Báo cáo khoa học: Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives pdf

Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives Elena J. Rossi 1,2, *, Lyann Sim 1,2, *, Douglas A. Kuntz 2 , Dagmar Hahn 3 , Blair D. Johnston 4 , Ahmad Ghavami 4 , Monica G. Szczepina 4 , Nag S. Kumar 4 , Erwin E. Sterchi 3 , Buford L. Nichols 5 , B. M. Pinto 4 and David R. Rose 1,2 1 Department of Medical Biophysics, University of Toronto, Canada 2 Division of Cancer Genomics and Proteomics, Ontario Cancer Institute, Canada 3 Institute of Biochemistry and Molecular Medicine, University of Berne, Switzerland 4 Department of Chemistry, Simon Fraser University, Burnaby, Canada 5 US Department of Agriculture, Agricultural Research Service, Baylor College of Medicine, Houston, TX, USA In the treatment of Type II (noninsulin-dependent) diabetes, management of blood glucose levels is crit- ical. One strategy is to delay digestion of ingested carbohydrates, thereby lowering postprandial blood glucose concentration [1]. This can be achieved by inhibiting the activity of pancreatic a-amylase, which mediates the hydrolysis of complex starches to oligo- saccharides, and ⁄ or membrane-bound intestinal a-glucosidases, which hydrolyze these oligosaccharides to glucose in the small intestine [1]. Carbohydrate ana- logues, such as acarbose (1) and miglitol (2) (Fig. 1) reversibly inhibit the function of these two groups of enzymes [2] resulting in delayed glucose absorp- tion into the blood and a smoothing or lowering of Keywords enzyme inhibition; family GH31; glucosidase; glycosyl hydrolase; salacinol Correspondence D. R. Rose, Ontario Cancer Institute, 101 College Street, Toronto, ON, M5G 1L7 Canada Fax: +416 581 7562 Tel: +416 581 7537 Email: drose@oci.utoronto.ca http://www.uhnresearch.ca/ *These authors contributed equally to this work (Received 5 January 2006, revised 11 April 2006, accepted 13 April 2006) doi:10.1111/j.1742-4658.2006.05283.x Inhibitors targeting pancreatic a-amylase and intestinal a-glucosidases delay glucose production following digestion and are currently used in the treatment of Type II diabetes. Maltase-glucoamylase (MGA), a family 31 glycoside hydrolase, is an a-glucosidase anchored in the membrane of small intestinal epithelial cells responsible for the final step of mammalian starch digestion leading to the release of glucose. This paper reports the produc- tion and purification of active human recombinant MGA amino terminal catalytic domain (MGAnt) from two different eukaryotic cell culture sys- tems. MGAnt overexpressed in Drosophila cells was of quality and quantity suitable for kinetic and inhibition studies as well as future structural stud- ies. Inhibition of MGAnt was tested with a group of prospective a-glucosi- dase inhibitors modeled after salacinol, a naturally occurring a-glucosidase inhibitor, and acarbose, a currently prescribed antidiabetic agent. Four synthetic inhibitors that bind and inhibit MGAnt activity better than acar- bose, and at comparable levels to salacinol, were found. The inhibitors are derivatives of salacinol that contain either a selenium atom in place of sulfur in the five-membered ring, or a longer polyhydroxylated, sulfated chain than salacinol. Six-membered ring derivatives of salacinol and compounds modeled after miglitol were much less effective as MGAnt inhibitors. These results provide information on the inhibitory profile of MGAnt that will guide the development of new compounds having antidiabetic activity. Abbreviations HPA, human pancreatic a-amylase; MGA, maltase glucoamylase; MGAnt, maltase glucoamylase N-terminal catalytic domain; pNP, para- nitrophenyl; SIM, sucrase isomaltase. FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS 2673 postprandial hyperglycemia [3,4] (Fig. 1). Because these inhibitors decrease both hyperglycemia and hyperinsulinemia, they reduce insulin resistance and stress on the beta-cells of the pancreas, thus preventing further insulin-dependent disorders [5–7]. Starch, one of the main digestible carbohydrates in the human diet, is composed of approximately 25% amylose and 75% amylopectin [9]. Mammalian starch digestion occurs in the lumen of the small intestine where the endoglycosidase a-amylase (EC 3.2.1.1) hydrolyzes the internal a-(1–4) linkages of starch while bypassing the a-(1–6) linkages of the amylopectin com- ponent. This hydrolysis yields both linear maltose oligosaccharides and branched isomaltose oligosaccha- rides, neither of which can be absorbed into the blood- stream without further processing [8]. These linear and branched oligosaccharides are hydrolyzed at the non- reducing end by maltase glucoamylase (MGA; E.C. 3.2.1.20 and 3.2.1.3) maltase glucoamylase and sucrase isomaltase (SIM; EC 3.2.1.48 and 3.2.1.10), respect- ively, to yield glucose [9]. MGA and SIM have over- lapping and complementary substrate specificities in Fig. 1. Inhibitors discussed in this paper: acarbose (1), miglitol (2), salacinol (3) and kotalanol (4); (5–7) are derivatives of salacinol with substi- tutions in the ring. (8–9) are ring expanded salacinol derivatives. (10)and(11) are miglitol derivatives. (12–15) are derivatives of salacinol with variations in the length and stereochemistry of the aliphatic chain. Figures in brackets indicate the degree of inhibition of MGAnt dependent maltose hydrolysis in the presence of 200 l M of inhibitor, when measured with 1 mM maltose as substrate. Glucose release was monitored using the glucose oxidase assay as described in Experimental procedures. Values are ± 10%. These conditions (1 ⁄ 4K m ) permitted a meas- urable effect from weak competitive inhibitors. Inhibition of human maltase glucoamylase E. J. Rossi et al. 2674 FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS starch digestion. SIM accounts for almost all sucrase activity, all isomaltase activity, and 80% of the maltase activity, while MGA accounts for all glucoamylase activity, 20% of the maltase activity, and 1% of the sucrase activity [10]. Together, these two enzymes form a complex in the epithelial cells of the small intestine and complete the hydrolysis of oligosaccharide chains in starch digestion. Human MGA encoded by the gene MGAM [8,11] is an a-glucosidase responsible for hydrolysis of a-1,4- linkages from the nonreducing end of maltose oligo- saccharides [9] and belongs to glycoside hydrolase family 31. It is type II membrane protein 1857 amino acids in length anchored in the brush border epithelial cells of the small intestine. MGA contains five distinct protein domains: a small cytosolic domain (26 amino acids) a transmembrane domain (20 amino acids), an O-glycosylated linker (or stalk) (55 amino acids), and two homologous (family GH31) catalytic domains (each 900 amino acids) [9]. The domain organization is illustrated schematically in Fig. 2. Each MGA cata- lytic domain contains a putative catalytic site made up of the amino acid sequence tryptophan-X-aspartate- methionine-asparagine-glutamate (WXDMNE), where X indicates a variable amino acid. This catalytic site is conserved in other human a-glucosidases and family 31 enzymes including SIM [12]. Human SIM is the clo- sest known homologue of hMGA, sharing 59% amino acid sequence identity, and is responsible for the hydro- lysis of branched a-1,6-linked oligosaccharides [8]. Due to its role in starch digestion, MGA has become an important inhibition target in the treatment of Type II diabetes. Although 1 and 2 (Fig. 1) are currently being used to treat Type II diabetes, they are accompanied by undesirable side-effects, including gastrointestinal and abdominal discomfort [2]. For this reason, there is a drive to identify alternative a-glucosi- dase inhibitors with greater potency and fewer side- effects. The naturally occurring glucosidase inhibitors salacinol (3) and kotalanol (4) (Fig. 1) have been iso- lated from Salacia reticulata, a plant native to Sri Lanka and India that has been used in the Ayurvedic system of medicine for the treatment of diabetes [13,14]. Compounds 3 and 4 (Fig. 1) may potentially have fewer long-term side-effects than other existing oral antidiabetic agents. Recent animal studies have shown that the oral ingestion of an extract from a S. reticulata trunk at a dose of 5000 mgÆkg )1 had no serious acute toxicity or mutagenicity in rats [15]. We have been active in the synthesis and biological evaluation of analogues of 3 (Fig. 1), differing in stereochemistry at the stereogenic centers, in ring- heteroatom substitution, and in ring size [16–22]. In vitro testing has revealed different inhibitory activ- ities of these compounds against different glycosidase enzymes [23,24]. In addition, 3, and the selenium ana- logue, blintol 5 (Fig. 1), have been shown to be very effective in controlling blood glucose levels in rats after a carbohydrate meal, thus providing lead candi- dates for the treatment of Type 2 diabetes [23]. In order to examine the mechanism of action of this class of inhibitors, 3, 5, the stereoisomers of salacinol 6, 7 [25], and the six-membered ring analogues of salacinol (8, 9) (N. S. Kumar and B. M. Pinto, unpublished results) were synthesized along with analogues of miglitol (10, 11) [22]. In view of the reported antiglucosidase activity of 4 [14], we also synthesized chain-extended analogues ( 12 –15) (Fig. 1) [26], whose acyclic, polyhydroxylated, sulfated chains varied between the four-carbon chain of salacinol and the seven-carbon chain of kotalanol. Fig. 2. Schematic diagram of MGA protein organization and expression construct. Amino acid boundaries of each of the domains comprising the full size protein, and the region inserted into the Drosophila expression plasmid, are indicated. E. J. Rossi et al. Inhibition of human maltase glucoamylase FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS 2675 It has been difficult previously to carry out extensive studies on the inhibitor profiles of these compounds due to the lack of large amounts of active enzyme. Here we report heterologous overexpression of recom- binant DNA encoding the MGA amino terminal cata- lytic domain (MGAnt) in Drosophila S2 cells in order to overcome this difficulty. The purified recombinant MGAnt was then used to perform kinetic analyses of prospective MGA inhibitors. Results The N-terminal catalytic domain of MGA is presently the most extensively studied region of the enzyme and enzymatic activity of the domain has been reported in the presence of maltose and amylose substrates, with little or no activity in the presence of lactose or sucrose substrates [8]. While the function of the C-terminal domain has yet to be determined, the results of Nich- ols et al. [8] confirmed that the N-terminal domain contains the substrate specificity of MGA and is dis- tinct from the specificity of SIM. For this reason, the recombinant proteins used in the studies reported here were designed to contain only the N-terminal region and all kinetic and inhibition analysis was performed using this catalytic domain. Activity of salacinol and acarbose on mammalian cell expressed C-terminally truncated MGA Preliminary inhibition studies were performed on sonicated cell extracts of primate cells expressing C-terminally truncated MGA [8]. In this assay, COS-1 cells transiently transfected with the MGA-P1A2 construct, which encodes the complete amino-terminal portion of the molecule including the membrane anchor and 5¢-catalytic domain, were used. The inhibition of maltose (4-O-a-d-glucopyranosyl-d-glucose) hydrolysis was monitored. The activity of the known glycosidase inhibitor acarbose (Bayer), used for the treatment of Type II diabetes, was compared to that of salacinol. Whereas salacinol at 5 lm concentration inhibited 60– 70% of the breakdown of maltose, 5 lm acarbose only inhibited 4% of the activity. Thus, it would appear that acarbose acts mainly by inhibiting human pancreatic a-amylase (HPA) and the breakdown of starch, and possibly other intestinal glucosidases but not MGA. The synthetic analogues of salacinol appeared to be slightly more active than the parent compound in these crude extracts. At 0.2 lm, blintol 5 inhibited 50% of MGA activity, and the chain extended analogues (13–15) inhibited 88%, 91%, and 90% of MGA activ- ity, respectively, when tested at 5 lm. Expression of active recombinant MGAnt in Drosophila S2 cells Due to limited expression levels in COS-1 cells and dif- ficulties in purification of the resultant membrane anchored protein we decided to express the catalytic domain as a secreted protein in Drosophila melanoga- ster cells (DES system, Invitrogen). We designed a construct that lacked the cytosolic, transmembrane region and most of the O-glycosylated stalk region that occurs at the amino terminus (Fig. 2). The N-terminal catalytic domain of MGA, starting at Ser87 and end- ing at amino acid 955, was fused to a C-terminal hexa- histidine tag. This domain was placed downstream of a metallothionein promoter and behind a Bip secretion signal. Correctness of the construct was determined by sequencing in each direction. An active protein was successfully expressed in Drosophila S2 cells. Secreted protein was isolated from the cell media using chelat- ing Sepharose resin and was further purified using anion exchange chromatography. The total yield of pure MGA from expression in Drosophila S2 cells was approximately 14 mgÆL )1 . The size and purity of the final protein preparation was determined by SDS ⁄ PAGE analysis (Fig. 3, inset) and by mass spec- trophotometric analysis. The expected size of the 876 amino acid expressed domain is 99 274 while a mass of 105 360 was determined by MALDI-TOF MS. The difference in mass is a result of glycosylation (six pre- dicted sites) as treatment with endo-glycosidase F reduced the apparent mass of the enzyme (results not shown). Fig. 3. MGAnt enzyme activity with maltose as a substrate. Line- weaver-Burk plot of MGAnt activity used to calculate kinetic param- eters V max and K m . Enzyme activity was measured by monitoring release of glucose from maltose using the glucose oxidase assay. Inset shows an SDS ⁄ PAGE gel of the purified MGAnt used in the assay. The size of the molecular weight markers shown in lane 1 are indicated. Lanes 2 and 3 show different loadings of the protein. Inhibition of human maltase glucoamylase E. J. Rossi et al. 2676 FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS Data obtained from the analysis of MGAnt activity in the presence of increasing maltose concentration was used in a double reciprocal Lineweaver–Burk plot (1 ⁄ velocity versus 1 ⁄ substrate) in order to calculate the V max and K M of the reaction (Fig. 3). The V max was determined to be 32.6 ± 1.4 Units ⁄ mg enzyme and the K M 4.6 ± 0.5 mm maltose. This differs some- what from the previously published results for purified murine MGA (34.7 UÆmg )1 , 1.24 mm, respectively) [27] but it must be pointed out that the purified rodent enzyme was almost twice the size of full size human MGA and was composed of a number of disulfide- linked proteolytic fragments [27]. The K M is close to the 3.4 mm measured for human MGA immunoprecip- itated from pooled clinical homogenates (B. Nichols, unpublished results). Inhibition analysis The availability of larger amounts of recombinant enzyme permitted a more thorough analysis of the inhibitor activities than was possible with the COS-1 homogenates. The effectiveness of a-glucosidase inhibi- tors on recombinant human MGAnt was tested using maltose as a substrate in the presence of known inhibi- tors acarbose and salacinol, and 11 newly synthesized putative inhibitors (Fig. 1). Initially, each inhibitor was tested at a concentration of 200 lm in order to screen for the most effective inhibitors. The inhibition results of the initial screening are listed along with each com- pound in Fig. 1. Of the 11 new putative inhibitors tes- ted, only inhibitors 5, 13, 14 and 15 showed full enzyme inhibition at 200 lm and were used in further inhibition analysis. As expected, the known a-glucosi- dase inhibitor salacinol also showed full inhibition at this concentration. Acarbose did not inhibit as well as salacinol or the four synthetic inhibitors but it was used in further analysis for the sake of comparison. The inhibition constants (K i ) of acarbose, salacinol and (5, 13–15; Fig. 1), against MGA were determined using the glucose oxidase assay and maltose as a sub- strate. Data points were obtained, in triplicate, for four different inhibitor concentrations (including 0 lm) and up to six different maltose concentrations. Tripli- cate data points pertaining to the various levels of each inhibitor were averaged and plotted together in Line- weaver–Burk plots and trendlines were added using Excel. The slopes of the lines corresponding to inhib- itor concentration approximately intersected at a point at the y-axis indicating classic competitive inhibition. The experimentally determined inhibition constants for acarbose, salacinol and its synthetic analogues (5, 13– 15) are listed (Table 1) and the Dixon plot visualiza- tion given in Fig. 4. Salacinol and 15 showed the best inhibition against MGA (K i ¼ 0.2 lm) while acarbose showed the worst inhibition (K i ¼ 62 lm). These val- ues are comparable to the preliminary data described above in COS-1 cells, despite the differences in assays and source of enzyme. Discussion Initial expression of active MGAnt protein in COS-1 cells demonstrated the validity of the cDNA clones, but suffered from low yields and the difficulty in isola- ting large quantities for physico-chemical studies. The Drosophila S2 cell expression system proved to be a successful method for the production of MGAnt in substantial quantities. The N-terminal catalytic domain was expressed and secreted into the medium, from which it was purified with sufficient purity (> 95%) and yield (> 40 mg ⁄ 3 L) for use in kinetic and inhibi- tion analysis as well as future use in structural studies. Kinetic analysis confirmed the enzyme activity of the recombinant protein, and inhibition analysis confirmed classic competitive inhibition by a-glucosidase inhibi- tors. Salacinol with a K i of 0.2 lm was the best inhib- itor tested. Acarbose had a K i of 62 lm against MGAnt. Through preliminary inhibitor screens, with maltose as a substrate for MGAnt, four new small molecules were discovered as promising a-glucosidase inhibitors from a group of 11 compounds designed and synthesized specifically for MGA inhibition. It is generally accepted that MGA, similar to SIM, has a negatively charged region in its catalytic center due to the presence of highly conserved acidic amino acid residues that are necessary for enzyme activity [8,28]. This provides an explanation for the high affin- ity of inhibitors such as acarbose and miglitol because upon binding, the inhibitor is protonated at its nitro- gen atom resulting in a positive charge that interacts tightly with the negatively charged residues in the act- ive site [28,29]. Salacinol, with a positively charged sul- fur atom, also contains a zwitterionic sulfonium-sulfate Table 1. Experimentally determined K i values. Inhibition constants were determined using maltose as a substrate for MGA. K i values were calculated according to each tested inhibitor concentration and averaged for a final result. Errors indicate the range of the data. Inhibitor K i (lM) Acarbose (1) 62.0 ± 13 Salacinol (3) 0.19 ± 0.02 5 0.49 ± 0.05 13 0.26 ± 0.02 14 0.25 ± 0.02 15 0.17 ± 0.03 E. J. Rossi et al. Inhibition of human maltase glucoamylase FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS 2677 structure that is thought to mimic the oxocarbenium ion intermediates in glycoside hydrolysis reactions [20]. There is a current debate as to whether carbohydrate mimics containing sulfonium ions and ammonium ions are effective inhibitors because of their ability to mimic the shape and charge of the presumed transition state, or because they bind with high affinity due to electro- static interactions with a carboxylate residue in the enzyme active site [16,18]. If electrostatic stabilization is the key to enzyme affinity, inhibitors bearing a permanent positive charge should function as well or better than current glycosidase inhibitors, as proven by the effectiveness of salacinol [16,18]. Inhibitors modeled after salacinol, all contain either a sulfur or a selenium atom resulting in a permanent positive charge in the five-membered ring. The differ- ences between these seven salacinol analogues involve the stereochemistry at the stereogenic centers in the polyhydroxylated, sulfated chain, as well as the num- ber of carbons in the acyclic chain linked to the 6 4 2 0 -200 -100 0 100 200 8 6 4 2 0 -3 -2 -1 0 12 3 [Salacinol (3)] (µ M) [Acarbose (1)] (µ M) 1/A450 1/A450 6 4 2 0 -3 -2 -1 0 1 2 3 [5] (µ M) [13] (µ M) 6 4 2 0 -3 -2 -1 0 1 2 3 1/A450 1/A450 -3 -2 -1 0 1 2 3 [14] (µ M) [15] (µ M) 12 10 10 8 6 4 2 0 8 6 4 2 0 -3 -2 -1 0 1 2 3 1/A450 1/A450 Fig. 4. Dixon plot analysis of the inhibition of MGAnt by acarbose and compounds 3, 5, 13, 14,and15 (Fig. 1) with fixed maltose concentra- tions of 5 m M (open circles), 7.5 mM (filled circles), 15 mM (open squares) and 30 mM (filled squares). Inhibition of human maltase glucoamylase E. J. Rossi et al. 2678 FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS sulfur ⁄ selenium atom. The remaining four of the 11 tested inhibitors, 8–11 (Fig. 1), were modeled after miglitol. These inhibitors each have a six-membered, cyclic alditol structure, with a positively charged sulfur or nitrogen in the ring. They also contain a four-car- bon chain linked to the positively charged atom, sim- ilar to salacinol and its derivatives. As in the case of salacinol, it was presumed that the permanent positive charge in the six-membered ring would lead to electro- static stabilization and increased active site affinity; however, none of these four inhibitors proved to be effective against MGAnt. This suggests that while the positive charge may be important in stabilizing active site interactions, the ring size also affects binding in the enzyme active site. The fact that salacinol, contain- ing a five-membered ring, has proven to be as effective, and in some cases more effective than both 1 and 2 (Fig. 1), suggests that the positively charged five-mem- bered ring is a better transition-state mimic because of its ring shape [29,30]. A preliminary inhibition screen showed four com- pounds of the group of salacinol analogues that were the most potent inhibitors of MGAnt activity (5, 13–15) (Fig. 4). The common element of these four derivatives is the identical stereochemistry at the carbon centers in the heteroalditol ring to that of salacinol. Inhibitor 5 is most similar to salacinol in that the only alteration is the replacement of the ring sulfur atom by selenium. Inhibitors 6 and 7, which were not effective as inhibitors of MGAnt, differ from salacinol (3)in stereochemistry at the carbon centers in the ring. These results suggest that the stereochemistry at these centers is critical for effective inhibition, the OH groups at C-2 and C-3 interacting with complementary groups in the enzyme active site. The five-membered carbon ring is likely the portion of the molecule that is most important in conferring affinity for the enzyme active site. This conclusion is reinforced by the observation that the four best inhibitors share three different carbon chain lengths linked to the ring heteroatom, suggesting that the chain length does not play a pre- dominant role in the binding or effectiveness of the inhibitors. Unfortunately, kotalanol, with the longest chain length, was not available for this study. The ana- lysis is clearly an oversimplification, since compound 12 was proven to be ineffective although it shares the same ring stereochemistry as salacinol and compounds 5, 13, 14 and 15. The major difference between compound 12 and the four effective inhibitors is in the stereochemis- try at C-4’. The stereochemistry at C-3’, and hence the placement of the sulfate group in the enzyme active site, does not appear to be important for enzyme inhibition (compare 12 against 13 and 15 in Fig. 1). Following the preliminary screen, each of the four most promising inhibitors was used in further inhibition analysis to determine their K i values for comparison with the a-amylase inhibitor, acarbose and salacinol (Table 1). Determination of the inhibition constants showed that salacinol and its four most potent derivatives have K i values in the low micromolar range (0.2–0.5 lm ), while acarbose is approximately 15–20-fold less potent against MGAnt (K i ¼ 62 lm, Fig. 4). This poor inhibition of the purified catalytic domain by acarbose was unexpected from previous reports in which acarbose was reported to be a powerful a-glu- cosidase inhibitor, with an effectiveness comparable to salacinol [2,28,32], although it is consistent with our preliminary data described above. One study reported acarbose inhibition against human MGA isolated from intestinal scrapings to be in the low micromolar range [28]. Acarbose is a very powerful inhibitor of human pancreatic a-amylase with a reported K i of 15 nm [33]. However the method of action of acarbose is quite complex and it appears to be acting as a type of sui- cide inhibitor of a-amylase in a mechanism whereby the acarbose is rearranged into an active entity by the a-amylase [33]. Thus the acarbose itself is not the act- ive inhibitor. The active rearranged entity may be inhibitory to MGA and could be generated in the intestinal scrapings by a-amylase present in the hetero- geneous sample or by activity in the C-terminal domain of the full-size protein, thereby accounting for the inhibition by ‘acarbose’ reported previously [28]. Our previous studies of the inhibitory effect of salac- inol and its derivatives against human a-amylase and fungal glucoamylase, rather than MGA, report the effectiveness of salacinol to be in the millimolar range [16,18,20]. In addition the analogues 5 and 13–15 did not inhibit human pancreatic a-amylase (S. G. Withers and B. M. Pinto, unpublished results). The present study reports activities of salacinol and synthetic deriv- atives, against active human recombinant MGAnt. By confirming the higher potency of salacinol and its derivatives against human MGAnt as compared with a-amylase and fungal glucoamylase, our results suggest that the inhibitors show specificity towards different a-glucosidases. This observation is important clinically because the design of a-glucosidase inhibitors for the treatment of Type II diabetes might require specificity for enzymes later in the starch digestion pathway in order to reduce unwanted side-effects. The inhibition constants of the most effective inhibi- tors found in this study, salacinol and compounds 5, 13, 14 and 15, are relatively similar, with salacinol and 15 being slightly more potent (0.2 lm) (Table 1). Inhibitors 13 and 15 show similar inhibition, with K i E. J. Rossi et al. Inhibition of human maltase glucoamylase FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS 2679 values of approximately 0.25 lm. Inhibitor 5 is slightly worse at 0.5 lm. Thus, for these four salacinol deriva- tives, the nature of the heteroatom or the length of the acyclic chain does not appear to have a significant effect on inhibitory activity. Since the stereochemistry at C-3¢ on the acyclic chain in 14 is opposite to that in 5, 13 and 15 it would appear that placement of the sulfate moiety within the active site is not significant for enzyme inhibition. It would appear then that the critical features of a potent inhibitor with an extended acyclic chain would be the stereochemistry at C-4¢, present in 13, 14 and 15, the stereochemistry at C-2¢ and C-3¢ being unim- portant. It would also appear that C-5¢ and C-6¢ pro- trude from the active site and make no substantial contacts with the enzyme since similar inhibitory activ- ities were observed for 13, 14 and 15. While the initial results of the inhibition assays are promising, at this point analysis of structure activity relationships can only be somewhat speculative. However the results of this study set the stage for improvement of the specific- ity and affinity of these compounds towards their potential development as antidiabetics. Further confirmation of the importance of inhibitor stereochemistry and how it affects binding in the active site will only be possible with an analysis of the atomic structure of the MGA binding site in both the presence and absence of bound inhibitor. Determination of this structural information, building on the groundwork reported in this study, will be a valuable tool in future design and synthesis of a-glucosidase inhibitors effect- ive against and specific to MGA. These inhibitors should be promising lead candidates as oral agents for the treatment and prevention of Type II diabetes. Experimental procedures Intestinal maltase assay Recombinant expression of C-terminally truncated human MGA in COS-1 cells has been published [8]. The COS cells transiently transfected with MGA-P1A2 were scraped off the tissue culture plates in 150 mm KCl. Aliquots were so- nicated and assayed for hydrolysis of 2% maltose for 2 h at 37 °C by the Dahlqvist method [34]. The reaction was stopped by boiling and glucose production was measured by the glucose oxidase assay (below). Protein was measured with a Bio-Rad (Hercules, CA, USA) protein assay kit. Recombinant MGAnt in Drosophila S2 cells The N-terminal catalytic domain of human MGA was expressed in Drosophila cells. The coding sequence was isolated from MGA-P1A2, which lacks the 903 amino acid C-terminal domain [8]. We also chose to delete the base pairs coding for the N-terminal cytosolic domain, the trans- membrane domain, and most (39 ⁄ 52 amino acids) of the O-glycosylated stalk region to give a construct encoding only the 876 amino acid catalytic domain of MGA. The expression construct was made in three steps from MGA- P1A2. In the first step deletion of the coding sequence for the 86 amino acid N-terminal region was carried out. An upstream primer (ccccggCTCGAGATCTgctgaatgtccagtggt) was synthesized which contains a CG tail, overlapping XhoI and BglII sites (capitalized) and 20 bp of complementary sequence. The TCT at the end of the BglII site codes for Serine87 of the full size MGA. For PCR, the upstream pri- mer was used in combination with a downstream primer, ACGTTAGTGCTAGGCAGTCGAG, which binds about 60 bp downstream of the XhoI site at nt1866 in MGA- P1A2. The PCR product was digested with XhoI, and ligated with a 6322 bp fragment of XhoI cut MGA-P1A2. The resulting plasmid, pBY_1, was cut with BglII and NotI, and ligated into BglII ⁄ NotI cut pMT ⁄ BiP ⁄ V5-His vector (Invitrogen, Carlsbad, CA, USA) to give pBY_2. This was in turn digested with NotI and AgeI to remove 74 bp of extra sequence. The ends were made blunt with mung bean nuclease, and ligated together to give the expression vector pMT-Bip-MGAnt-His6. This construct allows secretion of the MGAnt into the culture medium under the control of a metallothionein promoter with an in-frame C-terminal hexa-histidine tail for purification. Transfection, selection and isolation of single-cell clones The Drosophila Expression System (DES: Invitrogen) with Schneider 2 (S2) cells was used to express and secrete recombinant MGAnt. The S2 cells were maintained at 25 °C as a semiadherent monolayer in Schneider’s Insect Medium (Sigma, St Louis, MO, USA) enriched with 10% heat-inactivated fetal bovine serum (FBS). The cells were split with enriched media at a ratio of 1 : 4 every 3–4 days until transfection. The recombinant MGAnt vector was transfected, in combination with the pCoBLAST selection vector, which contains a blasticidin resistance cassette under the control of the Drosophila copia promoter, into S2 cells using the calcium phosphate procedure. Cells at a concen- tration of 3 · 10 6 cellsÆmL )1 were transfected with 19 lg of expression vector and 1 lg of selection vector. The procedure is carried out in duplicate to allow for one tran- siently and a second stably transfected cell line. Transfected cells were washed the next day with enriched medium to remove the calcium phosphate solution. Two days later, the transiently transfected cells were induced with 10 lm CdCl 2 and after a further three days, the cell medium was assayed for protein expression by SDS ⁄ PAGE and immunoblotting Inhibition of human maltase glucoamylase E. J. Rossi et al. 2680 FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS with antipentaHis antibody (Qiagen, Montreal, Canada). In order to obtain stably transfected cells, transfectants were passaged for one month in selective medium [enriched med- ium containing 16 lgÆmL )1 blasticidin (Invitrogen)]. These stably transfected blasticidin-resistant populations were used for subsequent single cell selection and scale-up. Successfully transfected cells were diluted with blastici- din-containing enriched medium to 10–50 cellsÆmL )1 , mixed with nontransfected S2 cells (to serve as a feeder layer), and grown in 100 lL volumes in a 96-well tissue culture plate until single colonies of cells developed. Levels of active MGAnt secreted into the medium were analyzed by hydro- lysis of pNP-glucose. A stable line of optimally expressing single cell clone was adapted to Ex-Cell 420 Insect Serum Free Media (JRH Biosciences, Lenexa, KS, USA) and then scaled up to 3200 mL in shaker flasks. Cells were then induced with 2 lm CdCl 2 , and the secreted protein was har- vested after 3 days. Protein purification Secreted protein was batch-bound from the media using chelating Sepharose resin (GE Healthcare, Montreal, Can- ada) at a ratio of approximately 3 lL resin to 1 mL media. Copper sulfate was added to 200 lm and imidazole was added to 2 mm to reduce nonspecific binding. Resin was poured into a column and washed with 20 column volumes of 20 mm Tris pH 8.5, 300 mm NaCl. Protein was eluted step-wise with 2, 6, 10, 20, 30, and 50 mm imidazole in wash buffer. Eluted fractions were analyzed using SDS ⁄ PAGE and the pNP-glucose activity assay to identify fractions containing active MGAnt. These fractions were pooled, concentrated, and dialyzed against 100 mm NaCl, 20 mm Tris pH 8.5 to remove residual copper and imidaz- ole, and to lower the salt concentration of the sample in preparation for ion exchange chromatography. A BioCAD Poros-HQ anion exchange column (PerSep- tive Biosystems, Framingham, MA, USA) was used to further purify the MGAnt. The column was washed and equilibrated with starting buffer, 100 mm Bis-Tris Propane pH 7. Sample was diluted by half with 100 mm Bis-Tris Propane pH 7 then was loaded on column and washed with starting buffer. Sample was eluted over a linear gradient of 0–1 m NaCl. Eluate was collected in 3 mL fractions and assayed for active MGA using SDS ⁄ PAGE and pNP-glu- cose assay. Fractions containing pure, active MGAnt were pooled and concentrated to 23 mgÆmL )1 . Inhibitors Acarbose 1, salacinol 3 and synthesized derivatives were analyzed as inhibitors for recombinant human MGAnt using the glucose oxidase enzyme activity assays described below. The inhibitors were dissolved in water as 50 mm stock solutions and stored at )20 °C. Enzyme activity assay Two methods were used to assess MGAnt activity. For rapid measurements of cell supernatants and assessment of column fractions the pNP-glucose assay was used. For detailed kinetic analysis the glucose-oxidase assay was used. pNP-glucose assay Reactions were carried out in 50 mm Mes buffer, pH 5.75, with 5 mm of para-nitrophenol-d-glucopyranoside (pNP- glucose, Sigma) as substrate. Reaction volumes were 50 lL in 96-well microtiter dishes. Reactions were incubated at 37 °C, and at the completion of the reaction (typically 30– 45 min) were stopped with 50 lL of 0.5 m sodium carbon- ate. The absorbance of the reaction product was measured at 405 nm with 520 nm background correction in a micro- titer plate reader. Glucose-oxidase assay Analysis of MGAnt inhibition was performed using maltose as the substrate, and measuring the release of glucose. Reac- tions were carried out in 100 mm Mes buffer, pH 6.5, at 37 °C for 15 min. The reaction was stopped by boiling for 3 min 20 lL aliquots were taken and added to 100 lL of glu- cose oxidase assay reagent (Sigma) in a 96-well plate. Reac- tions were developed for 1 h and absorbance was measured at 450 nm to determine the amount of glucose produced by MGA activity in the reaction. One unit of activity is defined as the hydrolysis of one micromole of maltose per minute. All reactions were performed in triplicate and absorbance measurements were averaged to give a final result. Enzyme kinetics Kinetic parameters of recombinant MGAnt were deter- mined using the glucose oxidase assay to follow the produc- tion of glucose upon addition of enzyme (25 nm)at increasing maltose concentrations (from 2.5 to 30 mm) with a reaction time of 15 min. Reactions were linear within this time frame. The program GraFit 4.0.14 was used to fit the data to the Michaelis-Menten equation and estimate the kinetic parameters, K m and V max , of the enzyme. K i values for each inhibitor were determined by measuring the rate of maltose hydrolysis by MGAnt at varying inhibitor concen- trations. Data were plotted in Lineweaver-Burk plots (1 ⁄ rate versus1 ⁄ [substrate]) and K i values for the compet- itive inhibition were determined by the equation K i ¼ K m [I] ⁄ (V max )s ) K m , where ‘s’ is the slope of the line. The K i reported for each inhibitor was estimated by averaging the K i values obtained from each of the different inhibitor concentrations. For ease of visualization, the inhibition analyses are presented as Dixon plots in Fig. 4. E. J. Rossi et al. Inhibition of human maltase glucoamylase FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS 2681 Acknowledgements We thank Brenda Yun, Tara Signorelli, and Marees Harris-Brandts for technical assistance. Supported by PENCE (Protein Engineering Network of Centres of Excellence), Canadian Institutes for Health Research (CIHR), Natural Sciences and Engineering Research Council of Canada, and University Medical Discover- ies Inc., Swiss National Science Foundation (grant 3100A0-100772 to E.E.S). References 1 Sherwood L (1995) Fundamentals of Physiology: a Human Perspective, 2nd edn. West Publications Co., St Paul ⁄ Minneapolis. 2 Asano N (2003) Glycosidase inhibitors: update and per- spectives on practical use. Glycobiology 13, 93R–104R. 3 Holman RR, Cull CA & Turner RC (1999) A rando- mized double-blind trial of acarbose in type 2 diabetes shows improved glycemic control over 3 years. Diabetes Care 22, 960–964. 4 Jacob GS (1995) Glycosylation inhibitors in biology and medicine. Curr Opin Struct Biol 5, 605–611. 5 Simpson RW, Shaw JE & Zimmet PZ (2003) The pre- vention of type 2 diabetes – lifestyle change or pharmac- otherapy? A challenge for the 21st century. Diabetes Res Clin Pract 59 , 165–180. 6 Chiasson JL, Josse RG, Gomis R, Hanefeld M, Karasik A & Laakso M (2002) Acarbose for prevention of type 2 diabetes mellitus: the STOP-NIDDM randomised trial. Lancet 359, 2072–2077. 7 Scheen AJ (2003) Is there a role for alpha-glucosidase inhibitors in the prevention of type 2 diabetes mellitus? Drugs 63, 933–951. 8 Nichols BL, Avery S, Sen P, Swallow DM, Hahn D & Sterchi E (2003) The maltase-glucoamylase gene: com- mon ancestry to sucrase-isomaltase with complementary starch digestion activities. Proc Natl Acad Sci USA 100, 1432–1437. 9 Nichols BL, Eldering J, Avery S, Hahn D, Quaroni A & Sterchi E (1998) Human small intestinal maltase-glu- coamylase cDNA cloning: homology to sucrase-isomal- tase. J Biol Chem 273, 3076–3081. 10 Semenza G & Auricchio S (1989) The Metabolic Basis of Inherited Disease II (Scriver, C R, Beaudet, A L, Sly, W S, Valle, D, Stanbury, J B, Wyngaarden, J B & Fredrickson, D S, eds), pp. 2975–2997. McGraw-Hill Inc., New York. 11 Roy R, Gautier M, Hayes H, Laurent P, Zaragoza P, Eggen A & Rodellar C (2002) Assignment of maltase glucoamylase (MGAM) gene to bovine chromosome 4q34 by in situ hybridization and confirmation by radiation hybrid mapping. Cytogenet Genome Res 98, 311C. 12 Lee SS, He S & Withers SG (2001) Identification of the catalytic nucleophile of the family 31 alpha-glucosidase from Aspergillus niger via trapping of a 5-fluoroglyco- syl-enzyme intermediate. Biochem J 15, 381–386. 13 Yoshikawa M, Murakami T, Shimada H, Matsuda H, Yamahara J, Tanabe G & Muraoka O (1997) Salacinol, potent antidiabetic principle with unique thiosugar sul- fonium sulfate structure from the Ayurvedic traditional medicine Salacia reticulata. Sri Lanka and India. Tetra- hedron Lett 38, 8367–8370. 14 Yoshikawa M, Murakami T, Yashiro K & Matsuda H (1998) Kotalanol, a potent alpha-glucosidase inhibitor with thiosugar sulfonium sulfate structure, from antidia- betic ayurvedic medicine Salacia reticulate. Chem Pharm Bull (Tokyo) 46, 1339–1340. 15 Shimoda H, Fujimura T, Makino K, Yoshijima K, Naitoh K, Ihota H & Miwa Y (1999) Safety profile of extractive from trunk of Salacia reticulata (Celastra- ceae). J Food Hygienic Soc Japan 40, 198–205. 16 Ghavami A, Johnston BD, Jensen MT, Svensson B & Pinto BM (2001) Synthesis of nitrogen analogues of salacinol and their evaluation as glycosidase inhibitors. J Am Chem Soc 123, 6268–6271. 17 Ghavami A, Johnston BD, Maddess MD, Chinapoo SM, Jensen MT, Svensson B & Pinto BM (2002) Synth- esis of 1,4-anhydro-d-xylitol heteroanalogues of the naturally occurring glycosidase inhibitor salacinol and their evaluation as glycosidase inhibitors. Can J Chemis- try-Revue Canadienne De Chimie 80, 937–942. 18 Ghavami A, Johnston BD & Pinto BM (2001) A new class of glycosidase inhibitor: synthesis of salacinol and its stereoisomers. J Org Chem 66, 2312–2317. 19 Ghavami A, Sadalapure KS, Johnston BD, Lobera M, Snider BB & Pinto BM (2003) Improved syntheses of the naturally occurring glycosidase inhibitor salacinol. Synlett 9, 1259–1262. 20 Johnston BD, Ghavami A, Jensen MT, Svensson B & Pinto BM (2002) Synthesis of selenium analogues of the naturally occurring glycosidase inhibitor salacinol and their evaluation as glycosidase inhibitors. J Am Chem Soc 124, 8245–8250. 21 Liu H & Pinto BM (2005) Efficient synthesis of the glu- cosidase inhibitor blintol, the selenium analogue of the naturally occurring glycosidase inhibitor salacinol. J Org Chem 70, 753–755. 22 Szczepina MG, Johnston BD, Yuan Y, Svensson B & Pinto BM (2004) Synthesis of alkylated deoxynojirimy- cin and 1,5-dideoxy-1,5-iminoxylitol analogues: polar side-chain modification, sulfonium and selenonium het- eroatom variants, conformational analysis, and evalua- tion as glycosidase inhibitors. J Am Chem Soc 126, 12458–12469. 23 Pinto BM, Johnston BD, Ghavami A, Szczepina MG, Liu H & Sadalapure K (2004) Glycosidase inhibitors Inhibition of human maltase glucoamylase E. J. Rossi et al. 2682 FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors Journal compilation ª 2006 FEBS [...]... Acarbose and 1-deoxynojirimycin inhibit maltose and maltooligosaccharide hydrolysis of human small intestinal glucoamylase -maltase in two different substrate-induced modes Arch Biochem Biophys 346, 7–14 Aleshin AE, Feng PH, Honzatko RB & Reilly PJ (2003) Crystal structure and evolution of a prokaryotic glucoamylase J Mol Biol 327, 61–73 Inhibition of human maltase glucoamylase 30 Kuntz DA, Ghavami A, Johnston... Synthesis of sulfonium sulfate analogues of disaccharides and their conversion to chain-extended homologues of salacinol; new glycosidase inhibitors J Org Chem 71, 1111–1118 Quezada-Calvillo R, Rodriguez-Zuniga F & Underdown BJ (2002) Partial characterization of murine intestinal maltase- glucoamylase Biochem Biophys Res Commun 295, 394–400 Breitmeier D, Gunther S & Heymann H (1997) Acarbose and 1-deoxynojirimycin... et al 24 25 26 27 28 29 and methods of synthesizing same US patent 10/877490 Pinto BM, Johnston BD, Ghavami A, Szczepina MG, Liu H, Sadalapure K, Jensen HH, Kumar NS & Nasi R (2006) Glycosidase inhibitors and methods of synthesizing same US patent 11/368014 Kumar NS & Pinto BM (2005) Synthesis of d-lyxitol and d-ribitol analogues of the naturally occurring glycosidase inhibitor salacinol Carbohydr Res... Crystallographic analysis of the interactions of Drosophila melanogaster Golgi [alpha]-mannosidase II with the naturally occurring glycomimetic salacinol and its analogues Tetrahedron Asymm 16, 25–32 31 Kavlekar LM, Kuntz DA, Wen X, Johnston BD, Svensson B, Rose DR & Pinto BM (2005) 5-Thio-dglycopyranosylamines and their amidinium salts as potential transition-state mimics of glycosyl hydrolases: synthesis,... C, Begum A, Numao S, Park KH, Withers SG & Brayer GD (2005) Acarbose rearrangement mechanism implied by the kinetic and structural analysis of human pancreatic alpha-amylase in complex with analogues and their elongated counterparts Biochemistry 44, 3347–3357 34 Dahlqvist A (1964) Method for assay of intestinal disaccharidases Anal Biochem 7, 18–25 FEBS Journal 273 (2006) 2673–2683 ª 2006 The Authors... mimics of glycosyl hydrolases: synthesis, enzyme inhibitory activities, X-ray crystallography, and molecular modeling Tetrahedron Asymm 16, 1035–1046 32 Muraoka O, Ying S, Yoshikai K, Matsuura Y, Yamada E, Minematsu T, Tanabe G, Matsuda H & Yoshikawa M (2001) Synthesis of a nitrogen analogue of salacinol and its alpha-glucosidase inhibitory activity Chem Pharm Bull (Tokyo) 49, 1503–1505 33 Li C, Begum . Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives Elena J. Rossi 1,2, *, Lyann. non- reducing end by maltase glucoamylase (MGA; E.C. 3.2.1.20 and 3.2.1.3) maltase glucoamylase and sucrase isomaltase (SIM; EC 3.2.1.48 and 3.2.1.10), respect- ively,