedizin, Justus-Liebig Universita ¨ t Giessen, Germany p-Hydroxyphenylacetate decarboxylase from Clostridium difficile catalyses the decarboxylation of p-hydroxyphenyl- acetate to yield the cytotoxic compound p-cresol. The three genes encoding two subunits of the glycyl-radical enzyme and the activating enzyme have been cloned and expressed in Escherichia coli. The recombinant enzymes were used to reconstitute a catalytically functional system in vitro.In contrast with the decarboxylase purified from C. difficile, which was an almost inactive homo-dimeric protein (b 2 ), the recombinant enzyme was a hetero-octameric (b 4 c 4 ), cata- lytically competent complex, which was activated using endogenous activating enzyme from C. difficile or recom- binant activating enzyme to a specific activity of 7 UÆmg )1 . Preliminary results suggest that phosphorylation of the small subunit is responsible for the change of the oligomeric state. These data point to an essential function of the small subunit of the decarboxylase and may indicate unique regulatory properties of the system. Keywords: Clostridium difficile; cresol; glycyl radical enzymes; S-adenosyl-methionine radical enzymes; Tanne- rella forsythensis. Clostridium difficile is a spore forming, strict anaerobic bacterium that causes gastrointestinal infections in humans ranging from asymptomatic colonization to severe diar- rhoea, pseudomembranous colitis, toxic megacolon, colon perforation and occasionally death [1]. C. difficile-associated diarrhoea is very common in hospitalized patients, partic- ularly after the normal intestinal flora has been disturbed by an antibiotic or an antineoplastic treatment [2,3]: the normal gut microbiota has to be disrupted before C. difficile infection can become established. The production of toxic fermentation end products may allow an ongoing suppres- sion of the endogenous microflora and therefore may play an important role in the progression of the disease. The formation and tolerance of p-cresol by C. difficile as the end product of tyrosine fermentation is well known [4,5]. The enzyme responsible is p-hydroxyphenylacetate decarb- oxylase (Hpd, E.C. 4.1.1 ) [6] which was previously purified in an almost inactive state [7]. Based on the N-terminal amino acid sequence of the protein, an ORF was detected in the unfinished genome of C difficile strain 630 provided by the C. difficile Sequencing Group at the Sanger Center. The encoded 902-amino acid protein was most similar to pyruvate formate lyase-like proteins of unknown function and showed a typical glycyl radical consensus sequence motif (VRVAGF) in the C-terminal region. Moreover, the decarboxylase gene (hpdB) was located in a putative operon together with a gene encoding an activating enzyme (hpdA), which is required to form the kinetically stable glycyl radical in the active enzyme. In this communication we report the identification of a hitherto unknown small subunit (HpdC) of the decarboxy- lase, which is essential for catalytic activity and may provide the unique regulatory properties of the Hpd system. Materials and methods Materials C. difficile (DSM 1296 T ) was purchased from the German Collection of Micro-organisms and Cell Cultures (DSMZ, Braunschweig, Germany). Escherichia coli strains and plasmids were obtained from commercial sources. Chemi- cals were purchased from commercial sources and were of the highest grade available. Organisms and cultivation C. difficile was cultivated as described previously [7]. Unless otherwise stated, E. coli strains were grown on Luria– Bertani (LB) agar plates or LB media supplemented with the required antibiotics at 28–30 °C. Correspondence to T. Selmer, Laboratorium fu ¨ r Mikrobiologie, Fachbereich Biologie, Philipps-Universita ¨ t, Karl-von-Frisch Str., D-35032 Marburg, Germany. Fax: + 49 6421 2828979, Tel.: + 49 6421 2825606, E-mail: selmer@staff.uni-marburg.de Abbreviations: LB, Luria–Bertani; Hpd, p-hydroxyphenylacetate decarboxylase; SAM, S-adenosyl-methionine; TFA, trifluoroacetic acid; RBS, ribosome binding sites. Enzymes: p-Hydroxyphenylacetate decarboxylase (EC 4.1.1 ); pyruvate formate lyase (EC 2.3.1.54); ribonucleotide reductase (EC 1.17.4.1); benzylsuccinate synthase (EC 4.1 ). (Received 8 January 2004, revised 15 March 2004, accepted 6 April 2004) Eur. J. Biochem. 1–6 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04152.x Cloning and sequencing of the genes The individual cloning steps were carried out in E. coli DH5a or GM 2159 strains. Genomic DNA of C. difficile strain DSM 1296 T was used as a template for PCR amplification of the hpd-genes. The primers were deduced from the genomic sequence provided by the Sanger Centre C. difficile Sequencing Group (http://www.sanger.ac.uk/ Projects/C_difficile/blast_server.shtml). KpnIandClaI endonuclease cleavage sites were introduced upstream and downstream of the coding sequence in order to facilitate cloning (Table 1). To minimize PCR errors, a Hi-Fidelity DNA polymerase (Hi-Fidelity-PCR Enzyme mix, Abgene) was used. The amplified hpdA and hpdB genes were cloned into pBluescript II SK(+) (Stratagene). Three clones of three individual PCR products were sequenced from double-stranded DNA in order to obtain the type strain sequences. The hpdC gene was sequenced directly using the PCR product as template. In order to allow an in-frame cloning of the individual genes in expression vectors, mutagenic primers were used to introduce suitable cleavage sites at the start codon and downstream of the stop codon. These primers were used to amplify the desired gene from genomic DNA by PCR and the fragments were inserted into pET11a, pET11d (Nov- agen) or pASK-IBA7 vectors (Institut fu ¨ r Bioanalytik, Go ¨ ttingen, Germany). The resulting clones were sequenced on both strands and PCR artefacts were replaced with corresponding DNA from other clones. The resulting clones were designated pET-D3 (hpdB), pET-A4 (hpdA), pASK- A2 (hpdA) and pET-X1 (hpdC). The vector for the coexpression of hpdBandhpdC (pET- DX4) was obtained from a PCR of genomic DNA using the primers sDecNheI and InterCterBamHI (Table 1). The fragment was cloned in pET11a vector and DNA without mutations in the 3¢-end of hpdB and the entire hpdC gene wasusedtoreplaceaStuI/BamHI fragment in pET-D3. Production of HpdB and HpdC in E. coli The expression plasmids were used to transform several E. coli host strains including DH5a [8] GM2159 [9], BL21 TM (DE3) Codon Plus-RIL (Stratagene), Tuner TM (DE3)pLysS and Rosetta TM (DE3)pLysS (Novagen). The growth conditions (media, temperature, oxygen) and the concentration of the inducers were varied in order to establish optimal conditions for the production of soluble proteins. HpdB/C and HpdC were produced by E. coli BL21 TM (DE3) Codon Plus-RIL harbouring pET-DX4 and pET-X1 plasmids, respectively. The cells were grown aerobically in LB medium supplemented with glucose (0.2%), carbenicil- lin (100 lgÆmL )1 ) and chloramphenicol (50 lgÆmL )1 )at 28–30 °C (pET-DX4) and 37 °C (pET-X1). Isopropyl thio-b- D -galactoside was added (1 m M )atD 578 of 0.5–0.8. After 3 h the cells were collected by centrifugation and stored frozen at )20 °C. Purification of HpdB and HpdB/C All purification steps were performed in an anoxic chamber (Coy Laboratories, Ann Arbor, MI, USA) in a N 2 /H 2 (95%/5%) atmosphere at 15–20 °C. Hpd was purified from freshly prepared cells of C. diff- icile (2–2.5 g) essentially as described previously [7]. How- ever, the DEAE-Sepharose column used in the earlier preparations was omitted and the Resource-Q column was replaced by a Source 15Q (1.6/20 cm) column. The HpdB/C complex was purified from aerobically induced E. coli BL21 TM (DE3) Codon Plus-RIL/pET-DX4. The cell pellet (3.0 g) was washed with buffer A [100 m M Tris/HCl pH 7.5, 5 m M (NH 4 ) 2 SO 4 ,1m M MgCl 2 ,0.5m M sodium dithionite, 20 l M ATP] and resuspended in 25 mL uffer A. The cell suspension was sonicated at 50 W, for 4 · 5 min with a Branson sonifier (Branson Ultrasonics, Danbury, CT, USA) on ice. Cell debris and membranes were removed by centrifugation (100 000 g,60min).The supernatant was loaded on a Resource-Q column (6 mL), which was equilibrated with buffer A. The decarboxylase complex was eluted in a linear gradient of 0–450 m M NaCl in 120 mL buffer A. The fractions containing HpdB/C were concentrated using a Vivapure device with a 100 kDa cut- off membrane (Vivascience, Germany) and loaded on a prepacked Superdex 200 HR 10/30 gel filtration column. The column was run in 150 m M NaCl in buffer A. The elution and purity of the proteins were monitored by Table 1. Amplification primers. s, Sense-strand; as, antisense-strand. Name Nucleotide sequence (5 fi 3¢) Recognition site DCNtermKpnI ATTCTGGTACCGTTTTATACTAATTATAGAAAGATTAAGG KpnI DCCtermClaI AAATTCAATCGATCACTATGCTTTCTCATATTTTACACC ClaI sDecNheI GAAATGGCTAGCAGTAAAGAAGACAAAATAAG NheI asDCBamHI ATGCTTTCTCGGATCCTACACCCCTTCATACTCTGTTCTAGC BamHI ActNtermKpnI TGTGTTGGTACCGAGAAAGAAGACTGGG KpnI ActCtermClaI TATTTATCGATAAAAACCACATAAAAAAGG ClaI ActNterNheI GTGTTTAATGGCTAGCCAAAAGCAATTAGAAGGC NheI ActCterBamHI CTTGTATTGGATCCTAGAAAGCTGTCTCATGACC BamHI ActSacII GGACATCCGCGGTATGAGTAGTCAAAAGC SacII InterNterm CAATTAATGGTACCTGTTGCTGGGTTTACTCAATATTGG KpnI InterCterm CCTTCTAATCGATTTTGACTACTCATTAAACACATGCC ClaI InterNterNcoI GTGTAAACCATGGGAAAGCATAGTGATTGTATG NcoI InterCterBamHI CTTCTGGATCCTTTTGACTACTCATTAAAC BamHI 2 P. I. Andrei et al. (Eur. J. Biochem.) Ó FEBS 2004 SDS/PAGE with Coomassie blue staining and the purified enzyme was stored anaerobically at 4 °C. Production of HpdA HpdA was produced anaerobically by E. coli GM 2159 harbouring the pASK-A2 plasmid in LB medium supple- mented with 0.2% glucose and carbenicillin (100 lgÆmL )1 ) at 30 °C. The production of HpdA was induced at D (578nm) of 0.35–0.5 with anhydrotetracycline (50 lgÆL )1 ) for 20 h. During the first 6 h of induction, the pH was maintained at 7.5 by addition of 10 M NaOH. Cells were harvested and the protein was immediately purified. Purification of recombinant HpdA HpdA was purified in an anoxic chamber using 5 mL StrepTactin Ò Sepharose columns. Wet packed cells (3.5– 5.0 g) were suspended in buffer B (20 mL) containing 100 m M Tris/HCl pH 8, 150 m M NaCl, 5 m M dithiothre- itol, and homogenized by sonication. Cell debris was removed by centrifugation (60 min at 100 000 g). The clear supernatant was applied onto the column equilibrated with buffer B. Non-bound protein was washed off with buffer B prior to elution of HpdA with desthiobiotin (2.5 m M )in buffer B. The enzyme was concentrated in 2 mL Vivaspin centrifugation devices with a cut-off of 10 kDa (final concentrations > 1 mgÆmL )1 ) and stored anoxically at )20 °C. Reconstitution of the Hpd activity in vitro All reconstitution steps were carried out under strict anoxic conditions. The recombinant HpdB/C was tested for catalytic competence using endogenous HpdA in cell-free extracts of C. difficile. Therefore, cell-free extracts from C. difficile and E. coli Bl21 TM (DE3) Codon Plus-RIL/pET- DX4 (85 lgÆmL )1 and 28 lgÆmL )1 total protein, respect- ively) were incubated at 30 °C in 100 m M Tris/HCl pH 7.5, 5m M (NH 4 ) 2 SO 4 ,1m M MgCl 2 ,0.5m M sodium dithionite, with 20 m M p-hydroxyphenylacetate and 0.23 m M S-aden- osyl-methionine (SAM). At defined time points samples were withdrawn and analysed for p-cresol formation as described previously [7]. Controls omitting any of the essential components (HpdA, HpdB/C or SAM) were analysed in parallel assays. p-Hpd activity was also reconstituted with purified recombinant proteins. Pure HpdA (3.8 lg) was reduced for 3 h in the presence of 0.5 m M sodium dithionite, 0.57 m M SAM and 17 lg HpdB/C in a final volume of 100 lL100m M Tris/HCl pH 7.5, 5 m M (NH 4 ) 2 SO 4 ,5m M dithiothreitol, 1 m M MgCl 2 (100 lL) at 4 °C. To follow the decarboxylation, 25 m M substrate (1 mL) was added. Aliquots were taken at defined time points and assayed for p-cresol formation by HPLC as described previously [7]. MALDI-TOF MS of HpdC Partially purified decarboxylase from C. difficile and recom- binant HpdB/C were acidified with trifluoroacetic acid (TFA). The supernatant was subjected to solid phase extraction using 50 mg-Sep-PakÒ Vac C18-cartridges (Waters) equilibrated with 0.1% TFA. The columns were washed twice with 1 mL 0.1% TFA and eluted with 0.1% TFA/67% acetonitrile. The samples thus obtained (1 lL) were mixed on a gold-plated target with 1 lL of a saturated solution of sinapinic acid in 0.1% TFA/67% acetonitrile and dried under air. The samples were analysed using a Voyager-DE/RP-MALDI-TOF MS in reflector mode. Determination of relative molecular masses of the native enzymes The apparent molecular masses of the native 4-Hpd was determined by gel filtration on a Superdex 200 HR 10/30 prepacked column, equilibrated with 150 m M NaCl in buffer A. Ribonuclease A from bovine pancreas (13.7 kDa), chymotrypsinogen A from bovine pancreas (27 kDa), ovalbumin from hen egg (43 kDa), albumin from bovine serum (67 kDa), aldolase from rabbit muscle (158 kDa), ferritin from horse spleen (440 kDa) and thyroglobulin from bovine thyroid (669 kDa) were used as molecular mass marker proteins (Amersham Biosciences, Germany.) Other methods Protein concentrations were determined using the Bradford procedure [10]. Results Based on the N-terminal amino acid sequence of purified HpdB, a putative operon was identified in the genome of C. difficile strain 630, which encoded both the glycyl radical subunit of the decarboxylase (HpdB) and its activating enzyme (HpdA). A detailed analysis of the sequence taking into account putative ribosome binding sites (RBS) estab- lished a third ORF (hpdC) located between hpdB and hpdA (Fig. 1). During the initial purification of the decar- boxylase from C. difficile this small protein (85 amino acids, 9.5 kDa) was overlooked. However, the low activity yield of the purification was attributed to the loss of a low molecular mass cofactor [6,7]. Based on the genomic DNA sequence of C. difficile strain 630, specific primers were deduced in order to amplify the genes encoding the two putative decarboxylase subunits and its activase by PCR from genomic DNA of the type strain DSM 1296 T . The type strain sequences have been deposited in the EMBL Nucleotide Sequence Database under the accession numbers AJ543425 (hpdB), AJ543426 (hpdC)and AJ543427 (hpdA). Within the hpdB gene, nine nucleotides were exchanged between the type strain and strain 630, but only two of these replacements changed the amino acid sequence (M670I and E806D). The gene of the small subunit (hpdC) contained two exchanged nucleotides, which were silent at the amino acid level. In hpdA, one nucleotide differed, leading to one amino acid exchange (I165V). The recombinant proteins were produced in E. coli from inducible expression vectors. Suitable endonuclease cleavage sites were introduced by PCR mutagenesis in order to allow in-frame cloning of the genes. While the BamHI sites introduced in the 3¢-UTR of the genes did not affect the resulting amino acid sequences, the introduction of NheIor NcoI sites next to the start codon altered the N-terminal Ó FEBS 2004 Subunit composition of p-Hpd (Eur. J. Biochem.)3 sequences of the resulting proteins (MSQS to MASS in HpdB, MRKH to MGKH in HpdC and MSSQ to MASQ in HpdA). In contrast with the hpdC gene product, which was produced in a variety of host cells as a soluble protein, HpdB and HpdA were synthesized only in Rosetta TM (DE3)pLysS and BL21 TM (DE3) Codon Plus-RIL cells. These hosts produce additional rare tRNAs and therefore support the expression of AT-rich genes such as hpdAand hpdB. Although strongly induced by isopropyl thio-b- D -galactoside, the proteins were produced as inclusion bodies. Neither variations in induction procedure nor media nor temperature yielded soluble protein (data not shown). The coexpression of hpdB and hpdC was achieved from a pET11a-derived expression clone, which contained both genes. In order to obtain this clone, the 3¢-region of hpdB and the hpdC gene were introduced into the existing clone of hpdB in pET11a. The resulting plasmid contained the vector-derived RBS and 5¢-UTR in front of the hpdB gene but the clostridial RBS and 5¢-UTR in front of hpdC. Expression of this construct in E. coli BL21 TM (DE3) Codon Plus-RIL was efficient for both polypeptides and resulted in soluble protein. Though no formation of p-cresol was observed in cell-free extracts from E. coli coexpressing hpdB and hpdC,a catalytically competent protein was produced. As shown in Fig. 2, the decarboxylase was rapidly activated by HpdA from cell-free extracts of C. difficile yielding a specific activity of 90 mUÆmg )1 corrected for an almost negligible background activity of the C. difficile extract, demonstra- ting the production of a functional recombinant enzyme. While strict anoxic conditions were required to achieve activation, the process was equally effective for cell-free extracts containing HpdB/C prepared from aerobically or anaerobically grown cells. No p-cresol formation was detected in the Resource-Q fractions containing separated subunits HpdB or HpdC. These results show that HpdC is essential for p-cresol formation and establish this polypep- tide as a subunit of p-Hpd. The decarboxylase was originally purified from cell-free extracts of C. difficile by successive anion exchange chro- matography on DEAE-Sepharose and Resource-Q fol- lowed by size exclusion chromatography on Superdex 200 [7]. The DEAE Sepharose column led to a loss of 95% of the activity and was therefore omitted throughout this work without significantly affecting purity. The presence of both HpdB and HpdC in these preparations was demonstrated both on SDS/PAGE and by MALDI-TOF MS (see below) and < 10% of the initial activity was lost in the first step. Gel filtration, however, led to a separation of the subunits and the final activities were found to be similar to those reported previously (< 0.5 UÆmg )1 ). The recombinant decarboxylase eluted from the anion exchange column in a similar position to the enzyme from C. difficile. In contrast, the behaviour of this enzyme on the size exclusion chromatography column was surprisingly different: The nonactivated homo-dimeric decarboxylase (eluting at  15 mL) was found only in poor yields and essentially free of HpdC (Fig. 3). The majority of the recombinant decarboxylase eluted at  12 mL, indicating a native molecular mass of 460 kDa. As judged by SDS/ PAGE, this protein was composed of HpdB and HpdC polypeptides. The relative intensities of the bands were estimated by scanning and quantified using the Molecular Dynamic IMAGEQUANT 5.2 program. The ratio of HpdB(b)/ HpdC(c) was corrected for the different sizes and found to be 1 : 1, indicating an b 4 c 4 composition in a hetero- octameric complex. Both the protein preparations from C. difficile and the recombinant ones were analysed by MALDI-TOF MS. Since the fully purified enzyme from C. difficile was essentially free of HpdC, partially purified enzyme obtained from Source 15Q anion exchange column was subject to a solid phase extraction procedure. The molecular mass observed for HpdC in these preparations was Fig. 2. Activation of the recombinant HpdB/C complex. Cell-free extract from C. difficile (85 lgÆmL )1 )wasincubatedat30°Cinthe presence of 20 m M pHPA, in the absence (d)orpresence(s)of 0.23 m M SAM. In the presence of E. coli extract containing HpdB/C (n), a rapid activation of the recombinant decarboxylase was observed. The activation was strictly dependent on the endogenous HpdA from C. difficile and SAM (data not shown). Fig. 1. Location of the hpdC gene. Potential clostridial ribosomal binding sites are boxed and the start codons are shaded grey. The amino acid sequence of HpdC is shown in bold letters together with the C-terminal end of HpdB and the N-terminal of HpdA. 4 P. I. Andrei et al. (Eur. J. Biochem.) Ó FEBS 2004 9508 ± 9 Da. This value is in good agreement with the predicted molecular mass of 9504 Da for HpdC. The mass spectrum of recombinant HpdC was strikingly different: in addition to a signal indicating a molecular mass of 9510 ± 9 Da, a second signal with equal intensity was observed at 9590 ± 9 Da. The 80-Da mass increment between the two signals suggests a possible phosphorylation of the small subunit in this enzyme, which could account for the different oligomeric states. The recombinant activase was produced as an N-terminally streptavidin-tagged protein and purified to apparent homogeneity by affinity chromatography on StrepTactinÒ Sepharose under strict anoxic conditions (Fig. 4). The final preparation was deep brown, indicating the expected presence of iron–sulfur clusters in the enzyme. Size exclusion chromatography showed HpdA to be a monomeric enzyme that was determined to contain 7–8 mol of iron and 6–7 mol of acid labile sulfur per mol of enzyme. The E. coli extracts containing the recombinant activator catalytically activated the recombinant decarboxylase to yield specific activities of > 7 UÆmg )1 .However,after purification of the recombinant enzymes, the efficiency of the activating process dropped dramatically yielding specific activities of below 1.5 UÆmg )1 . This level of activity was achieved only with a large molecular excess of the activating enzyme (HpdA/HpdB/C ¼ 10 : 1). Discussion Initial attempts to purify p-Hpd from C. difficile [6] were unsuccessful. Later, the decarboxylase was isola- ted ) though almost inactive ) as a homodimer of the HpdB subunits [7]. In both cases it was suggested that the low activity yield was due to the loss of a low molecular mass fraction of < 10 kDa during the purification. A closer analysis of the DNA sequence provided by the Sanger Center, taking into account the possible ribosomal binding sites, showed a third ORF, hpdC, located between the decarboxylase and the activase genes. The hpdC gene starts directly downstream of the decarboxylase gene (hpdB), and overlaps the 5¢-region of hpdA. It encodes an 85-amino acid, cysteine rich polypeptide (9.4% cysteine). In contrast with the well-studied glycyl radical enzymes pyruvate formate-lyase and class III ribonucleotide reductase, which are homodimeric enzymes (for review see [11,12]), the findings reported in this paper suggest a hetero-oligomeric structure of the decarboxylase in the catalytically competent enzyme. A hetero-oligomeric structure has been described for the benzylsuccinate synthase of Thauera aromatica and related organisms [13,14]. Whereas the small subunits form a stable complex with the glycyl radical subunit in benzyl- succinate synthase and therefore copurify, the complex of HpdB and HpdC is apparently much weaker and rapidly dissociates during the purification. The first evidence for an important structural function of HpdC in the decarboxylase arose from the observation that HpdB produced by E. coli/pET-D3 exclusively yielded insoluble protein, whereas coexpression of hpdB and hpdC gave a soluble, catalytically competent enzyme, which was smoothly activated by cell-free extracts of C. difficile. An important, probably regulatory function of HpdC became evident during the purification of the recombinant protein. The molecular mass data immediately suggested a phosphorylation of HpdC, which could affect the oligo- meric structure and complex stability of the decarboxylase. Since recombinant HpdC is not phosphorylated when produced by E. coli/pET-X1 plasmid (data not shown), it seems very likely that its phosphorylation is a catalytic property of the HpdB subunit. Indeed, a Prosite motif scan of the HpdB amino acid sequence revealed the presence of a P-loop ATP-binding motif (PS00017, [AG]-x(4)-G-K-[ST]) comprising amino acids 181–188 (AKEWVGKS) [15]. However, at present it is not possible to exclude an artificial origin for this modification in E. coli and further analysis of this putative phosphorylation will be required in order to establish its functional relevance. A correlation between glycyl radical concentration and Ævolume activity for partially purified enzyme from C. diff- icile, containing the HpdC subunit, allowed an estimate for the specific activity of about 50 UÆmg )1 in a fully active Fig. 4. Purification of HpdA from E. coli cells expressing Strep-tagged hpdA. The samples were separated by SDS/PAGE and stained with Coomassie blue. Cell-free extracts of noninduced cells (NI), induced cells (I) and the affinity purified product (HpdA) are shown (S: standard proteins). Fig. 3. Purification of HpdB/C from E. coli coexpressing hpdB and hpdC. The SDS/PAGE analysis of an elution profile from a Superdex 200 column is shown. Consecutive fractions of the 450-kDa (15–17) and the 200-kDa (24–27) region were analysed by SDS/PAGE and Coomassie blue staining. Cell-free extracts of noninduced (NI) and induced (I) cells and partially purified enzyme from the Resource-Q column (R) are shown for comparison. Molecular masses of standard proteins (S) and the positions of HpdB and HpdC are indicated. Ó FEBS 2004 Subunit composition of p-Hpd (Eur. J. Biochem.)5 decarboxylase with one radical site per HpdB dimer. The recombinant, octameric complex of HpdB and HpdC is smoothly activated using either endogenous HpdA from C. difficile extracts or recombinant HpdA from E. coli extracts. The specific activity of the recombinant decarb- oxylase is higher (7 UÆmg )1 ) than the highest activity observed for the homo-dimeric enzyme purified from C. difficile (< 0.5 UÆmg )1 ), but is still significantly lower than the estimated maximum value. These findings suggest that the recombinant decarboxylase and the recombinant activating enzyme are functional; however, the reconstitu- tion of the system using individually purified enzymes in vitro is difficult due to an essential requirement for an as yet unknown factor present in the cell extracts of both C. difficile and E. coli. Apparently, this factor is lost during purification and limiting when cell-free extracts are used to restore activity (P. I. Andrei and M. Blaser, unpublished data), suggesting that higher specific activities might be obtained by providing the missing compound. Interestingly, a small fraction of the recombinant decarb- oxylase dissociated during the purification. While the resulting homo-dimers of nonactivated HpdB thus obtained remained soluble and have been purified, all attempts to detect activity in these preparations failed. It will be interesting to establish whether the glycyl radical formation by HpdA is possible with this form or whether it inhibits this reaction with the functional complex. The function of HpdC remains to be established, but the data presented strongly suggest that this small subunit is essential for catalytic activity and may play an important role in regulation of the decarboxylase system. Indeed, the presence of this small subunit distinguishes the 4-Hpd from all other groups of glycyl radical enzymes. While several hundreds of putative glycyl radical enzymes are found in the finished and unfinished genomes of microbes, only one additional putative arylacetate decarboxylase has been found so far in the unfinished genome of the human pathogen Tannerella forsythensis ATCC 43037 (formerly named Bacteroides forsythus), the sequence for which can be obtained from http://tigrblast.tigr.org/ufmg/index.cgi?data base ¼ b_forsythus. The gene encoded amino acid sequence of a putative glycyl radical enzyme of this organism is highly similar (57% identity, 88% similarity) to HpdB and also has a small ORF encoding an 86-amino acid protein directly downstream. The amino acid sequence of this small protein is 33% identical and 58% similar to HpdC. Since T. forsythensis has very complex growth requirements and is therefore not accessible for metabolic testing in vivo, recom- binant production of this enzyme will be performed in order to study the properties of this new system and to compare its properties with those of the Hpd from C. difficile. Acknowledgements We are very grateful to Prof. Dr W. Buckel for his constant support throughout the project and to Dr Dan Darley for proof-reading the manuscript. We also like to thank the Max-Planck Institute for Terrestrial Microbiology for the access to MALDI-TOF MS and EPR. This work was supported by grants from the priority program ÔRadicals in Enzymatic CatalysisÕ of the Deutsche Forschungsgemeinschaft (DFG) and is dedicated to Prof. Dr Achim Kro ¨ ger. Prof. Dr Kro ¨ ger was a member of the reviewing panel of the priority program and died on 11 June 2002. References 1. Spencer, R.C. (1998) Clinical impact and associated costs of Clostridium difficile-associated disease. J. Antimicrob. Chemother. Suppl. C41, 5–12. 2. Fedorko, D.P., Engler, H.D., O’Shaughnessy, E.M., Williams, E.C., Reichelderfer, C.J. & Smith, W.I. Jr (1999) Evaluation of two rapid assays for detection of Clostridium difficile toxin A in stool specimens. J. Clin. Microbiol. 37, 3044–3047. 3. Borriello, S.P. & Wilcox, M.H. (1998) Clostridium difficile infec- tions of the gut: the unanswered questions. J. Antimicrob. Chemother. Suppl. C41, 67–69. 4. Elsden, S.R.H.M.G. & Waller, J.M. (1976) The end products of the methabolism of aromatic amino acids by Clostridia. Arch. Microbiol. 107, 283–288. 5. Hafiz, S. & Oakley, C.L. (1976) Clostridium difficile:isolationand characteristics. J. Med. Microbiol. 9, 129–136. 6. D’Ari, L. & Barker, H.A. (1985) p-Cresol formation by cell-free extracts of Clostridium difficile. Arch. Microbiol. 143, 311–312. 7. Selmer, T. & Andrei, P.I. (2001) p-Hydroxyphenylacetate decarboxylase from Clostridium difficile.Anovelglycylradical enzyme catalysing the formation of p-cresol. Eur. J. Biochem. 268, 1363–1372. 8. Sambrook, J. & Russell, D.W. (1989) Molecular cloning. A laboratory Manual, 3 edn, Cold spring harbor laboratory press, New York. 9. Parker, B. & Marinus, M.G. (1988) A simple and rapid method to obtain substitution mutations in Escherichia coli: Isolation of a dam deletion/insertion mutation. Gene 73, 531–535. 10. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. 11. Fontecave, M. (1998) Ribonucleotide reductases and radical reactions. Cell Mol. Life Sci. 54, 684–695. 12. Sawers, G. & Watson, G. (1998) A glycyl radical solution: oxygen- dependent interconversion of pyruvate formate-lyase. Mol. Microbiol. 29, 945–954. 13. Coschigano, P.W., Wehrman, T.S. & Young, L.Y. (1998) Identi- fication and analysis of genes involved in anaerobic toluene metabolism by strain T1: putative role of a glycine free radical. Appl. Environ. Microbiol. 64, 1650–1656. 14. Leuthner, B., Leutwein, C., Schulz, H., Horth, P., Haehnel, W., Schiltz, E., Schagger, H. & Heider, J. (1998) Biochemical and genetic characterization of benzylsuccinate synthase from Thauera aromatica: a new glycyl radical enzyme catalysing the first step in anaerobic toluene metabolism. Mol. Microbiol. 28, 615–628. 15. Walker, J.E., Saraste, M., Runswick, M.J. & Gay, N.J. (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1, 945–951. 6 P. I. Andrei et al. (Eur. J. Biochem.) Ó FEBS 2004 . the presence of this small subunit distinguishes the 4-Hpd from all other groups of glycyl radical enzymes. While several hundreds of putative glycyl radical. identified in the genome of C. difficile strain 630, which encoded both the glycyl radical subunit of the decarboxylase (HpdB) and its activating enzyme (HpdA).