Báo cáo khoa học: Peroxiredoxins as cellular guardians in Sulfolobus solfataricus – characterization of Bcp1, Bcp3 and Bcp4 pot

Peroxiredoxins as cellular guardians in Sulfolobus solfataricus – characterization of Bcp1, Bcp3 and Bcp4 Danila Limauro 1 , Emilia Pedone 2 , Ilaria Galdi 1 and Simonetta Bartolucci 1 1 Dipartimento di Biologia Strutturale e Funzionale, Universita ` di Napoli ‘Federico II’, Complesso Universitario Monte S. Angelo, Naples, Italy 2 Istituto di Biostrutture e Bioimmagini, CNR, Naples, Italy To maintain a proper intracellular redox environment, aerobic microorganisms use redox systems and antioxi- dants that protect cells from the attack of reactive oxy- gen species (ROS) such as superoxide anions, H 2 O 2 and hydroxyl radicals. Increased ROS concentration inside a cell results in damage to the main biomole- cules and membranes and essential metabolic functions [1]; to maintain a low intracellular ROS level, cells are equipped with an array of antioxidant systems, in the first place superoxide dismutases (SODs), which cata- lyze the dismutation of superoxide anions into H 2 O 2 and oxygen. H 2 O 2 is reduced by various systems, in the main by catalases and peroxidases. Peroxiredoxins (Prx) are thiol-peroxidases that scavenge peroxides using the enzyme-recycling thioredoxin (Trx) ⁄ thiore- doxin reductase (Tr) system as an electron donor [2,3]. Keywords antioxidant; archaea; disulfide oxidoreductase; oxidative stress; thiol-peroxidase Correspondence Simonetta Bartolucci, Dipartimento di Biologia Strutturale e Funzionale, Complesso Universitario di Monte S. Angelo, Universita ` di Napoli ‘Federico II’, Via Cinthia, 80126 Naples, Italy Fax: +39 081679053 Tel: +39 081679052 E-mail: bartoluc@unina.it (Received 20 December 2007, revised 22 February 2008, accepted 27 February 2008) doi:10.1111/j.1742-4658.2008.06361.x Peroxiredoxins are ubiquitous enzymes that are part of the oxidative stress defense system. In the present study, we identified three peroxiredoxins [bacterioferritin comigratory protein (Bcp)1, Bcp3 and Bcp4] in the genome of the aerobic hyperthermophilic archaeon Sulfolobus solfataricus. Based on the cysteine residues conserved in the deduced aminoacidic sequence, Bcp1 and Bcp4 can be classified as 2-Cys peroxiredoxins and Bcp3 as a 1-Cys peroxiredoxin. A comparative study of the recombinant Bcps pro- duced in Escherichia coli showed that these enzymes protect DNA plasmid from oxidative damage and remove both H 2 O 2 and tert-butyl hydroper- oxide, although at different efficiencies. We observed that all of them were particularly thermostable and that peak enzymatic activity fell within the range of the growth temperature of S. solfataricus. Furthermore, we dis- covered an alternative Bcp reduction system whose composition differs from that of the peroxiredoxin reduction system previously characterized in the aerobic hyperthermophilic archaeon Aeropyrum pernix. Whereas the latter uses the thioredoxin ⁄ thioredoxin reductase ⁄ NADPH system, this alternative Bcp system is formed of the protein disulfide oxidoreducatase, SSO0192, the thioredoxin reductase, SSO2416, and NADPH. The role of Bcps in oxidative stress was investigated using transcriptional analysis. Different northern blot analysis responses suggested that the Bcp antioxi- dant system of S. solfataricus can both operate at the constitutive level, with Bcp1 and Bcp4 preventing endogenous peroxide formation, and at the inducible level, with Bcp3 and the already characterized Bcp2 protecting cells from the attack of external peroxides. Abbreviations Bcp, bacterioferritin comigratory protein; Cys p, peroxidatic cysteine; Cys R, resolving cysteine; MCO, metal ion catalyzed oxidation; PDO, protein disulfide oxidoreductase; ROS, reactive oxygen species; SOD, superoxide dismutase; ssSOD, SOD from Sulfolobus solfataricus; t-BOOH, tert-butyl hydroperoxide; Tr, thioredoxin reductase; Trx, thioredoxin. FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS 2067 Prxs are ubiquitous enzymes identified in eubacteria, archaea, yeast, algae, higher plants and animals [4,5]. All Prxs share the same basic catalytic mechanisms, whereby a cysteine conserved in the N-terminal sequence, the peroxidatic cysteine (Cys p ), is oxidized to sulfenic acid (Cys-S P OH) by a peroxide substrate. These enzymes are generally distinguished into 2-Cys or 1-Cys based on whether or not they contain the resolving cysteine (Cys R ). In 2-Cys Prxs, the Cys-S P OH and Cys-S R react and form a disulfide (C P -S-S-C R ): the stable disulfide form is then reduced by one of sev- eral disulfide oxidoreductases, completing the catalytic cycle. 2-Cys Prxs have been further distinguished into typical or atypical, depending on the location of Cys- S R residue. In typical 2-Cys-Prxs, the Cys-S P OH reacts with the Cys-S R residue located in the C-terminal sequence of the other subunit of the antiparallel homodimer. By contrast, in atypical 2-Cys Prx, the Cys-S R residue resides within the same subunit. Although catalases mainly detoxify high levels of H 2 O 2 , the function of Prxs is to scavenge low levels of H 2 O 2 [6]. It has been demonstrated that Prxs with a K M in the low lm range are kinetically more efficient scavengers of trace amounts of H 2 O 2 than catalases, and this is why they are probably the primary defence against endogenous hydrogen peroxide. More than 40 proteins have been found to perform a similar function in a variety of organisms, ranging from bacteria and eukarya to archaea. A hexadecameric Prx [3] belonging to the 2-Cys Prx family has recently been isolated in the archaeon Aeropyrum pernix and the enzyme was found to be dependent on the Trx ⁄ Tr ⁄ NADPH system for H 2 O 2 reduction. Another archaeal Prx from Pyrococcus horikoshii PH1217 [7,8] has been characterized and subsumed within the 2-Cys family. Although it performs peroxi- dase activity, its electron donor partner may differ from that found in A. pernix. On evaluation, the Sulfolobus solfataricus P2 genome [9] was found to contain no putative amino acid sequences that are homologues of catalases, but four homologues of Prxs, annotated as bacterioferritin comigratory protein (Bcp)1, Bcp2, Bcp3 and Bcp4. Indeed, the antioxidant system of S. solfataricus P2 has so far been identified only in part, in that only two enzymes have been characterized: SOD from S. solfa- taricus (SsSOD) [10] and a 1-Cys Prx (Bcp2) [11]. SsSOD has a homodimeric structure that is sensitive to inactivation by H 2 O 2 . Its half-life is 2 h at 100 °C [12]. SsSOD has been found both in the culture fluid of S. solfataricus during growth on glucose-rich media and is associated with the cell surface. There is evidence that cell-associated SsSOD protects both the cell surface enzyme glucose dehydrogenase and the integral-mem- brane enzyme succinate dehydrogenase against oxyradi- cal protein deactivation [13]. Transcriptional analysis has provided evidence of constitutive gene expression. Moreover, the high stability of the 2 h half-life mRNA suggests that high SsSOD levels are likely to protect the cells from the superoxide anion generated in the natural oxidant environment of S. solfataricus [14,15]. Bcp2 is a recently characterized Prx; its transcription in S. solfataricus is up-regulated by various stressors and the different kinetics observed in response to these agents could imply different regulatory mechanisms, or at least variations in the same mechanism. Further- more, Bcp2 displays peroxidase activity at a tempera- ture optimum in the range 80–90 °C (i.e. the range in which S. solfataricus grows). The peroxidase activity of Bcp2 involves the single cysteine residue (Cys 49 ) in the catalytic activity, suggesting a mechanism whereby the residue is oxidized by H 2 O 2 and then reduced by the dithiothreitol used as electron donor in vitro [11]. No physiological partner has so far been identified. A new redox system formed of the protein disulfide oxi- doreductase (PDO) SSO0192 and the Tr SSO2416 has recently been characterized in S. solfataricus. SSO0192 is a typical PDO, a member of the protein disulfide isomerase-like family [16], whose redox and chaperone activities confirm a central role in the biochemistry of cytoplasmic disulfide bonds and suggest a potential role in intracellular protein stabilization, respectively [17]. Recent investigations of the genomic sequence databases of S. solfataricus led to the identification of two putative Trxs (i.e. TrxA1 and TrxA2; SSO0368 and SSO2232, respectively). Unlike SSO0192, which is part of the new thioredoxin system SSO0192 ⁄ SSO2416, both these Trxs proved to be inactive in reduction with SSO2416 [17]. The present study aims to expand our knowledge of the antioxidant system in S. solfataricus. Accordingly, we characterize three Prxs deduced from the S. solfa- taricus P2 genome: we report on the cloning of bcp1, bcp3 and bcp4 and the characterization of the recombi- nant products and, next, we investigate the possible role of the SSO0192 ⁄ SSO2416 system as an in vivo partner of Bcps in enzyme recycling. Subsequently, transcriptional studies help to shed light on the tactic used by S. solfataricus during oxidative stress. Results Sequence analysis of Bcp1, Bcp3 and Bcp4 Four genes encoding the putative Prxs named Bcp1 (SSO2071), Bcp2 (SSO2121), Bcp3 (SSO2255) and Peroxiredoxin antioxidant system D. Limauro et al. 2068 FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS Bcp4 (SSO2613) were identified in the S. solfataricus genome database (http://www-archbac.u-psud.fr/projects/ sulfolobus/). One of them, Bcp2 (215 amino acids, with a predicted molecular mass of 24 744.79 Da and a theoretical pI of 6.85), has recently been character- ized and classified as a 1-Cys Prx [11]. bcp1 encodes a putative protein of 153 amino acids with a predicted molecular mass of 17 460.12 Da and a theoretical pI of 7.73; bcp4 encodes a putative pro- tein of 156 amino acids with a predicted molecular mass of 17 461.28 Da and a theoretical pI of 7.65; bcp3 encodes a putative protein of 149 amino acids with a predicted molecular mass of 16 976.42 Da and a theoretical pI of 8.84. Comparison of the sequences of S. solfataricus Bcps revealed an approximate 35% identity for Bcp1, Bcp3 and Bcp4. A BlastP search against the Swiss-Prot ⁄ TrEMBL GenBank database identified numerous Prx homo- logues of Bcp1, Bcp3 and Bcp4. The highest identity of Bcps is found with archaeal thermophilic Prxs (Figs 1–3). The Bcp1 and Bcp4 amino acid sequences include two cysteine residues at positions 45 and 50 of the highly conserved N-terminal region and show significant identity with chloroplastic PrxQ, which is involved in antioxidant defence and in the redox homeostasis of photosynthesis [18]; by contrast, the Bcp3 sequence only shows one cysteine at position 42 in the N-terminal region. Expression and purification of Bcp1, Bcp3 and Bcp4 bcp1, bcp3 and bcp4 were amplified by PCR from S. solfataricus genomic DNA and cloned into pET- 30c(+). The genes were expressed in Escherichia coli cells and the recombinant proteins were highly overex- pressed in soluble form, as fusions with a C-terminal eight-residue histidine tag (LEHHHHHH), with an approximate 10% yield of homogeneous proteins. To purify the recombinant Bcps, the soluble frac- tions (140 mg) of the cell extracts were heated at 80 °C for 15 min; this heat-treatment removed approximately 40% of E. coli proteins. Bcp1 was purified to homoge- neity in a one-stage process using affinity chromato- graphy on HisTrap HP. SDS ⁄ PAGE of the final preparation revealed a single band with a molecular Fig. 1. Sequence alignment of Bcp1. CLUSTALW alignment of S. solfataricus (Bcp1) Q97WP9|SULSO, S. acidocaldarius Q4J6R7|SULAC, S. tokodaii Q974D1|SULTO, Picrophilus torridus Q6L214|PICTO, Anabaena variabilis Q3M6A0|ANAVT, and Synechococcus sp. Q31LU7|SYNP7. D. Limauro et al. Peroxiredoxin antioxidant system FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS 2069 mass of 18 ± 1 kDa. Bcp3 and Bcp4 required an addi- tional purification step with cation and anion-exchange chromatography, respectively. The molecular masses of the three recombinant pro- teins were determined using MS analysis as reported in the Experimental procedures; the values reported for Bcp1 (18 525 Da), Bcp3 (18 041 Da) and Bcp4 (18 526 Da) were in agreement with the corresponding theoretical values. The quaternary structure of the enzymes was assessed via analytical gel filtration of the purified proteins: Bcp1 and Bcp3 were eluted at a vol- ume consistent with a monomeric structure whereas Bcp4 was eluted consistently with its dimeric structure. Peroxidase activity The peroxidase activity of recombinant Bcps was tested in vitro via a metal ion catalyzed oxidation (MCO) assay. The assay was based on the ability to protect plas- mids against Fe 3+ -catalyzed reduction of O 2 to H 2 O 2 , which occurs in the presence of an electron donor, such as dithiothreitol. Via the Fenton reaction, the H 2 O 2 formed in these conditions was further converted into HO . , which nicks supercoiled plasmid DNA. Accord- ingly, we investigated whether recombinant Bcp1, Bcp3 and Bcp4 could protect DNA from oxidative damage in terms of removing the H 2 O 2 , generated by the MCO system. As shown in Fig. 4A–C (lanes 2), in the pres- ence of the MCO system, the supercoiled form of pUC19 was completely converted into nicked form, whereas the addition of Bcp1, Bcp3, or Bcp4 to the reac- tion mixture averted this damage. In more detail, 2 lm of Bcp3 was sufficient to remove the H 2 O 2 generated by the MCO system and to preserve the supercoiled DNA plasmid form (Fig. 4B, lane 6); whereas 40 lm and 20 lm of Bcp1 and Bcp4 (Fig. 4A, lane 6 and Fig. 4C, lane 6), were only partially able to convert nicked into supercoiled plasmid; BSA and Bcp2 were used as nega- tive and positive controls, respectively. Subsequently, using dithiothreitol as electron donor for enzyme recycling, we further investigated the anti- oxidant activity of Bcps by measuring both H 2 O 2 and the organic peroxide tert-butyl hydroperoxide (t-BOOH) removed. A non-enzymatic spectrophoto- metric assay was performed as described in the Experi- mental procedures. Bcp1, Bcp3 and Bcp4 were capable Fig. 2. Sequence alignment of Bcp3. CLUSTALW alignment of S. solfataricus (Bcp3) Q97WG5|SULSO, S. tokodaii Q96YS1|SULTO, S. acido- caldarius Q4JCJ2|SULAC, A. pernix Q9YG15|AERPE, Pyrobaculum aerophilum Q8ZYA3|PYRAE, and Thermoplasma acidophilum Q9HL73|THEAC. Peroxiredoxin antioxidant system D. Limauro et al. 2070 FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS of scavenging both H 2 O 2 and t-BOOH, although at different efficiencies. The results shown in Fig. 5A demonstrate that 2.5 lm of Bcp1 is sufficient to remove approximately 50% of the existing H 2 O 2 and that Bcp4 at the same concentration and 1.4 lm Bcp3, respectively, remove all the peroxides. Figure 5B shows the activity of the same enzymes when t-BOOH is used as a substrate: 8 lm of Bcp1 and Bcp4 remove approx- imately 50% of the t-BOOH, a proportion which rises to approximately 90% when Bcp3 is used at the same concentration. In conclusion, Bcp1 Bcp3 and Bcp4 are more efficient when H 2 O 2 is used as substrate in place of t-BOOH. To determine the physiological partners involved in Bcp reduction in vivo, we used the redox Trx-like system of S. solfataricus comprising the PDO member SSO0192, the Tr SSO2416 and NADPH [17]. The H 2 O 2 consumption rate at 80 °C was measured by monitoring the decrease in A 490 , as in the previous assay. We found that Bcp1, Bcp3 and Bcp4 were also capable of perform- ing their peroxide reductase activity in the presence of the Trx-like system (Fig. 6), although at a slightly lesser efficiency compared to dithiothreitol. These results indi- cate that Bcp1, Bcp3 and Bcp4 are functional Trx-like peroxidases, whereas Bcp2, which was previously reported to remove H 2 O 2 in the presence of dithiothrei- tol [11], is unable to eliminate H 2 O 2 in the presence of the SSO2416 ⁄ SSO0192 ⁄ NADPH system. In all likeli- hood, the different response observed for Bcp2, com- pared to the other three enzymes, either reflects a different oxidized catalytic center accessibility or a different reaction mechanism. Fig. 3. Sequence alignment of Bcp4. CLUSTALW alignment of S. solfataricus (Bcp4) Q97VL0|SULSO, S. acidocaldarius Q4J9Q3|SULAC S. tokodaii Q96ZP9|SULTO, Thermotoga marittima Q9WZN7|THEMA, Orysa sativa PRXQ|ORSSJ, and Arabdopsis thaliana PRXQ|ARATH. D. Limauro et al. Peroxiredoxin antioxidant system FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS 2071 Temperature dependence and thermostability of Bcp1, Bcp3 and Bcp4 To characterize the thermophilicity of recombinant Bcp1, Bcp3 and Bcp4, we investigated the peroxidase activities of the enzymes by measuring H 2 O 2 removal at increasing temperatures. Bcp1 and Bcp3 activity was shown to be highest at 85 °C, which is in the optimum temperature range for S. solfataricus growth (Fig. 7A,B), whereas Bcp4 showed maximum peroxi- dase activity in the range 95–100 °C, the highest temperature tested (Fig. 7C). At this point, we deter- mined the thermoresistance levels of the enzymes by incubating them for varying periods at 80, 90, 95 and 100 °C and then assaying their respective residual per- oxidase activity (data not shown). Following a 2 h incubation at 80 °C, all the enzymes were shown to have retained 100% of their initial activity; Bcp1 dis- played a half-life of 2 h at 95 °C but, after a 60 min incubation at 100 °C, its relative activity dropped to 20% of the starting value. Bcp3 and Bcp4 are more thermostable than Bcp1: after 2 h at 100 °C, they A B C N F SF 12 43657 NF SF 12 43657 NF SF 12 43657 SF NF SF 12 4365 NF SF 12 4365 Fig. 4. DNA cleavage protection assay performed by Bcp1 (A), Bcp3 (B) and Bcp4 (C). Supercoiled pUC19 plasmid (lanes 1) was exposed to the MCO system (dithiothreitol ⁄ Fe +3 ⁄ O 2 ) alone (lanes 2) and with different Bcps concentrations. pUC19 plus the MCO sys- tem plus Bcp2 1 l M as positive control (lanes 3), pUC19 plus the MCO system plus BSA as negative control (lanes 7). pUC19 plus the MCO system plus Bcp1 2 l M (lane 4A) or Bcp1 20 lM (lane 5A) or Bcp1 40 l M (lane 6A). pUC19 plus the MCO system plus Bcp3 1 l M (lane 4B) or Bcp3 1.5 lM (lane 5B) or Bcp3 2 lM (lane 6B). pUC19 plus the MCO system plus Bcp4 1 l M (lane 4C) or Bcp4 10 l M (lane 5C) or Bcp4 20 lM (lane 6C). NF, nicked form; SF, supercoiled form of pUC19 are indicated on the left by arrows. H 2 O 2 removal (%) Bc p s ( µ M) 0 20 40 60 80 100 A 0 1 2 3 4 5 Bc p s ( µ M) B 0 20 40 60 80 100 t-BOOH removal (%) 0 4 8 12 16 Fig. 5. Different efficiency of Bcps in removing H 2 O 2 (A) and t-BOOH (B). Peroxidase activity was measured using the ferrithiocyanate method at 80 °C as described in the Experimental procedures in the presence of dithiothreitol as an electron donor. Bcp1(d), Bcp3 ( ), Bcp4 ( ). 0 20 40 60 80 100 12345 Relative activity (%) Fig. 6. Peroxidase activity of recombinant Bcps in the presence of the SSO2416 ⁄ SSO0192 ⁄ NADPH system of S. solfataricus. SSO0192 ⁄ SSO2416 ⁄ NADPH + H 2 O 2 negative control (1), SSO0192 ⁄ SSO2416 ⁄ NADPH + H 2 O 2 + Bcp1 5 lM (2), SSO0192 ⁄ SSO2416 ⁄ NADPH + H 2 O 2 + Bcp2 5 lM (3), SSO0192 ⁄ SSO2416 ⁄ NADPH + H 2 O 2 + Bcp3 4 lM (4), SSO0192 ⁄ SSO2416 ⁄ NADPH + H 2 O 2 + Bcp4 5 lM (5). Peroxiredoxin antioxidant system D. Limauro et al. 2072 FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS both showed similar half-lives but, after 2 h at 95 °C, relative activity had dropped to 92% for Bcp4 and to 60% for Bcp3. Interestingly Bcp4 is found to be fairly resistant in 6 m urea: after a 30 min incubation, the enzyme retained 50% of its activity (data not shown). Transcriptional analysis of bcp1, bcp3 and bcp4 under oxidative stress The involvement of bcp1, bcp3 and bcp4 in oxidative stress was investigated by assessing mRNA levels fol- lowing treatment of S. solfataricus cells with H 2 O 2 and t-BOOH as direct oxidants and with paraquat, which was used to generate superoxide anions [15]. To estab- lish the concentrations of agents capable of slowing down or otherwise affecting growth, the cells were treated with different amounts of stressors in the expo- nential phase [11]. Therefore, the S. solfataricus P2 strain was grown until the early exponential phase (0.3 A 600 ) and then induced with 0.1 mm paraquat, 0.05 mm H 2 O 2 and 0.05 mm t-BOOH for varying periods (Fig. 8A–C). The hybridizing bands in the northern analysis revealed the expected size of approxi- mately 500 bp, indicating that the genes are transcribed as monocistronic mRNAs. When S. solfa- taricus cells were incubated with paraquat, H 2 O 2 and t-BOOH, the bcp1 and bcp4 mRNA levels did not increase appreciably, whereas, 15 min after the addi- tion of H 2 O 2 , the level of bcp3 mRNA was found to have risen approximately five-fold. Discussion Prxs are recently identified thiol peroxidases and are ubiquitous among both prokaryotes and eukaryotes. bcp1 16S rRNA bcp4 16S rRNA16S rRNA16S rRNA bcp3 16S rRNA paraquat 0153060015 A B C 30 60 H 2 O 2 0153060 t-BOOH paraquat 0153060 01530 60 H 2 O 2 01530 60 t-BOOH 0 15 60 paraquat 06015 30 t-BOOH 0153060 H 2 O 2 rRNA16S rRNA Fig. 8. Transcriptional response of bcp1, bcp3 and bcp4 to oxidative stress. Cultures of S. solfataricus P2 were grown until the mid-exponential phase and treated with 0.05 m M H 2 O 2 , 0.1 mM paraquat, 0.05 mM t-BOOH for different times. RNAs were obtained from culture harvested at the time shown The arrows indicate the transcript of bcp1 (A), bcp3 (B) and bcp4 (C). The tran- scripts of 16S rRNA were reported for normalization. Tem p erature (°C) 0 20 40 60 80 100 02040 A BC 60 80 100 Tem p erature (°C) 020406080100 Tem p erature (°C) 020406080100 Relative activity (%) 0 20 40 60 80 100 Relative activity (%) 0 20 40 60 80 100 Relative activity (%) Fig. 7. Temperature dependence of Bcp1, Bcp3 and Bcp4. Bcp1 (A), Bcp3 (B) and Bcp4 (C) were incubated under the conditions described in the Experimental procedures with 0.2 m M H 2 O 2 . The peroxidase activity was assayed at different temperatures using the ferrithiocyanate method. The non-enzymatic removal of H 2 O 2 by heat was performed in parallel. D. Limauro et al. Peroxiredoxin antioxidant system FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS 2073 They are classified into several subfamilies based on the number and locations of the conserved cysteine residues that they contain, on subunit composition, on the nature of the electron donor involved in their reduction, and on structural comparison analysis [19]. Recent studies of multigenic Prx families present in cyanobacteria, such as Synechococcus elongatus PCC7942 and Synechocystis sp. PCC6803 [18], and the characterization of Prxs from plants, have led to the identification of a new class of Prxs named PrxQ, simi- lar to Bcps occurring in E. coli, [20]. This family is characterized by a Trx-dependent peroxidase activity, a primary structure in which the two conserved cyste- ine residues in the N-terminal region are separated by five amino acids, and by a similar molecular weight of approximately 17 kDa. The discovery of Prxs in archaea, defined together with cyanobacteria, the oldest evolutionary group of organisms, emphasizes the ancient role of Prxs both in defence against ROS and in redox homeostasis. The system that we have elucidated in the present study detoxifies S. solfataricus cells from peroxides related to Prxs. S. solfataricus shows an array of Prxs, named Bcp1, Bcp2, Bcp3 and Bcp4, which are able to shield cells from the attack of peroxides in the absence of catalases [9]. Sequence analysis points to a significant identity between Bcp1 and Bcp4 and the PrxQ subfamily because of the presence of two conserved residues: Cys 45 and Cys 50. By contrast, Bcp3 shows higher iden- tity values with archaeal Prxs and its functional role differs from those of Bcp1 and Bcp4. Our functional data point to a higher efficiency of Bcp3, compared to both Bcp1 and Bcp4, in scavenging peroxides and in protecting nucleic acid from oxidative damage. DNA cleavage assays performed with an MCO system showed that Bcp3 was able to protect plasmid 10-fold more efficiently than either Bcp1 or Bcp4, in addition to ensuring DNA integrity at an efficiency level com- parable to that of the previously characterized Bcp2 [11]. These findings are in agreement with the observa- tion that 1-Cys-Prxs protect nucleic acid both in eukaryotes and bacteria [18]. Furthermore, the rapid five-fold increase in specific mRNA, as observed dur- ing the transcriptional analysis of Bcp3 15 min after the addition of H 2 O 2 , is comparable to that observed for Bcp2, thus suggesting a role in response to oxida- tive stress. Based on our results, the physiological role of Bcp3 appears to differ from those of Bcp1 and Bcp4 despite their comparable molecular weights, significant sequence identity, and the use of the SSO0192 ⁄ SSO2416 ⁄ NADPH system for enzyme recy- cling. This reducing system involves, for the first time, an enzyme of the PDO family [21], namely SSO0192, in place of a Trx, associated with a Tr in the Prx reducing cascade, emphasizing the key role of the pro- tein both in antioxidant defence and in redox homeo- stasis. Hence, the PDO ⁄ Tr ⁄ NADPH is an alternative reduction system [17] of Prx with respect to the previ- ously characterized Trx (APE0641) ⁄ Tr (APE1061) ⁄ NADPH system of ApPrx (APE2278) in the aerobic archaeon A. pernix [3]. The SSO0192 ⁄ SSO2416 ⁄ NADPH system regenerates Bcp1, Bcp3 and Bcp4, differently from previously char- acterized Bcp2 whose electron donor has so far not been identified. The presence of the conserved Cys45 and Cys50 residues in Bcp1 and Bcp4 and the capabil- ity of the SSO0192 ⁄ SSO2416 ⁄ NADPH system with respect to recycling oxidized enzymes suggests the fol- lowing catalytic mechanism: the putative peroxidatic cysteine, Cys45, could be transformed into a sulfenic acid intermediate that is reduced by the attack of the second cysteine, Cys50, to form an intramolecular disulfide bridge. Subsequently, this disulfide is further reduced by SSO0192 and the oxidized form of SSO0192 is eventually reduced by SSO2416 ⁄ NADPH. As for Bcp3, in which Cys42 is the only cysteine resi- due conserved, it is likely that the sulfenic acid is directly reduced by SSO0192 and that the resulting transient intermolecular disulfide bridge is subse- quently reduced by SSO2416 ⁄ NADPH. The findings obtained in the present study suggest that Bcp1 and Bcp4 protect cells from endogenous per- oxides formed during metabolism, whereas Bcp2 and Bcp3 respond to oxidative stress. Furthermore, the dif- ferent enzyme recycling system adopted by the previ- ously characterized Bcp2, which, unlike the other Bcps, does not use the SSO0192 ⁄ SSO2416 ⁄ NADPH system (data not shown), may reflect different oxidized catalytic centre accessibility and ⁄ or different reaction mechanisms. Experimental procedures Construction and expression of recombinant proteins Genomic DNA of S. solfataricus was prepared as described in Arnold et al. [22]. Based on the bcp1, bcp3 and bcp4 nucle- otide sequences, the following oligonucleotides were designed and used as primers in the PCR gene amplification proce- dures. For bcp1, the forward primer 5¢-TATCTAT CA TATGGTAAAAGTGGGGGA-3¢ and the reverse primer 5¢-AAGAAGGCCAT CTCGAGAGCTGATCT-3¢ contain- ing the NdeI and XhoI restriction sites, respectively (under- lined), were used; the amplification was carried out at 94 °C Peroxiredoxin antioxidant system D. Limauro et al. 2074 FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS for 1 min, 50 °C for 1 min and 72 °C for 1 min, for 35 cycles using HF Taq DNA polymerase (Roche Applied Science, Monza, Italy). For bcp3, the forward primer 5¢-AAATT CA TATGAACGTAGGAGAAGAAGCACCAG-3¢ and the reverse primer 5¢-GA CTCGAGAGTTGAGTTTTGTCT CTTTATTATCTC-3¢ containing the NdeI and XhoI restric- tion sites, respectively (underlined), were used; the amplifi- cation was carried out at 94 °C for 1 min, 45 °C for 1 min and 72 °C for 1 min, for 35 cycles using HF Taq DNA polymerase (Roche). For bcp4, the forward primer 5¢-CAAAATCTTT CATATGGTAGAAATAGG-3¢ and the reverse primer 5¢-GCCTAGCCATAACAT CTCGAGAG ATA-3¢ containing the NdeI and XhoI restriction sites, respectively (underlined), were used; the amplification was carried out at 94 °C for 1 min, 48 °C for 1 min and 72 °C for 1 min, for 35 cycles using HF Taq DNA polymerase (Roche). The PCR products were purified with QIAquick PCR purifi- cation kit (Quiagen Spa, Milan, Italy) and cloned in pGEMTeasy vector (Promega Italia Srl, Milan, Italy). The nucleotide sequences of the inserted genes were determined to ensure that no mutations were present in the genes. Then, NdeI-XhoI fragments were cloned into pET-30c(+) (Novagen, Darmstadt, Germany) giving the recombinant plasmids pETBcp1, pETBcp3 and pETBcp4, respectively, that were used to transform competent E. coli BL21-Codon- Plus (DE3)-RIL cells for expression purposes. Cells were grown to an A 600nm of approximately 1 in LB media supplemented with kanamycin (50 lgÆmL )1 ) and chl- oramphenicol (33 lgÆmL )1 )at37°C and were induced for 3 h. The expression of Bcp3 and Bcp4 was induced by 1mm isopropyl thio-b-d-galactoside (Inalco S.P.A., Milan, Italy) for 3 h, whereas the induction was carried out for 6 h for Bcp1. Purification of Bcp1, Bcp3 and Bcp4 recombinant proteins Escherichia coli cells containing the expressed recombinant proteins were harvested by centrifugation and pellets from 1000 mL cultures were suspended in 20 mm Tris ⁄ HCl (pH 8.0) and disrupted by sonication with 20 min pulses at 20 Hz (Sonicator Ultrasonic liquid processor; Heat System Ultrasonics Inc., NY, USA). The suspensions were clarified by ultracentrifugation at 160 000 g for 30 min. The crude extracts obtained were heated at 80 °C for 15 min and then centrifugated at 15 000 g at 4 °C for 30 min, removing almost 70% of the mesophilic host proteins. The extract were concentrated (Amicon, Millipore Corp.; Bedford, MA, USA) and applied to a HisTrap HP (GE Healthcare, Healthcare Europe, GmbH, Milan, Italy) equilibrated with 50 mm Tris ⁄ HCl (pH 8.0), 0.3 m NaCl (buffer A). The columns were washed with buffer A with 20 mm imidazole, and proteins were eluted with the same buffer A, supple- mented with 250 mm imidazole. The active fractions were pooled and dialyzed against 20 mm Tris ⁄ HCl (pH 8.0). The concentrated samples of Bcp3 and Bcp4 were applied on two different ionic-exchange columns. The Bcp3 sample was applied to a Resource S (GE Healthcare) in 20 mm sodium phosphate buffer (pH 6.5) connected to AKTA system (GE Healthcare) and eluted with a linear gradient 0.1–0.4 m NaCl in 30 min at a flow rate of 1 mLÆmin )1 . The active fractions were pooled, concentrated and exten- sively dialysed against 20 m m Tris ⁄ HCl (pH 8.0). Bcp4 was applied to a Resource Q (GE Healthcare) in 50 mm Tris ⁄ HCl (pH 9.0) connected to AKTA system (GE Healthcare) and eluted with a linear gradient 0.1–0.5 m NaCl for 30 min at a flow rate of 1 mLÆmin )1 . The active fractions were pooled, concentrated and extensively dialysed against 20 mm Tris ⁄ HCl (pH 8.0). Determination of quaternary structure The molecular mass of the Bcp1, Bcp3 and Bcp4 recombi- nant proteins were determined by gel-filtration chromato- graphy on a Superdex 75 PC (0.3 cm ⁄ 3.2 cm) connected to AKTA system (GE Healthcare). Proteins were eluted with buffer 20 mm sodium phospate (pH 7.4), 0.2 m KCl at a flow rate of 0.04 mLÆmin )1 . b-Amylase (200 kDa), alcohol dehydrogenase (150 kDa), BSA (65.4 kDa), ovalbumin (48.9 kDa), chimotrypsinogen (22.8 kDa) and the RNasi A (15.6 kDa) were used as molecular weight standards (GE Healthcare). Analytical methods for Bcp recombinant protein characterization Proteins concentration was determined using BSA as the standard [23]. Protein homogeneity was estimated by SDS ⁄ PAGE [24] using 12.5% (w ⁄ v) acrylamide resolving gel and 5% acrylamide stacking gel. Samples were heated at 100 °C for 5 min in 2% SDS and 2% 2-mercaptoetha- nol and run in comparison with molecular weight stan- dards. Gels were stained with the Coomassie Brilliant Blue procedure. The molecular mass of the Bcp1, Bcp3 and Bcp4 were also estimated using electrospray mass spectra recorded on a Bio-Q triple quadrupole instrument (Micromass, Man- chester, UK). Samples were dissolved in 1% (v ⁄ v) acetic acid ⁄ 50% (v ⁄ v) acetonitrile and injected into the ion source at a flow rate of 10 lLÆmin )1 using a Phoenix syringe pump (Carlo Erba Strumentazione, Milan, Italy). Spectra were collected and elaborated using masslynx software provided by the manufacturer. Calibration of the mass spectrometer was performed with horse heart myoglobin (16.9 kDa). DNA cleavage assay by the MCO system The ability of Bcps to protect DNA from oxidative nicking by hydroxyl radicals was determined as previously D. Limauro et al. Peroxiredoxin antioxidant system FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS 2075 described by Lim et al. [25]. A reaction mixture of 50 lL included 3 lm FeCl 3 ,10mm dithiothreitol for the thiol MCO system, 100 mm Hepes (pH 7.0), different concentra- tions of recombinant Bcp1 or Bcp3 or Bcp4 or BSA as a negative control or Bcp2 as a positive control. The reaction was initiated by incubating the mixture for 40 min at 37 °C before adding 2 lg of plasmid pUC19 and developed for an additional 1 h at the same temperature. DNA bands were evaluated on 0.8% (w ⁄ v) agarose gel after staining with ethidium bromide 5 lgÆmL )1 . Assays of peroxidase activity Bcps recombinant proteins were tested for their ability to remove peroxides in an in vitro non-enzymatic assay. The reaction was started adding H 2 O 2 or t-BOOH at a final concentration of 0.2 mm to the reaction mixture containing 50 mm Hepes (pH 7.0), 10 mm dithiothreitol in the presence of different concentrations of Bcps in a final volume of 0.1 mL. As an alternative to dithiothreitol as an electron donor, a mixture containing 0.25 mm NADPH, 0.2 lm SSO2416, 20 lm SSO192, 0.05 mm FAD was used, forming a reducing cascade to recycle the enzymes. The reaction was incubated at 80 °C for 1 min and stopped by adding 0.9 mL of trichloroacetic acid solution (10%, w ⁄ v), as pre- viously described by Lim et al. [23]. Peroxidase activity was determined from the amount of peroxide remaining, which was detected by measurement of the purple-colored ferri- thiocyanate complex developed after the addition of 0.2 mL of 10 mm Fe(NH 4 ) 2 (SO 4 ) 2 and 0.1 mL of 2.5 m KSCN, using H 2 O 2 as a standard. The amount of the ferrithiocya- nate complex present was determined by measurement of A 490 . The percentage of peroxides removed was calculated on the basis of the change in A 490 obtained with Bcps rela- tive to that obtained without Bcps. Experiments were per- formed in triplicate. Transcriptional analysis Sulfolobus solfataricus P2 strain liquid cultures were grown aerobically at 80 °C in mineral medium supplemented with 0.1% BactoÔ yeast extract (Becton Dickinson and Com- pany, Franklin Lakes, NJ, USA), 0.1% tryptone (Oxoid, Basingstoke, Hampshire, UK) and 0.2% sucrose (TYS medium) in an orbital shaker. Oxidative stresses were per- formed by adding paraquat, H 2 O 2 or t-BOOH at a final concentration of 0.1 mm and 0.05 mm, respectively, to S. solfataricus cultures in early exponential growth phase (A 600 = 0.3). Aliquots of cultures were collected at differ- ent times by centrifugation at 5000 g for 10 min at 4 °C. Total RNA was extracted by the guanidinium isothiocya- nate method, as described in Sambrook et al. [26]. The integrity and concentration of total RNA were verified by electrophoretic analysis by separating the total RNA on 1% agarose gel containing formaldehyde. Northern blot analysis was performed to quantify the amount of bcp1, bcp3 and bcp4 mRNA in different stress conditions and to determine the size of the specific tran- scripts. The NdeI-XhoI fragments derived from digestion of pET- Bcp1, pETBcp3 and pETBcp4, purified from agarose gel, labelled with [a 32 P]dATP and with random primed DNA labelling kit (Roche), were used to identify bcp1, bcp3 and bcp4 mRNA, respectively. Acknowledgements This work was supported by grants from MIUR (PRIN 2003-2004). References 1 Imaly JA (2003) Pathways of oxidative damage. Annu Rev Microbiol 57, 395–418. 2 Rho BS, Hung LW, Holton JM, Vigil D, Kim SI, Park MS, Terwilliger TC & Pedelacq JD (2006) Functional and structural characterization of a thiol peroxidase from Mycobacterium tuberculosis. J Mol Biol 361, 850–863. 3 Jeon SJ & Ishikawa K (2003) Characterization of novel hexadecameric thioredoxin peroxidase from Aeropyrum pernix K1. J Biol Chem 278, 24174–24180. 4 Dietz KJ, Jacob S, Oelze ML, Laxa M, Tognetti V, De Miranda SM, Baier M & Finkemeier I (2006) The func- tion of peroxiredoxins in plant organelle redox metabo- lism. J Exp Bot 57, 1697–1709. 5 Wood ZA, Schroder E, Robin HJ & Poole LB (2003) Structure, mechanism and regulation of peroxiredoxins. Trends Biochem Sci 28, 32–40. 6 Seaver LC & Imlay JA (2001) Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli. J Bacteriol 183, 7173–7181. 7 Kashima Y & Ishikawa K (2003) Alkyl hydroperoxide reductase dependent on thioredoxin-like protein from Pyrococcus horikoshii. J Biochem (Tokyo) 134, 25–29. 8 Kawakami R, Sakuraba H, Kamohara S, Goda S, Kawarabayasi Y & Ohshima T (2004) Oxidative stress response in an anaerobic hyperthermophilic archaeon: presence of a functional peroxiredoxin in Pyrococcus horikoshii. J Biochem (Tokyo) 136, 541–547. 9 She Q, Singh RK, Confalonieri F, Zivanovic Y, Allard G, Awayez MJ, Chan-Weiher CC, Clausen IG, Curtis BA, De Moors A et al. (2001) The complete genome of the crenarchaeon Sulfolobus solfataricus P2. Proc Natl Acad Sci USA 98, 7835–7840. 10 Ursby T, Adinolfi BS, Al-Karadaghi S, De Vendittis E & Bocchini V (1999) Iron superoxide dismutase from the archaeon Sulfolobus solfataricus: analysis of struc- ture and thermostability. J Mol Biol 286, 189–205. Peroxiredoxin antioxidant system D. Limauro et al. 2076 FEBS Journal 275 (2008) 2067–2077 ª 2008 The Authors Journal compilation ª 2008 FEBS [...]... Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress FEBS J 273, 72 1– 731 12 De Vendittis E, Ursby T, Rullo R, Gogliettino MA, Masullo M & Bocchini V (2001) Phenylmethanesulfonyl fluoride inactivates an archaeal superoxide dismutase by chemical modification of a specific tyrosine residue Cloning, sequencing and expression of. .. quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 24 8–2 54 Weber K, Pringle JR & Osborn M (1972) Measurement of molecular weight by electrophoresis on SDS-acrylamide gel Methods Enzymol 26, 3–2 7 Lim YS, Cha MK, Kim HK, Uhm TB, Park JW, Kim K & Kim IH (1993) Removals of hydrogen peroxide and hydroxyl radical by thiol-specific antioxidant protein as a possible role in vivo Biochem... thioredoxin-like ancestor Biochemistry 43, 1398 1–1 3995 Hosoya-Matsuda N, Motohashi K, Yoshimura H, Nozaki A, Inoue K, Ohmori M & Hisabori T (2005) Anti-oxidative stress system in cyanobacteria Significance of type II peroxiredoxin and the role of 1-Cys peroxiredoxin in Synechocystis sp strain PCC 6803 J Biol Chem 7, 84 0–8 46 Pedone E, Limauro D & Bartolucci S (2008) The machinery for oxidative protein folding... coding for Sulfolobus solfataricus superoxide dismutase Eur J Biochem 268, 179 4–1 801 13 Cannio R, D’angelo A, Rossi M & Bartolucci S (2000) A superoxide dismutase from the archaeon Sulfolobus solfataricus is an extracellular enzyme and prevents the deactivation by superoxide of cell-bound proteins Eur J Biochem 267, 23 5–2 43 14 Bini E, Dikshit V, Dirksen K, Drozda M & Blum P (2002) Stability of mRNA in. .. the genomes of the cyanobacteria Synechocystis sp PCC 6803 and Synechococcus Peroxiredoxin antioxidant system 19 20 21 22 23 24 25 26 elongatus PCC 7942 for the presence of peroxiredoxins and their transcript regulation under stress J Exp Bot 56, 319 3–3 206 Copley SD, Novak WR & Babbitt PC (2004) Divergence of function in the thioredoxin fold suprafamily: evidence for evolution of peroxiredoxins from a... archaeon Sulfolobus solfataricus RNA 8, 112 9–1 136 15 Limauro D, Fiorentino G & Bartolucci S (2004) How Sulfolobus responds to enviromental stress In Biochemistry and Molecular Biology in the Thermophilic Archaeon Sulfolobus solfataricus (Farina B & Faraone Mennella MR, eds), pp 10 5–1 30 Research Signpost, Kerala, India 16 Pedone E, D’Ambrosio K, De Simone G, Rossi M, Pedone C & Bartolucci S (2006) Insights... structural and functional analysis of a protein disulfide oxidoreductase from the bacterium Aquifex aeolicus J Mol Biol 356, 15 5–1 64 17 Pedone E, Limauro D, D’Alterio R, Rossi M & Bartolucci S (2006) Characterization of a multifunctional protein disulfide oxidoreductase from Sulfolobus solfataricus FEBS J 273, 540 7–5 420 18 Stork T, Michel KP, Pistorius EK & Dietz KJ (2005) Bioinformatic analysis of the genomes... folding in thermophiles Antioxid Redox Signal 10, 15 7–1 70 Arnold HP, She Q, Phan H, Stedman K, Prangishvili D, Holz I, Kristjansson JK, Garrett R & Zillig W (1999) The genetic elements pSSVx of the extremely thermophilic crenarchaeon Sulfolobus is a hybrid between a plasmid and a virus Mol Microbiol 34, 21 7–2 26 Bradford M (1976) A rapid and sensitive method for the quantification of microgram quantities of. .. hydroxyl radical by thiol-specific antioxidant protein as a possible role in vivo Biochem Biophys Res Commun 192, 27 3–2 80 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory, Cold Spring Harbor, NY FEBS Journal 275 (2008) 206 7–2 077 ª 2008 The Authors Journal compilation ª 2008 FEBS 2077 . not shown). Transcriptional analysis of bcp1, bcp3 and bcp4 under oxidative stress The involvement of bcp1, bcp3 and bcp4 in oxidative stress was investigated by assessing mRNA levels. Peroxiredoxins as cellular guardians in Sulfolobus solfataricus – characterization of Bcp1, Bcp3 and Bcp4 Danila Limauro 1 , Emilia