Báo cáo khoa học: Changes in acetylcholine receptor function induce shifts in muscle fiber type composition docx

Changes in acetylcholine receptor function induce shifts in muscle fiber type composition Tae-Eun Jin1,*, Anton Wernig2 and Veit Witzemann1 Abt Zellphysiologie, Max-Planck-Institut fur Medizinische Forschung, Heidelberg, Germany ă Institut fur Physiologie, Universitat Bonn, Germany ă ă Keywords acetylcholine receptor; acetylcholine receptor e-subunit knockout mice; fast and slow muscle; fiber type; real-time PCR Correspondence V Witzemann, Abt Zellphysiologie, Max-Planck-Institut fur Medizinische ă Forschung, Jahnstr 29, D-69120 Heidelberg, Germany Fax: +49 6221 486459 Tel: +49 6221 486475 E-mail: witzeman@mpimf-heidelberg.mpg.de *Present address Center for Cell Signaling Research, Ewha Woman’s University, Seoul, South Korea (Received January 2008, revised 12 February 2008, accepted 25 February 2008) doi:10.1111/j.1742-4658.2008.06359.x AChRe) ⁄ ) mice lack e-subunits of the acetylcholine receptor and thus fail to express adult-type receptors The expression of fetal-type receptors throughout postnatal life alters postsynaptic signal transduction and causes a fast-to-slow fiber type transition, both in slow-twitch soleus muscle and in fast-twitch extensor digitorum longus muscle In comparison to wildtype muscle, the proportion of type slow fibers is significantly increased (6%), whereas the proportion of fast fibers is reduced (in soleus, type 2A by 12%, and in extensor digitorum longus, type 2B ⁄ 2D by 10%) The increased levels of troponin Islow transcripts clearly support a fast-to-slow fiber type transition Shifts of protein and transcript levels are not restricted to ‘myogenic’ genes but also affect ‘synaptogenic’ genes Clear increases are observed for acetylcholine receptor a-subunits and the postsynaptically located utrophin Although the fast-to-slow fiber type transition appears to occur in a coordinated manner in both muscle types, muscle-specific differences are retained Most prominently, the differential expression level of the synaptic regulator MuSK is significantly lower in extensor digitorum muscle than in soleus muscle The results show a new quality in muscle plasticity, in that changes in the functional properties of endplate receptors modulate the contractile properties of skeletal muscles Muscle thus represents a self-matching system that adjusts contractile properties and synaptic function to variable functional demands The impact of innervation on the establishment of specific muscle fiber types during embryonic and postnatal development has been demonstrated in numerous studies [1], and has been attributed to the specific neural impulse pattern [2] that can be mimicked partially by electrical stimulation [3,4] Skeletal muscles adapt to specific functions and have, throughout development, the capacity to change their phenotype in response to altered functional demands Their phenotypic profiles are affected not only by innervation ⁄ neuromuscular activity, but also by exercise training, mechanical load- ing ⁄ unloading, hormones, and aging, causing transitions from fast-to-slow or slow-to-fast fiber types Muscle activity has also been shown to induce structural and functional adaptations of the neuromuscular junction (NMJ), suggesting that muscle function, fiber type composition and plasticity of the NMJ may be linked [5] In order to identify the contributions of postsynaptic signaling to adaptation of muscle function, it is necessary to modulate activity specifically at endplate acetylcholine receptors (AChRs), leaving neuronal inputs unchanged and avoiding complex Abbreviations AChR, acetylcholine receptor; BS, blocking solution; CSA, cross-sectional area; EDL, extensor digitorum longus muscle; GABP, growthassociated binding protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MuSK, muscle, skeletal, receptor tyrosine kinase; MyHC, myosin heavy chain; NFAT, nuclear factor of activated T cells; NMJ, neuromuscular junction; P, postnatal day; SOL, soleus muscle; Utrn, utrophin 2042 FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS T.-E Jin et al treatments that affect both presynaptic and postsynaptic signaling, such as denervation, pharmacological blockade, and exercise training Mammalian AChRs are expressed in two forms: Embryonic-type AChRc, composed of a2bcd subunits, is replaced during postnatal development by adult-type AChRe, composed of a2bed subunits [6,7] As a result, endplate AChRs have reduced channel open times, increased ion conductance, and higher Ca2+ permeability [6,8,9] Muscles of AChRe) ⁄ ) mice lack adulttype AChRe and express instead embryonic-type AChRc throughout postnatal life Nevertheless, molecular maturation of the postsynaptic apparatus proceeds in the absence of the AChRe, and all endplates are apposed by nerve endings that appear to be normal in structure and function despite progressive AChR deficiency with increasing age [10,11] Thus, the AChRe) ⁄ ) mice provide a model system for altered postsynaptic signaling We analyzed the muscle fiber type composition in skeletal muscle of AChRe) ⁄ ) and wild-type mice, with the aim of answering the following questions: (a) what is the composition of muscle fiber type of the slowtwitch soleus (SOL) muscle and the fast-twitch extensor digitorum longus (EDL) muscle; (b) is the fiber type composition changed in AChRe) ⁄ ) mice; (c) are changes in fiber type correlated with the mRNA expression pattern of muscle-specific and synapse-specific genes; and (d) are changes in the contractile machinery linked to changes in transcript levels of myogenic genes and synaptogenic genes that regulate, directly or indirectly, synaptic structure ⁄ function? Our results show that changes in the functional properties of endplate AChRs modulate the contractile properties of skeletal muscles and change the expression profile of myogenic genes in a coordinated fashion Results Developmental changes of muscle fiber types in muscle of wild-type and AChRe) ⁄ ) mice The heavy chain portion of the myosin molecule (MyHC) determines the major functional characteristic of distinct myosin isoforms and thus provides a particularly useful molecular marker for muscle fiber types [12,13] The different MyHC isoforms correlate with the functional characteristics of the respective fiber type in the adult muscle [1], and fiber types are classified as: type with MyHC1, type 2A with MyHC2A, type 2D with MyHC2D, and type 2B with MyHC2B As described in Experimental procedures, serial crosssections from SOL muscle of wild-type mice were AChR and muscle fiber type composition A B C D Fig Fiber type composition in SOL muscle of wild-type mice at P85 Serial cross-sections (10 lm) were analyzed by ATPase staining and immunochemically by using antibodies to MyHC The asterisk marks the position of identical muscle fibers in serial crosssections (i) Type muscle fiber (a) Type 2A muscle fiber (b) Type 2B ⁄ 2D muscle fiber Scale bar in (D) is 100 lm (A) ATPase staining at pH 4.6 identifies type fibers (dark stain), type 2A fibers (light stain), and type 2B ⁄ 2D fibers (intermediate stain) (B) ATPase staining at pH 9.4 identifies type fibers (light stain), and type fibers (dark stain) (C) Immunochemical staining using antibody to MyHC1 (MY-32 at a : 1000 dilution) identifies type fibers (D) Immunochemical staining using antibody to MyHC2 (NOQ7.5.4.D at a : 200 dilution) identifies type fibers stained with hematoxylin ⁄ eosin to visualize the individual muscle fibers In addition, type 1, 2A and 2B ⁄ 2D fibers were clearly identified by ATPase staining at pH 4.6 (Fig 1A) and at pH 9.4 (Fig 1B) Type and fibers were also visualized by immunochemical staining (Fig 1C,D) These staining procedures were employed to compare the fiber type composition of SOL and EDL muscles in wild-type and AChRe) ⁄ ) mice Because the fiber type composition of muscle changes during postnatal development [14,15], we first determined the time when adult MyHC isoforms were expressed at constant levels in the SOL muscle of wildtype mice (Fig 2A–D) ATPase staining at pH 4.6 identified type 1(dark stain), 2A (light stain), and 2B ⁄ 2D (intermediate stain) fibers, and showed that between postnatal day (P)15 and P20, the proportion of slow type and fast type 2A fibers was still variable After P20, from P60 up to P85, the fiber types remained at constant levels (Fig 2E,F) At all stages, a few fast fibers, type 2B ⁄ 2D (0 £ 1% of the total fibers), were detectable Throughout the postnatal period analyzed here, the cross-sectional areas (CSAs) of single muscle fibers increased (Fig 2F,G) FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS 2043 AChR and muscle fiber type composition A T.-E Jin et al E Fiber types (% of total) B 80 60 40 20 D C // 15 20 60 87 Total fibers G Type 2a Type CSA (µm2) F Fiber number Postnatal days (P) Type Type 2a Type 2b2d Type 2b/2d 20 30 40 50 60 Postnatal days (P) 70 80 20 30 40 50 60 Postnatal days (P) 70 80 Fig Fiber type composition in SOL muscle of wild-type mice at increasing postnatal age Cross-sections of SOL at (A) P15, (B) P20, (C) P60, and (D) P85 (E) Developmentally regulated changes in fiber type composition in percent of total fibers (type fibers, white bars; type 2A fibers, gray bars; type 2B ⁄ 2D fibers, black bars) Original values are given in the table below the diagram (F) Number of fiber types increases during postnatal development Data were collected from three different animals using cross-sections as indicated in the table (n) (G) CSAs of fiber types increase throughout postnatal development In each case, seven separate cross-sections were used to determine the CSA of 50–70 fibers ATPase staining, pH 4.6 Scale bar in (D), 100 lm Next, we analyzed SOL muscle from AChRe) ⁄ ) mice, and representative cross-sections are shown in Fig 3A (P20) and Fig 3B (P58) At P20, muscle type 1, 2A and 2B ⁄ 2D fibers displayed a similar composition as in wild-type muscle at P15, suggesting that postnatal differentiation in AChRe) ⁄ ) mice may be delayed in comparison to wild-type mice Furthermore, fiber types had not reached constant levels at P20 and the profile displayed a moderate but steady ‘fast-toslow’ transition throughout postnatal development Until P60, the type fiber level had increased by 10%, whereas type 2A fibers decreased by 17% In addition, there was a 7% increase in type 2B ⁄ 2D fibers (Fig 3C) The values shown in Fig 3D demonstrate the significance of the observed changes AChRe) ⁄ ) mice develop severe muscle weakness and muscle atrophy during postnatal age, which might affect fiber number and ⁄ or reduce muscle mass Therefore, we not only followed myofiber type transitions, 2044 but also counted the total number of muscle fibers and determined the CSAs in SOL mucle of AChRe) ⁄ ) mice (Fig 4A–C) In spite of progressive muscle weakness and the observed fast-to-slow fiber type transition, the total number of fibers (Fig 4A,B) was comparable to that in wild-type SOL muscle (Fig 2F), and the CSAs increased until P60 (Fig 4A,C), as observed in wildtype mice (Fig 2G) Muscle fiber types in SOL and EDL muscle from wild-type and AChRe) ⁄ ) mice To confirm the observed fast-to-slow shift in fiber type composition in SOL muscle from AChRe) ⁄ ) and wildtype mice, we compared both muscles directly under identical experimental conditions In SOL muscle from AChRe) ⁄ ) mice, numbers of type and 2B ⁄ 2D fibers increased by 6%, whereas those of type 2A fibers decreased by about 12% (Fig 5A,C,E) The total fiber FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS T.-E Jin et al AChR and muscle fiber type composition A Fiber types (% of total) C B Type Type 2A Type 2B/2D 60 40 20 20 60 20 60 Postnatal days (P) 20 60 D Fig Fiber type composition in SOL muscle of AChRe) ⁄ ) mice at increasing postnatal age Cross-sections of SOL muscle from AChRe) ⁄ ) mice are shown, (A) at P20 and (B) at P58 ATPase staining, pH 4.6 Scale bar below (B), 100 lm (C) Columns represent percentage of muscle fibers in SOL muscle (% of total) at P20 and P60, respectively, for type 1, 2A and 2B ⁄ 2D fibers, as indicated (D) Original values were collected from 18–72 cross-sections (n) For mice AChRe) ⁄ ) at P20, three different animals were used to generate the cross-sections of SOL muscle The P60 values of AChRe) ⁄ ) mice were from four different animals, ranging between 50 and 60 days in age number and the CSAs were, as noted before, comparable to those in wild-type SOL muscle (Table 1) This raised the question of whether similar changes were also induced in fast-twitch muscles, which differ in their contractile properties and in their MyHC expression profile from slow-twitch muscle Wild-type EDL muscles have predominantly type 2A fibers mixed with type 2D ⁄ 2B fibers and a few type fibers The direct comparison with EDL muscles from AChRe) ⁄ ) mice showed a 6% increase in the proportion of type fibers, which was similar to the increase observed in slow-twitch muscle In contrast to SOL muscle, there was a small increase of about 3% in type 2A fast fibers, possibly at the expense of type 2B ⁄ 2D fibers, which decreased by 10% (Fig 5B,D,F) The CSAs of type 2A and 2B ⁄ 2D fibers in EDL muscle from AChRe) ⁄ ) mice were smaller than in wild-type muscle, whereas type fibers showed no significant difference (Table 1) The total number of fibers was reduced in EDL muscle of AChRe) ⁄ ) mice in comparison to that of wild-type mice (Table 1) Direct comparison of the fiber type composition in EDL and SOL muscles from wild-type mice distinguishes EDL muscle clearly as fast muscle, in that type fibers are expressed in much lower numbers than in SOL muscle, whereas type 2B ⁄ 2D fibers are expressed much more abundantly (Fig 5G) The profile for EDL muscle versus SOL muscle in AChRe) ⁄ ) mice still identifies EDL muscle as fast muscle in comparison to SOL muscle However, the increased number of type fibers and the reduced number of type 2B ⁄ 2D fibers clearly reflects the fast-to-slow shift in fiber composition in EDL muscle of AChRe) ⁄ ) mice Transcript levels in muscles from AChRe) ⁄ ) and wild-type mice The changing fiber type compositions led to the question of whether differences in MyHC protein profiles in SOL and EDL muscles were reflected by changes in the transcript levels of the corresponding MyHC genes In addition, we wanted to investigate whether these ‘AChR-mediated’ signals that change muscle fiber types cause changes in the expression of synaptically expressed genes We therefore selected, besides the ‘myogenic’ genes, several ‘synaptogenic’ genes that contribute directly or indirectly to synapse formation and ⁄ or function and determined their respective mRNA expression levels Comparing myogenic transcripts in SOL muscle of AChRe) ⁄ ) and wild-type mice (Fig 6A), we observed increased levels of MyHC1 and MyHC2A, whereas levels of MyHC2B and MyHC2D were decreased We also measured troponin I transcripts, as their fiber type-specific expression depends on ‘slow’ and ‘fast’ innervation [16] In accordance with a fast-to-slow transition, an increase was observed for troponin Islow, whereas troponin Ifast appeared to be unaffected Ca2+-dependent calcineurin ⁄ nuclear factor of activated T cells (NFAT) signaling is also thought to contribute to muscle activity-regulated fiber transformations [17] Therefore, we determined the transcript levels of the transcription factors NFATc1 and NFATc4, but observed no significant changes Synaptogenic transcript levels (Fig 6B) were elevated for AChR a-subunits, muscle, skeletal, receptor tyrosine kinase (MuSK) and utrophin (Utrn) transcripts, and were not significantly different (changes ‡ 2-fold or £ 2-fold) for AChR c-subunit, dystrophin, rapsyn, growth-associated binding protein (GABP)a, GABPb, dishevelled (Dvl1), and sodium channel (Scn4a) In AChRe) ⁄ ) mice, AChR e-subunit transcripts were not detected using primers recognizing sequences of exon that had been deleted in AChRe) ⁄ ) mice AChRe-subunit FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS 2045 AChR and muscle fiber type composition A Fiber type T.-E Jin et al Fiber type 2A Fiber type 2B/2D n Total number *(P < 0.05), **(P < 0.001) B C CSA (µm2) Fiber number Total fibers Type 2A Type Type Type 2A Type 2B/2D Type 2B/2D 20 Postnatal days (P) 60 20 Postnatal days (P) 60 Fig Number and CSAs of muscle fibers in SOL muscle from AChRe) ⁄ ) mice during postnatal development (A) Numbers of total fibers, type 1, 2A and 2B ⁄ 2D fibers, and CSAs, are shown for SOL muscle from AChRe) ⁄ ) mice at P20 (18 cross-sections from three different animals) and at P60 (72 cross-sections from four different animals between 50 and 60 days old) Fiber types were determined by ATPase staining, pH 4.6 (B) Number of total fibers, type 1, 2A and 2B ⁄ 2D fibers, in SOL muscle at P20 and P60 from AChRe) ⁄ ) mice are plotted as mean values ± SEM Arrows illustrate increase ⁄ decrease of fiber type numbers as indicated (C) CSAs (lm2 ± SEM) of type 1, 2A and 2B ⁄ 2D fibers in SOL muscle of AChRe) ⁄ ) mice at P20 and P60 are plotted In each case, seven separate cross-sections were used to determine the CSA of 50–70 fibers Arrows show that the CSA increases between P20 and P60 transcripts, however, were identified using primers that recognize 5¢-upstream sequences of exon With these primers, we observed that the transcriptional activities of the e-subunit genes were similar in AChRe) ⁄ ) and in wild-type muscle Comparing EDL muscle of AChRe) ⁄ ) mice and wild-type mice (Fig 6C), we found that expression of myogenic gene transcripts was strongly increased for MyHC1 and moderately increased for MyHC2A, whereas no significant changes were observed for MyHC2B and MyHC2D, reflecting the fast-to-slow fiber shift Troponin Islow was clearly increased and troponin Ifast was also elevated in this muscle Again, no significant changes were seen for NFATc1 and NFATc4 transcripts Synaptogenic transcripts (Fig 6D) of AChR a-subunits were increased, whereas AChR e-subunit transcripts were reduced and AChR c-subunits were not significantly changed Rapsyn and Utrn also appeared to be increased No significant changes were observed for dystrophin, MuSK, GABPa, GABPb, Dvl1, and Scn4a In Fig 6A,C, 2046 arrows indicate increased or reduced expression of MyHC type 1, 2A and 2B ⁄ 2D fibers A correlation with changes in the corresponding transcripts was seen only for MyHC1 in SOL and EDL muscle and for MyHC2A in EDL muscle The other transcript levels did not match fiber type expression Differential expression of selected ‘myogenic’ and ‘synaptogenic’ transcripts in SOL and EDL muscle Comparison of transcript levels in SOL and EDL muscle of wild-type mice and of AChRe) ⁄ ) mice could reveal differences between slow and fast muscles and thus indicate whether altered AChR function would change the expression of myogenic and ⁄ or synaptogenic transcripts In EDL muscle of wild-type mice, MyHC1 transcripts were strongly reduced and MyHC2B transcripts were strongly increased as compared to SOL muscle MyHC2A and MyHC2D transcripts showed no significant difference Troponin Islow clearly stood FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS T.-E Jin et al AChR and muscle fiber type composition A B C D E F G Fig Comparison of fiber type composition in muscle sections from SOL and EDL muscle of wild-type and AChRe) ⁄ ) mice Crosssections of (A) SOL muscle and (B) EDL muscle of wild-type mice at P75, and (C) SOL muscle and (D) EDL muscle of AChRe) ⁄ ) mice at P60 Cross-sections (10 lm) of three or four different animals were subjected to ATPase staining, pH 4.6 (i) Type fiber (a) Type 2A fiber (b) Type 2B ⁄ 2D fiber Scale bar in (D) is 100 lm (E) Fiber type composition in SOL muscle of wild-type mice (white columns; 100 cross-sections) compared with fiber type composition in AChRe) ⁄ ) mice (gray columns; 72 cross-sections) Columns represent type 1, 2A and 2B ⁄ 2D fibers (% of total) (F) Fiber type composition in EDL muscle of wild-type mice (white columns; 12 cross-sections) compared with fiber type composition in AChRe) ⁄ ) mice (gray columns; 12 cross-sections) Columns represent type 1, 2A and 2B ⁄ 2D fibers (% of total) (G) Comparison of fiber type composition of EDL muscle versus SOL muscle in wildtype mice (white columns) and AChRe) ⁄ ) mice (gray columns) EDL values were normalized to SOL values (fiber type EDL ⁄ fiber type SOL) and plotted on a logarithmic scale The EDL ⁄ SOL profile of AChRe) ⁄ ) mice is similar to the wild-type profile, but type fibers are increased, whereas type 2B ⁄ 2D fibers are reduced out as a marker for fast-to-slow transition, and was accordingly reduced in EDL muscle, whereas troponin Ifast was expressed at similar levels in SOL and EDL muscle The NFATc1 and NFATc4 transcripts showed no significant difference (Fig 7A) Comparing transcript levels of synaptogenic genes in SOL and EDL muscles of wild-type mice, we observed no changes ‡ 2-fold or £ 2-fold for the AChR e-subunit, Dvl1, Utrn, and Scn4a transcripts Slightly reduced transcript levels were observed for the AChR a-subunit, rapsyn, dystrophin, GABPa and GABPb transcripts (Fig 7B) AChR c-subunit and MuSK transcripts were significantly reduced in EDL muscle The myogenic and synaptogenic transcript profiles of SOL and EDL muscle in AChRe) ⁄ ) mice still reflected muscle-specific differences between SOL and EDL muscles A closer look at individual transcript levels, however, showed that MyHC1 transcripts in EDL muscle of AChRe) ⁄ ) mice were elevated in comparison to wild-type EDL muscle (Fig 7B), in accordance with the fast-to-slow fiber type transition in AChRe) ⁄ ) mice (Fig 5G) An increase was also seen for MyHC2B transcript levels, which is explained by the fact that MyHC2B transcripts were downregulated in SOL muscle but upregulated in EDL muscle of AChRe) ⁄ ) mice Further support for a fast-to-slow transition was the shift of troponin Islow to higher levels in EDL muscle in AChRe) ⁄ ) mice The synaptogenic transcript levels displayed no significant shifts when SOL and EDL muscles of AChRe) ⁄ ) mice and SOL and EDL muscles of wild-type mice were compared As in EDL muscle of wild-type mice, the transcripts of the AChR c-subunit as well as the MuSK gene were reduced to similarly low levels (Fig 7D) Discussion AChRe) ⁄ ) mice were employed to investigate whether functional properties of endplate AChRs affect the fiber type composition in muscle In AChRe) ⁄ ) mice, embryonic-type AChRc is not replaced by adult-type AChRe and is expressed throughout postnatal life [10,11] The results show a new quality in muscle plasticity: postnatal expression of AChR with prolonged channel open time but reduced Ca2+ permeability and ion conductance stimulates transitions from fast to slow fiber types, both in SOL muscle and in EDL muscle The AChR-induced changes in ‘myogenic’ and ‘synaptogenic’ gene expression indicate that AChR-mediated postsynaptic signaling is linked to signal pathways that regulate fiber type composition MyHC isoforms in SOL muscle of wild-type and AChRe) ⁄ ) mice during postnatal development Adult patterns of MyHC isoforms are expressed in a species-specific and muscle-specific manner within 3–4 weeks after birth, and fiber type transitions depend on neuronal, mechanical and ⁄ or hormonal signals [14,18] In agreement with a previous report [15], we FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS 2047 AChR and muscle fiber type composition T.-E Jin et al Table The fiber number and CSAs of SOL and EDL muscles from wild-type and AChRe) ⁄ ) mice Fiber type numbers and CSAs of muscle fibers were determined using cross-sections (Fig 5) of SOL and EDL muscles of wild-type (P68–P80) and AChRe) ⁄ ) (P49–P57) mice CSAs (mean ± SEM) of fibers were measured at middle regions of each muscle In each case, seven separate cross-sections were used to determine the CSA of 50–70 fibers Values with P < 0.05 were considered to be statistically significant ATPase staining, pH 4.6 WT, wild-type Fiber type Fiber type 2B ⁄ 2D Fiber type 2A n SOL WT AChRe) ⁄ ) EDL WT AChRe) ⁄ ) Number CSA Number CSA 100 72 322 ± 11 335 ± 13* 1066 ± 90 964 ± 50 476 ± 18 330 ± 12** 909 ± 73 721 ± 52 12 12 6±1 29 ± 3** 286 ± 35 268 ± 14 517 ± 24 284 ± 8** 1225 ± 94 643 ± 26** Number CSA Total number 9±1 51 ± 3** 655 ± 65 568 ± 28 816 ± 30 716 ± 26* 296 ± 15 114 ± 2** 445 ± 25 337 ± 15* 819 ± 39 427 ± 11** *P < 0.05; **P < 0.001 observed constant expression levels of slow and fast fibers in SOL muscle of wild-type mice (C57Bl ⁄ 6) well after P20 The early fiber type transitions occur during a time when AChRc channels are replaced by AChRe channels [6], suggesting that there is a link between AChR conversion and fiber type transition In fact, it has been reported that the c-to-e subunit transition is delayed in slow-twitch muscle as compared to fasttwitch muscles [19] The continuous fast-to-slow specification up to P60 in SOL muscle of AChRe) ⁄ ) mice may thus be due to the lack of AChRe channels and the persistence of AChRc channels More experiments are now required to clarify whether the AChRc to AChRe channel conversion affects early postnatal MyHC isoform transitions Fast-to-slow transition – correlation of muscle fiber type and gene transcript levels in SOL and EDL muscles from wild-type and AChRe) ⁄ ) mice The altered functional property ⁄ density of the endplate AChR stimulates, in SOL and EDL muscles of AChRe) ⁄ ) mice, transitions from fast to slow fiber types, as demonstrated by increased numbers of type fibers The increase in type fibers correlates with an increase in MyHC1 transcript level Changes in MyHC2A and MyHC2B ⁄ 2D transcript levels, however, and changes in protein levels not match Differences in transcript and protein levels have been attributed to translational or post-translational processing events or expression of hybrid fibers in single muscle fibers [20,21] A reliable marker for AChR-mediated fast-to-slow transition is troponin Islow Troponin I is the regulatory component of the troponin complex and probably influences the rate of force generation and relaxation during twitch [22] Troponin Islow and troponin Ifast 2048 levels are regulated by electrical activity in a fiber-typespecific manner [16,23,24] Increased troponin Islow transcripts in muscle of AChRe) ⁄ ) mice suggest that the AChR-mediated signals that cause a fast-to-slow MyHC transition lead to an adaption of troponin Islow Troponin Ifast, however, is not changed in a reciprocal manner, indicating that troponin Islow and troponin Ifast respond independently to distinct fast and slow signaling pathways [24] The analyzed synaptogenic transcripts in SOL and EDL muscles of AChRe) ⁄ ) mice are affected in a coordinated fashion, in that transcripts are moderately elevated or not significantly altered (changes were considered significant only for values ‡ 2-fold or £ 2-fold) A clear increase is observed for AChR a-subunit and for MuSK (in SOL muscle) and rapsyn (in EDL muscle) transcripts As AChR a-subunit as well as MuSK transcripts respond to changes in muscle activity, the increase could be a compensatory reaction to progressing AChR deficiency On the other hand, fast-to-slow transitions induced by electrical stimulation have led to an increase of postsynaptic AChR [25], suggesting that the myogenic and synaptogenic signaling pathways are linked An exception to coordinated regulation is that the e-subunit transcripts appear to be significantly reduced in EDL muscle The increased Utrn transcript levels provide further support for a fast-to-slow transition in SOL and EDL muscles of AChRe) ⁄ ) mice Slow fiber type specification is sensitive to nerve activity-induced intracellular Ca2+ [26], which regulates calcineurin ⁄ NFAT signaling [17,27], and calcineurin ⁄ NFAT signaling regulates the transcript levels of Utrn [28,29] The mRNAs of the transcription factors NFATc1 and NFATc4 are not altered dramatically Similarly, the transcription factors GABPa and GABPb, which have been suggested to contribute to synapse-specific gene expression FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS T.-E Jin et al AChR and muscle fiber type composition A B C D Fig Gene expression of myogenic and synaptogenic genes in SOL and EDL muscles from AChRe) ⁄ ) mice in relation to wild-type mice Transcript expression profiles in SOL and EDL muscles were quantified by real-time PCR The mean values (mean ± SEM) of SOL and EDL muscles from AChRe) ⁄ ) mice were normalized to the values from wild-type SOL and EDL muscles, respectively, and are represented by gray bars Wild-type SOL and EDL muscle transcript levels are 1.0 (± SEM) Values were obtained by analyzing muscle from six different animals Values with P < 0.05 were considered to be statistically significant The specific primers for the selected genes are listed in Table (A, B) Relative expression levels of (A) myogenic and (B) synaptogenic transcripts in SOL muscle from AChRe) ⁄ ) mice are compared to transcript levels in SOL muscle from wild-type mice (C, D) Relative expression levels of (C) myogenic and (D) synaptogenic transcripts in EDL muscle from AChRe) ⁄ ) mice are compared to transcript levels in EDL muscle from wild-type mice Inserts in (A) and (C) indicate changes at the protein level for type 1, type 2A and type 2B ⁄ 2D fibers Increase ⁄ decrease of fiber types in muscle from AChRe) ⁄ ) mice as compared to muscle from wild-type mice is schematically indicated by arrows [30,31], are not significantly different between muscle of wild-type and AChRe) ⁄ ) mice These results, however, not exclude functional roles of these factors in muscle fiber development and fiber type transitions as observed here Differential analysis of SOL and EDL muscles The differential fiber type profile of SOL and EDL muscles highlights similar muscle-specific differences both in wild-type and in AChRe) ⁄ ) mice The differ- ence between EDL and SOL muscles is less pronounced in AChRe) ⁄ ) mice, because of the fast-to-slow shift, which causes a relative increase of type fibers and a decrease of type 2B ⁄ 2D fibers in EDL muscle Corresponding shifts of MyHC1 transcripts in differential SOL ⁄ EDL transcript profiles as well as the increased troponin Islow transcript levels indicate that SOL and EDL muscles adjust to the altered AChR-mediated signaling in a muscle-specific manner The synaptogenic transcripts, on the other hand, display no significant differences between wild-type and AChRe) ⁄ ) SOL and FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS 2049 AChR and muscle fiber type composition T.-E Jin et al Table List of TaqMan assay-on-demand products and our designed primer and probe set for quantitative real-time PCR Assay ID Dye Context sequence Symbol Gene name Mm99999915_g1 FAM TGAACGGATTTGGCCGTATTGGGCG GAPDH Mm00431627_m1 FAM TTCTCTATAACAACGCAGACGGCGA AChRa Mm00437417_m1 FAM TGGAGAACAATGTGGACGGTGTCTT AChRc Mm00437411_m1 FAM ACTGCTGGGCAGGTATCTTATATTC AChRe Custom designed FAM ATCTCACTGAACGAGAAAGAAGAAA AChRe2 Mm00438592_m1 FAM AGGACTTCGGGGTGGTGAAGGAGGA Dvl1 Mm00464475_m1 Mm00448006_m1 FAM FAM GAGTTCAGCACAAATTTCACAGGCT AATGCTCTCAGGGAAAATTCCAGAA Dmd Musk Mm00485539_m1 FAM CTACGCCCAGGTCAAGGACTATGAG Rapsyn Mm00810176_s1 Mm00600555_m1 FAM FAM TCTTTCTAGGAAGGCAACATTCTAG ATTGGTGCCAAGGGCCTGAATGAGG Utrn MyHC1 Mm00454991_m1 FAM CTGAGATCGACAGGAAGCCCGCAAT MyHC2A Mm01332531_g1 FAM GAATGCTGAAGGACACACAGCTGCA MyHC2B Mm01332500_gH FAM ACTTATCAAACTGAGGAAGACCGCA MyHC2D Mm00502426_m1 Mm00437157_g1 Mm00484598_m1 Mm00487471_m1 Mm00479445_m1 FAM FAM FAM FAM FAM GAAAAGGAGCGGCCAGTCGAGGTAG GTCTGAAGTGCAGGAACTCTGCAAA TGCAAGATATTCAGCTGGATCCAGA TTCTTCAGAAACTCCAGTAGTGGCC GCAAGCCAAATTCCCTGGTGGTTGA TnIs TnIf Gabpa Gabpb1 Nfatc1 Mm00452375_m1 FAM GGGTCCTGATGGAAAACTGCAGTGG Nfatc4 Mm00500103_m1 FAM TATGGAGGAGCTGGAAGAGGCCCAT Scn4a Glyceraldehyde-3-phosphate dehydrogenase Cholinergic receptor, nicotinic, alpha polypeptide (muscle) Cholinergic receptor, nicotinic, gamma polypeptide Cholinergic receptor, nicotinic, epsilon polypeptide Cholinergic receptor, nicotinic, epsilon polypeptide Dishevelled, dsh homolog (Drosophila) Dystrophin, muscular dystrophy Muscle, skeletal, receptor tyrosine kinase Receptor-associated protein of the synapse, 43 kDa Utrophin Myosin, heavy polypeptide 7, cardiac muscle, beta Myosin, heavy polypeptide 2, skeletal muscle, adult Myosin, heavy polypeptide 4, skeletal muscle, adult Myosin, heavy polypeptide 1, skeletal muscle, adult Troponin I, skeletal, slow Troponin I, skeletal, fast GA repeat binding protein, alpha GA repeat binding protein, beta Nuclear factor of activated T cells, cytoplasmic, calcineurindependent Nuclear factor of activated T cells, cytoplasmic, calcineurindependent Sodium channel, voltage-gated, type IV, alpha polypeptide EDL muscles Generally, it appears that transcript levels are reduced in EDL muscle, most prominently for AChR c-subunit and MuSK transcripts In a previous study of rat muscle, the majority of cytoskeletal proteins were also found to be reduced in EDL muscle as compared to SOL muscle [32] Comparison of fast and slow muscle shows that MuSK, as a major synaptic regulator [33–35], is expressed at significantly lower levels in EDL muscle than in SOL muscle, and may coordinate differentiation of the postsynaptic apparatus differently in fast and slow muscle Compensatory changes in MuSK expression levels as a consequence of altered AChR function ⁄ density are apparently similar in SOL and EDL muscles The overall conservation of muscle-specific expression patterns of myogenic and 2050 Exon NCBI Ref NM_008084 NM_007389 NM_009604 NM_009603 NM_009603 NM_010091 15 NM_007868 NM_010944 NM_009023 39 NM_011682 NM_080728 33 NM_144961 31 AJ278733 26 AJ293626 3 NM_021467 NM_009405 NM_008065 NM_010249 NM_198429 NM_023699 10 NM_133199 synaptogenic transcripts reveals that AChR-induced changes affect contractile profiles of muscles in a coordinated fashion Muscle fiber type and AChR function Fast-to-slow transitions are induced by enhanced neuromuscular activity, e.g by chronic low-frequency stimulation [1], as well as by prolonged exercise [36], whole body exercise training [37,38] and hyperactivity of rats [39] The mechanisms that cause these adaptive changes in wild-type muscle to increased muscle activity seem unlikely to compensate for progressive muscle weakness in AChRe) ⁄ ) mice On the other hand, denervation, limb immobilization and unloading or FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS T.-E Jin et al AChR and muscle fiber type composition A B C D Fig Gene expression of myogenic and synaptogenic genes in EDL muscle in relation to SOL muscle from wild-type and AChRe) ⁄ ) mice The transcript expression profile was quantified by real-time PCR The mean values (mean ± SEM) of EDL muscle from wild-type and AChRe) ⁄ ) mice were normalized to corresponding values from SOL muscle and are represented by gray bars SOL transcript levels are 1.0 (± SEM) The values were obtained by analyzing muscle from six different animals; values with P < 0.05 were considered to be statistically significant The specific primers for the selected genes are listed in Table (A, B) Relative expression levels of (A) myogenic and (B) synaptogenic transcripts in EDL muscle from wild-type mice (C, D) Relative expression levels of (C) myogenic and (D) synaptogenic transcripts in EDL muscle from AChRe) ⁄ ) mice The values are presented on a logarithmic scale and show the relative upregulation or downregulation spinal cord transection all cause atrophy of slow and fast extensor muscles The characteristic feature is the transformation of muscle fibers from slow to fast [37] Progressive muscle weakness and atrophy are characteristic symptoms of the AChRe) ⁄ ) mice, and thus would be expected to reduce the proportion of slow fibers The overall fast-to-slow transition therefore indicates that altered functional properties of the endplate AChRs mediate signals that dominate and overrule possible denervation ⁄ atrophy-induced changes It is not clear how changes in neuromuscular activity or motor activity regulate transcriptional control mechanisms of MyHC expression Major regulatory signals are attributed to action potentials that are transmitted to the fibers and change intracellular Ca2+ concentrations [40] Embryonic and adult-type AChRs evoke different membrane potentials, which could affect the signal cascades regulating myofiber transformation differently The AChR subtypes have, in addition, different Ca2+ permeabilities, and thus could modulate the subsynaptic Ca2+ levels The challenge now is to determine whether and how the spatially restricted synaptic Ca2+ signals could be transmitted to act more globally to alter myofiber expression In wild-type mice, the functional change of AChRc to AChRe may fine-tune the postnatal expression of fiber type composition, e.g by increasing the inherent motor activity mediated by the higher ion conductance of AChRe In AChRe) ⁄ ) mice, lack of AChRe may delay early postnatal fiber type transitions, and the persistence of AChRc reduces, rather than increases, motor activity At the same time, synaptic Ca2+ levels may FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS 2051 AChR and muscle fiber type composition T.-E Jin et al be increased due to the prolonged channel open times of AChRc Mutated AChR with prolonged channel open times has indeed been shown to increase synaptic Ca2+ levels, which are thought to mediate endplate degeneration and induction of so-called slow channel myasthenic symptoms [41] Another possibility may be that AChR deficiency induces retrograde signals, which stimulate presynaptic compensatory changes Isometric twitch and tetanic contraction forces following direct and indirect stimulation of the muscle, however, favor postsynaptic impairment of signal transduction, and NMJs of AChRe) ⁄ ) mice have so far displayed no significant changes regarding functional and structural properties of the presynaptic nerve terminal [10,11] Thus, our results suggest that changes of the postsynaptic AChR induce a fast-to-slow fiber type transition in muscle Experimental procedures Animals The generation of AChRe) ⁄ ) mice has been described previously [10] Wild-type C57Bl ⁄ mice (2–13 weeks) and AChRe) ⁄ ) mice (2–9 weeks) mice were killed by CO2 inhalation All animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No 85-23, revised 1996) and the European Community guidelines for the use of experimental animals Immunochemistry, histochemical staining, and fiber counts SOL and EDL muscles were dissected from mice and prepared in an embedding medium (Sakura, AT Zoeterwoude, the Netherlands) The muscles were rapidly frozen in liquid nitrogen-cooled isopentane, and placed in a cryostat at )20 °C to cut 10 lm longitudinal sections in the mid-portion of muscles Subsequently, they were mounted on polylysine-coated glass slides The sections on glass slides were washed with NaCl ⁄ Pi for min, and incubated in blocking solution (BS: 0.5% BSA, 2.5% horse serum and 0.01% Triton X-100 in NaCl ⁄ Pi) for 30 Sections were then incubated for h with primary antibody in BS, and were washed three times for each in NaCl ⁄ Pi Sections were incubated for 10 in BS, secondary antibody in BS was applied for h, and sections were washed four times for each in NaCl ⁄ Pi Stained sections were visualized under an Axioplan uorescence microscope (Zeiss, Gotă tingen, Germany) and imaged using a CCD camera (Intas, Gottingen, Germany) Primary antibody MY-32 (Sigma, ă Deisenhofen, Germany) was used to detect type fibers, 2052 and NOQ7.5.4.D (Sigma) was used to detect all type fibers Antibodies to type fibers and type fibers were used at dilutions of : 1000 and : 200, respectively Secondary antibody, Alexa 488-labeled goat anti-(mouse IgG) (Molecular Probes, Leiden, the Netherlands), was used at a dilution of : 500 Cross-sections were stained with hematoxylin ⁄ eosin as previously described [42] Myofibrillar ATPase staining was performed as previously described [43] In brief, sections were incubated in acidic buffer (3.5 mm barbital, 3.5 mm sodium acetate, pH 4.54) or basic buffer (20 mm barbital, 36 mm calcium chloride, pH 10.2) for 10–15 min, and then in ATP staining buffer (3.6 mm ATP, 20 mm barbital, 18 mm CaCl2, pH 9.4) for h Incubation in 1% CaCl2 for 10 was followed by incubation in 2% CoCl2 for 10 and in 2% (NH4)2S for Sections were then dehydrated in 50%, 70%, 80%, 95% and 100% ethanol, and mounted on Eukitt (O Kindler, Freiburg, Germany) Stained sections were visualized under an Axioplan fluorescence microscope and captured with a CCD camera In muscles, where fiber type distribution across the muscle was uneven, muscle fiber type counting was done in whole muscle sections The scale factor was determined by measuring a known distance from a micrometer Captured cross-sectional images close to the middle region of muscles were outlined with graphire3 (Wacom, Krefeld, Germany) In each section, 50–70 fibers were outlined and analyzed with imagej 1.32j software (http://rsb.info.nih.gov/ij/) on a PC to determine mean CSA and SEM RNA isolation, reverse transcription, and real-time PCR RNA was isolated from frozen whole SOL and EDL muscle tissue of wild-type (7–9 weeks old, n = 4) and AChRe) ⁄ ) mice (8–9 weeks old, n = 3) mice as previously described [44] First-strand cDNA was synthesized from lg of total RNA, using reverse transcriptase (Invitrogen, Karlsruhe, Germany) and lL of pd(N)6 random hexamer (Amersham Pharmacia, Freiburg, Germany) Real-time PCR was carried out in duplicate using the ABI PRISM 7000 Sequence Detection System, with TaqMan universal master mix (NoAmpErase), according to the manufacturer’s guidelines (Applied Biosystems, Darmstadt, Germany) The PCR amplification was carried out as follows: an initial activation step at 95 °C for 10 min, and then two-step cycling at 95 °C for 15 s and at 60 °C for 40 s, for a total of 45 cycles A : 10 dilution of cDNA was used in PCR experiments for gene expression profiling The primers and probes were purchased from Applied Biosystems (TaqMan Assays-on-Demand Gene Expression Products) and are listed in Table The probes were labeled with a reporter fluorescent dye, 6-carboxyfluorescein, at their 5¢-ends To avoid amplification of contaminating genomic DNA, custom-designed primers and probes were FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS T.-E Jin et al chosen at exon ⁄ exon borders using primer express 2.0 software (Applied Biosystems) Data analysis was performed with ABI 7000 prism 1.1 software containing the RQ study application CT values were collected and analyzed with automatic baseline and manual threshold options The analyzed CT values with the same threshold in each gene were exported to Microsoft Excel 2002 for expression analysis The CT values of each gene were normalized with the CT values of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene Normalized CT values of genes in transgenic mice were compared with those of the genes of wild-type mice The GAPDH gene was chosen for normalization of the RNA load under the assumption that it is invariant in muscle from wild-type and AChRe) ⁄ ) mice during postnatal development Comparison of transcript levels The mean transcript expression values in EDL muscle from wild-type or AChRe) ⁄ ) mice were normalized using the mean values from SOL muscle to quantitate increased or decreased expression levels in both muscle types (the mean values of SOL muscle transcripts are therefore 1.0) Similarly, when comparing muscle from AChRe) ⁄ ) and wild-type mice, the mean values from wild-type mice were used for normalization To calculate mean expression values, the relative quantification method (2) DDCT method) was used as previously described [45] Data are presented as means ± SEM Difference in mean values was assessed by a one-tailed independent Student’s t-test using Microsoft Excel software Values with P < 0.05 were considered to be statistically significant Acknowledgements This work was supported by the SFB We like to thank Dr Christoph Peter for critical comments on the manuscript AChR and muscle fiber type composition 10 11 12 13 14 15 References Pette D & Staron RS (2001) Transitions of muscle fiber phenotypic profiles Histochem Cell Biol 115, 359–372 Buller AJ, Eccles JC & Eccles RM (1960) Interactions between motoneurones and muscles in respect of the characteristic speeds of their responses J Physiol 150, 417–439 ´ Salmons S & Vrbova G (1969) The influence of activity on some contractile characteristics of mammalian fast and slow muscles J Physiol (Lond) 201, 535–549 Lømo T, Westgaard RH & Dahl HA (1974) Contractile properties of muscle: control by pattern of muscle activity in the rat Proc R Soc Lond B 187, 99–103 Deschenes MR, Tenny KA & Wilson MH (2006) Increased and decreased activity elicits specific morpho- 16 17 18 logical adaptations of the neuromuscular junction Neuroscience 137, 1277–1283 Mishina M, Takai T, Imoto K, Noda M, Takahashi T, Numa S, Methfessel C & Sakmann B (1986) Molecular distinction between fetal and adult forms of muscle acetylcholine receptor Nature 321, 406–411 Witzemann V, Barg B, Criado M, Stein E & Sakmann B (1989) Developmental regulation of five subunit specific mRNAs encoding acetylcholine receptor subtypes in rat muscle FEBS Lett 242, 419–424 Brenner HR & Sakmann B (1978) Gating properties of acetylcholine receptor in newly formed neuromuscular synapses Nature 271, 366–368 Villarroel A & Sakmann B (1996) Calcium permeability increase of endplate channels in rat muscle during postnatal development J Physiol 496, 331–338 Witzemann V, Schwarz H, Koenen M, Berberich C, Villarroel A, Wernig A, Brenner HR & Sakmann B (1996) Acetylcholine receptor e-subunit deletion causes muscle weakness and atrophy in juvenile and adult mice Proc Natl Acad Sci USA 93, 13286–13291 Missias AC, Mudd J, Cunningham JM, Steinbach JH, Merlie JP & Sanes JR (1997) Deficient development and maintenance of postsynaptic specializations in mutant mice lacking an ‘adult’ acetylcholine receptor subunit Development 124, 5075–5086 Engel AG & Franzini-Armstrong C (1994) Myology, 2nd edn McGraw-Hill Inc, New York, NY Weiss A, Schiaffino S & Leinwand LA (1999) Comparative sequence analysis of the complete human sarcomeric myosin heavy chain family: implications for functional diversity J Mol Biol 290, 61–75 Adams GR, McCue SA, Zeng M & Baldwin KM (1999) Time course of myosin heavy chain transitions in neonatal rats: importance of innervation and thyroid state Am J Physiol 276, R954–R961 Allen DL & Leinwand LA (2001) Postnatal myosin heavy chain isoform expression in normal mice and mice null for IIb or IId myosin heavy chains Dev Biol 229, 383–395 Calvo S, Stauffer J, Nakayama M & Buonanno A (1996) Transcriptional control of muscle plasticity: differential regulation of troponin I genes by electrical activity Dev Genet 19, 169–181 Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C, Shelton JM, Wu H, Zhu W, Bassel-Duby R & Williams RS (1998) A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type Genes Dev 12, 2499–2509 d’Albis A, Chanoine C, Janmot C, Mira J-C & Couteaux R (1990) Muscle-specific response to thyroid hormone of myosin isoform transitions during rat postnatal development Eur J Biochem 193, 155– 161 FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS 2053 AChR and muscle fiber type composition T.-E Jin et al 19 Missias AC, Chu GC, Klocke BJ, Sanes JR & Merlie JP (1996) Maturation of the acetylcholine receptor in skeletal muscle: regulation of the AChR c-to-e switch Dev Biol 179, 223–238 20 Denardi C, Ausoni S, Moretti P, Gorza L, Velleca M, Buckingham M & Schiaffino S (1993) Type-2X-myosin heavy chain is coded by a muscle fiber type-specific and developmentally regulated gene J Cell Biol 123, 823–835 21 Sartorius CA, Lu BD, Acakpo-Satchivi L, Jacobsen RP, Byrnes WC & Leinwand LA (1998) Myosin heavy chains IIa and IId are functionally distinct in the mouse J Cell Biol 141, 943–953 22 Squire JM & Morris EP (1998) A new look at thin filament regulation in vertebrate skeletal muscle FASEB J 12, 761–771 23 Calvo S, Venepally P, Cheng J & Buonanno A (1999) Fiber-type-specific transcription of the troponin I slow gene is regulated by multiple elements Mol Cell Biol 19, 515–525 24 Rana ZA, Gundersen K, Buonanno A & Vullhorst D (2005) Imaging transcription in vivo: distinct regulatory effects of fast and slow activity patterns on promoter elements from vertebrate troponon I isoform genes J Physiol 562.3, 815–828 25 O¢Reilly C, Pette D & Ohlendieck K (2003) Increased expression of the nicotinic acetylcholine receptor in stimulated muscle Biochem Biophys Res Commun 300, 585–591 26 Dunn SE, Simard AR, Bassel-Duby R, Williams RS & Michel RN (2001) Nerve activity-dependent modulation of calcineurin signaling in adult fast and slow skeletal muscle fibers J Biol Chem 276, 45243–45254 27 Rusnak F & Mertz P (2000) Calcineurin: form and function Physiol Rev 80, 1483–1521 28 Chakkalakal JV, Stocksley MA, Harrison MA, Angus LM, Deschenes-Furry J, St-Pierre S, Megeney LA, Chin ER, Michel RN & Jasmin BJ (2003) Expression of utrophin A mRNA correlates with the oxidative capacity of skeletal muscle fiber types and is regulated by calcineurin ⁄ NFAT signaling Proc Natl Acad Sci USA 100, 7791–7796 29 Chakkalakal JV, Harrison MA, Carbonetto S, Chin E, Michel RN & Jasmin BJ (2004) Stimulation of calcineurin signaling attenuates the dystrophic pathology in mdx mice Hum Mol Genet 13, 379–388 30 Bessereau JL, Stratford-Perricaudet LD, Piette J, Le Poupon C & Changeux JP (1994) In vivo and in vitro analysis of electrical activity-dependent expression of muscle acetylcholine receptor genes using adenovirus Proc Natl Acad Sci USA 91, 1304–1308 31 Schaeffer L, Duclert N, Huchet-Dymanus M & Changeux JP (1998) Implication of a multisubunit Etsrelated transcription factor in synaptic expression of the nicotinic acetylcholine receptor EMBO J 17, 3078– 3090 2054 32 Chopard A, Pons F & Marini JF (2001) Cytoskeletal protein contents before and after hindlimb suspension in a fast and slow rat skeletal muscle Am J Physiol Regul Integr Comp Physiol 280, R323–R330 33 Yang X, Arber S, William C, Li L, Tanabe Y, Jessell TM, Birchmeier C & Burden SJ (2001) Patterning of muscle acetylcholine receptor gene expression in the absence of motor innervation Neuron 30, 399–410 34 Lin W, Burgess RW, Dominguez B, Pfaff SL, Sanes JR & Lee KF (2001) Distinct roles of nerve and muscle in postsynaptic differentiation of the neuromuscular synapse Nature 6832, 1057–1064 35 Hesser BA, Henschel O & Witzemann V (2006) Synapse disassembly and formation of new synapses in postnatal muscle upon conditional inactivation of MuSK Mol Cell Neurosci 31, 470–480 36 Wernig A, Irintchev A & Weisshaupt P (1990) Muscle injury, cross-sectional area and fibre type distribution in mouse soleus after intermittent wheel-running J Physiol 428, 639–652 37 Baldwin KM & Haddad F (2001) Effects of different activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle J Appl Physiol 90, 345–357 38 Demirel HA, Powers SK, Naito H, Hughes M & Coombes JS (1999) Exercise-induced alterations in skeletal muscle myosin heavy chain phenotype: dose–response relationship J Appl Physiol 86, 1002– 1008 39 Asmussen G, Schmalbruch I, Soukup T & Pette D (2003) Contractile properties, fiber types, and myosin isoforms in fast and slow muscles of hyperactive Japanese waltzing mice Exp Neurol 184, 758–766 40 Bassel-Duby R & Olson EN (2006) Signaling pathways in skeletal muscle remodeling Annu Rev Biochem 75, 19–37 41 Gomez CM, Maselli RA, Groshong J, Zayas R, Wollmann RL, Cens T & Charnet P (2002) Active calcium accumulation underlies severe weakness in a panel of mice with slow-channel syndrome J Neurosci 22, 6447–6457 42 Sheehan DC & Hrapchak BB (1987) Theory and Practice of Histotechnology, 2nd edn Battelle Memorial Institute, Columbus, GA 43 Brooke MH & Kaiser KK (1970) Three ‘myosin ATPase’ systems: the nature of their pH lability and sulfhydryl dependence J Histochem Cytochem 18, 670–672 44 Chomczynski P & Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanatephenol-chloroform extraction Anal Biochem 162, 156– 169 45 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method Methods 25, 402–408 FEBS Journal 275 (2008) 2042–2054 ª 2008 The Authors Journal compilation ª 2008 FEBS ... Type 2B ⁄ 2D muscle fiber Scale bar in (D) is 100 lm (A) ATPase staining at pH 4.6 identifies type fibers (dark stain), type 2A fibers (light stain), and type 2B ⁄ 2D fibers (intermediate stain) (B) ATPase... Developmentally regulated changes in fiber type composition in percent of total fibers (type fibers, white bars; type 2A fibers, gray bars; type 2B ⁄ 2D fibers, black bars) Original values are given in the table... were subjected to ATPase staining, pH 4.6 (i) Type fiber (a) Type 2A fiber (b) Type 2B ⁄ 2D fiber Scale bar in (D) is 100 lm (E) Fiber type composition in SOL muscle of wild -type mice (white columns;