Tài liệu Báo cáo khoa học: Antioxidant protein 2 prevents methemoglobin formation in erythrocyte hemolysates doc

Antioxidant protein 2 prevents methemoglobin formation in erythrocyte hemolysates Karl M. Stuhlmeier 1 , Janet J. Kao 2 , Pia Wallbrandt 3 , Maria Lindberg 3 , Barbro Hammarstro¨m 3 , Hans Broell 1 and Beverly Paigen 4 1 Ludwig Boltzmann Institute for Rheumatology and Balneology, Vienna, Austria; 2 Maimonides Medical Center, Brooklyn, NY, USA; 3 Department of Molecular Biology, AstraZeneca, Umea ˚ , Sweden; and 4 The Jackson Laboratory, Bar Harbor, ME, USA Antioxidant protein 2 (AOP2) is a member of a family of thiol-specific antioxidants, recently renamed peroxiredoxins, that evolved as part of an elaborate system to counteract and control detrimental effects of oxygen radicals. AOP2 is found in endothelial cells, erythrocytes, monocytes, T and B cells, but not in granulocytes. AOP2 was found solely in the cytoplasm and was not associated with the nuclear or membrane fractions; neither was it detectable in plasma. Further experiments focused on the function of AOP2 in erythrocytes where it is closely associated with the hemo- globin complex, particularly with the heme. An investigation of the mechanism of this interaction demonstrated that the conserved cysteine-47 in AOP2 seems to play a role in AOP2-heme interactions. Recombinant AOP2 prevented induced as well as noninduced methemoglobin formation in erythrocyte hemolysates, indicating its antioxidant proper- ties. We conclude that AOP2 is part of a sophisticated system developed to protect and support erythrocytes in their many physiological functions. Keywords: hemoglobin; erythrocytes; reactive oxygen species; antioxidant protein 2. Evolving antioxidant defence systems to protect against O 2 toxicity has been a prerequisite for an organism’s use of O 2 for efficient energy production. To benefit from O 2 as an energy source, multicellular organisms had to develop a system to distribute O 2 . In mammals this function is carried out by red blood cells (RBC), which utilize hemoglobin to distribute O 2 to cells. Not only are RBC highly specialized O 2 and CO 2 carriers, they also serve an additional important function, namely acting as a sink for reactive oxygen species (ROS) [1]. Erythrocytes can take up O 2 -radicals as well as H 2 O 2 in plasma to protect the organism from damage by such compounds [2–4]. These tasks make erythrocytes especially vulnerable to damage by ROS. Furthermore, carrying high concentrations of O 2 andhighlevelsof potentially pro-oxidant heme protein inside a membrane rich in polyunsaturated fatty acid side chains cause additional problems. RBCs are therefore exposed to a constant flow of hemoglobin auto-oxidation, as approxi- mately 3% of the hemoglobin undergoes oxidation to methemoglobin (metHb) every day. Moreover RBC are also exposed to repeated physical stress through deforma- tion. More importantly, RBC have low metabolic activities with no ability to synthesize new proteins or lipids to replace damaged molecules [1]. Due to these properties, RBC need to be equipped with a series of enzymes that can protect cells from damage by free radicals; such enzymes include Cu-Zn- superoxide dismutase, catalase, glutathione peroxidase, metHb reductase, and glucose 6-phosphate dehydrogenase. Recently, a new type of antioxidant protein has been reported to be present in RBC [5,6], the thiol-specific antioxidant proteins, which are members of a large family of more than 40 proteins found in prokaryotes as well as eukaryotes [7–10]. The peroxiredoxin proteins show no significant homology with previously identified antioxidant proteins. The nomenclature of these proteins is still confu- sing, as these molecules were originally described under several names e.g. rehydrins, thioredoxin-dependent per- oxide reductases, but this family has been renamed as peroxiredoxins [11,12]. Peroxiredoxins are grouped into 1-Cys proteins with a conserved cysteine at amino acid position 47 and 2-Cys proteins with a second conserved amino acid at position 170 (relative to yeast peroxiredoxin). They usually exist as homodimers. The substrates are alkyl hydroperoxides [9], peroxynitrates [13] and hydrogen per- oxides [14], and they detoxify these substrates by oxidation of the Cys at amino acid 47 [9,15]. These proteins enzymatically detoxify hydroxyradicals using reducing equivalents from thiol-containing molecules such as thio- redoxins and glutathione. As a major function of these proteins is to regulate ROS levels, they not only protect Correspondence to K. M. Stuhlmeier, Ludwig Boltzmann Institute for Rheumatology and Balneology, Kurbadstrasse 10, PO Box 78, A-1107 Vienna, Austria. Fax: + 43 1 68009 9234, Tel.: + 43 1 68009 9237, E-mail: karlms@excite.com Abbreviations: AOP2, antioxidant protein 2; metHb, methemoglobin; MNCs, mononuclear cells; PMNs, polymorphonuclear cells; RBC, red blood cells; ROS, reactive oxygen species. Note: The nomenclature of antioxidant protein 2 is currently under- going reconsideration. This protein is currently named antioxidant protein 2 in humans and peroxiredoxin 5 in mice. However, peroxi- redoxin 5 in humans refers to a different protein (named peroxiredoxin 6 in mouse). As the same protein is supposed to have the same name in different species, we will use the old name of antioxidant protein 2 until this nomenclature issue is resolved by the human and mouse nomenclature committees. (Received 11 June 2002, revised 13 October 2002, accepted 26 November 2002) Eur. J. Biochem. 270, 334–341 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03393.x macromolecules from oxidation, but also may be involved in signal transduction as well because ROS are implicated in physiological signaling [16,17]. We investigated the distribution and function of AOP2, which is a 1-Cys member of the peroxiredoxin protein family. Its presence has been described for mouse, pig and human cells. Murine AOP2 was first isolated from the liver and kidney as a cDNA corresponding to a protein variant that differs between the C57BL/6J and DBA/2J strains of mice [18]. Subsequently, the genomic structure of AOP2 in mice was determined [19] and the crystal structure of the human protein determined [20]. An analysis of the EST database suggested that AOP2 may be ubiquitously expressed [21]. The encoded protein is 224 amino acids in length with a predicted size of 25 kDa. However, the protein detected in cells of mouse, human, rat and pig origin, as well as the recombinant form of AOP2, migrates in PAGE as a protein of approximately 32 kDa. To date, the protein expression pattern of the native AOP2 has been reported only for rat, which demonstrated AOP2 exclusively in the lung [22]. However, we screened organs and different cell types in mice with an antibody raised against a unique peptide from the AOP2 protein and found high levels of this protein in essentially all organs (unpublished results). Endothelial cells, erythrocytes and white blood cells are targets as well as sources of many forms of ROS [1]. We therefore investigated the distribution and function of this novel antioxidant protein in these cells. Herein we report our findings on AOP2 distribution and its protective effects in RBC, as well as the mechanism of interactions. Experimental procedures Materials Pyrrolidine dithiocarbamate, cysteine, serine, alanine, cross- linked hemoglobin, hemin, pig serum, Igepal CA-630, and globin were obtained from Sigma (St. Louis, MO) or Sigma (Vienna, Austria). L -Glutamine was obtained from PAA Labor- und ForschungsgesmbH. (Vienna, Austria), penicil- lin, streptomycin, cell culture medium and fetal bovine serum from Gibco BRL, Life Technologies (Vienna, Austria). Tumor necrosis factor alpha was obtained from R & D Research (Minneapolis, MN). Generation of AOP2 antibodies One synthetic peptide (FPKGVFTKELPSGKKYLRYC) corresponding to amino acids 202–220 of murine AOP2 was generated. The peptide sequence was chosen based on an antigenicity calculation (Jamesson–Wolf, based on hydro- philicity, surface probability, flexibility and secondary structure predictions) and had been shown by Kang et al. [23], to be an antigen determinant. An additional amino acid, cysteine, was added to the C-terminal end of the synthetic peptide to obtain specific coupling of the peptide to BSA and affinity gel matrices. Rabbits were immunized with BSA-conjugated peptides and repeatedly injected to increase the antibody response. The IgG antibody fraction was purified from the antisera obtained after IV immuni- zations using Protein G Sepharose 4 Fast Flow (Pharmacia LKB Biotechnology, Uppsala, Sweden). Polyclonal AOP2 antibodies were further purified on Sulfolink (Pierce, Rockford, IL, USA) affinity columns to which the synthetic peptides had been coupled by their cysteine residues. Affinity-purified antibodies were characterized by ELISA and Western blot analysis. In immunoblotting, the AOP2 antibody recognized a polypeptide with a relative molecular mass of approximately 32 kDa in human and mouse liver homogenates. N-terminal amino acid sequencing identified the 32 kDa polypeptide as AOP2. In addition, the AOP2 antibody recognized recombinant AOP2D124A and the recombinant protein encoded by the Aop2-related sequence 1 (data not shown). Recombinant AOP2 Production and purification of recombinant AOP2 in Escherichia coli were performed mainly as described [23]. Full-length Aop2 cDNA was amplified by the polymerase chain reaction (PCR) and subsequently used for cloning. PCR was performed with forward primer (5¢-CGGCA TATGCCCGGAGGGTTGCTTCTC-3¢), which contains nucleotides 1–21 of the mouse Aop2 sequence, the initiation codon and a NdeI cleavage site, and reverse primer (5¢- CGCGAATTCTTATTAAGGCTGGGGTGTATAACG G-3¢), which contains nucleotides 653–671 of the mouse Aop2 sequence, two stop codons and an EcoRI cleavage site. The resulting PCR products were cloned into pGEM- T. An NdeI–EcoRI fragment from pGEM-T, containing the cDNA encoding AOP2, was subcloned into pET-17b generating pETAop2D123A. The nucleotide sequence of pETAop2D124A was verified by DNA sequencing. E. coli cells (BL21(DE3)pLysS) were transformed with pETAop2D124A. Cells were grown overnight in a small volume of liquid broth supplemented with carbencillin and chloramphenicol and thereafter transferred to new medium. Production of recombinant protein was induced by addition of isopropyl-b- D -thiogalactopyranoside. Cells were harvested, disrupted and recombinant protein was purified from the soluble fraction as described [23]. The purification method includes streptomycin sulfate precipi- tation, ammonium sulfate precipitation, hydrophobic chromatography and anion exchange chromatography. The sample was applied to a Q-Sepharose column (Pharmacia LKB Biotechnology, Uppsala, Sweden), equil- ibrated with 20 m M Tris/HCl (pH 8.0), 2 m M dithio- threitol and 1 m M EDTA. At this pH recombinant AOP2 was bound to the column matrix. Thereafter, bound material was eluted with a linear gradient of 0–0.5 M NaCl in 20 m M Tris/HCl (pH 8.0), 2 m M dithiothreitol and 1 m M EDTA. During purification recombinant AOP2 was detected by immunoblot analysis using specific polyclonal antibodies. The purified protein was more than 95% pure and the yield was  50%. The N-terminal amino acid sequence, purity and accurate molecular mass of recombinant AOP2 were verified by N-terminal amino acid sequencing and electro- spray mass spectroscopy (data not shown). Preparation of cell lysate Blood from human or mouse was diluted in phosphate buffered saline (NaCl/P i ), and RBC separated from white Ó FEBS 2003 Distribution and function of antioxidant protein 2 (Eur. J. Biochem. 270) 335 blood cells by density gradient centrifugation on a 67% (w/v) Percoll (Amersham Pharmacia Biotech, Uppsala, Sweden) gradient. RBC were washed three times with NaCl/P i ,and then hemolyzed with three volumes of distilled water for 15 s. Afterwards, 10 · NaCl/P i wasusedtoadjustthe salinity and pH to physiological conditions. Hemolysate was used for metHb measurements, Western blots and pre- cipitation studies following centrifugation at 20 800 g for 15 min at 4 °C. RBC membrane extract was prepared as follows: ghosts (pellets after hemolysis) were washed three times with NaCl/P i , afterwards, membranes were dissolved in lysis buffer containing 0.32 M sucrose, 3 m M CaCl 2 , 2m M magnesium acetate, 0.1 m M dithiothreitol, 0.5 m M phenylmethylsulfonyl fluoride, and 0.5% Igepal CA-630. In some cases, RBC were lysed directly in such a buffer and the resulting protein solution used for Western blot experi- ments. Endothelial cell cytoplasm and nuclear extract were prepared as described [24]. Polymorphonuclear cells were separated from mononuclear cells on a density gradient (67 and 55% Percoll, respectively), washed three times and cell extracts prepared as described above. B and T cell extracts were obtained from whole cell lysates of human lymphoma cells, BJAB (Santa Cruz Biotechnology, Santa Cruz, CA) and mouse T cell lymphoma cells, CTLL-2 (Santa Cruz Biotechnology, Santa Cruz, CA). Cell culture Porcine aortic endothelial cells were isolated and cultured as previously described [24]. Briefly, endothelial cells were cultured in Dulbecco’s modified Eagle’s medium with 4.5 gÆL )1 glucose and supplemented with 10% heat inacti- vated fetal bovine serum, L -glutamine and 50 unitsÆmL )1 penicillin/streptomycin. Methemoglobin measurement Hemolysate was placed in disposable cuvettes (polymethyl methacrylate, 2.5 mL capacity) with a light path of 1 cm. Lysate and indicated amounts of reagents were incubated at room temperature without shaking. The metHb formed was measured at time intervals ranging from 0–200 h. A spectrophotometer (Spectronic Genesys 5, Milton Roy, Rochester, NY) was used in survey scan mode to measure absorbance between 400 and 700 nm. Immunoprecipitation Cross-linked hemoglobin, hemin and globin were obtained from Sigma (Vienna, Austria). Aliquots of beads were washed three times in NaCl/P i . Red blood cell lysate, antibodies to AOP2, recombinant AOP2 protein, bovine serum albumin, or a combination of the above were incubated at 4 °C on a rotating device. We used either protein A/G PLUS-Agarose (Santa Cruz Biotechnology, Santa Cruz, CA) or hemoglobin (bovine) cross-linked with cyanogen bromide to beaded agarose for these precipitation studies. To ensure high specificity of protein–protein interactions, after 1 h beads were collected by centrifugation and washed six times in high stringency buffer (0.1% Tween 20, 0.1% SDS, 1% Igepal CA-630, in NaCl/P i ). After the last wash solution was aspirated, 25 lLSDS sample buffer was added, heated to 95 °C for 5 min, and immunoprecipitates collected for SDS/PAGE. Western blot analysis Cytosolic and nuclear extracts from endothelial cells, mononuclear cells (MNCs) and polymorphonuclear cells (PMNs) were prepared as described [25]. Equal amounts of protein (immunoprecipitates, nuclear and/or cytoplasm extract) were separated by SDS/PAGE (10 or 12%), transferred to an Immobilon-P poly(vinylidene difluoride) (PVDF) membrane using a semidry transfer cell (Bio-Rad Laboratories, Hercules, CA), and probed with a rabbit polyclonal antibody no. 5 against AOP2. Bands were visualized using horseradish peroxidase, conjugated donkey antirabbit IgG, and the Enhanced ChemiLuminescence assay (Amersham Life Science Inc., Arlington Heights, IL) according to the manufacturer’s instructions. Results Expression of AOP2 Using Western blots, we determined the expression of AOP2 in various cell types. High levels of AOP2 occurred in the cytoplasm of aortic endothelial cells but not in the nuclear extract (Fig. 1A). Furthermore, stimulating endo- thelial cells (50 l M of pyrolidine dithiocarbamate or 5ngÆmL )1 of tumor necrosis factor) for 10 min, 2, 8 or Fig. 1. Expression of AOP2 in various tissues. Arrow indicates AOP2. (A) Western blots demonstrated that AOP2 was expressed in RBC and MNCs but not in PMNs. Furthermore, in endothelial cells (EC), AOP2 is found in the cytoplasm (EC Cyto) but not in the nucleus (EC Nuc). AOP2 was expressed similarly in mouse cells (data not shown). (B) Whole cell lysate of resting B and T cells were separated by SDS/PAGE and stained with a specific anti-AOP2 Ig as described in experimental procedures section. (C) RBC from two mice (A and B) were lysed and separated into membrane and cytoplasm (stroma) fractions. Equal amounts of protein were separated by SDS/PAGE. Membranes were exposed to films for times ranging from 30 s to 15 min. The ÔMembraneÕ blot was exposed approximately 10 times longer than was the ÔStromaÕ blot. 336 K. M. Stuhlmeier et al.(Eur. J. Biochem. 270) Ó FEBS 2003 24 h did not lead to changes in AOP2 levels (data not shown). Next, we tested whether polymorphonuclear cells (PMNs), mononuclear cells (MNCs), or erythrocytes express AOP2. Human and mouse blood was collected, and cells separated immediately on a Percoll gradient. AOP2wasdetectedinRBCandMNCs,butnotinPMNs (Fig.1B).EvengelsloadedwithmaximalamountsofPMN whole cell extract (50 lgproteinÆlane )1 ) and deliberately overexposed exhibited only a weak band of AOP2 (data not shown), which may have resulted from RBCs contamin- ating the PMN fraction. A representative Western blot (Fig. 1B) indicates that both B cells (human BJAB cells) and T cells (mouse lymphocyte cell line CTLL-2) contained equal amounts of AOP2 and showed no difference in its molecular size. Similarly, AOP2 of RBC from mouse and human origin had identical staining patterns (data not shown). AOP2 is located in the cytoplasm of RBC but is not membrane bound (Fig. 1C). We collected blood of A/J and C57BL/6 strains, separated the plasma from the solid components, fractioned the RBCs, and electrophoresed the membrane and cytoplasm portions on a 12% gel. The gels were immunostained, and blots were exposed to films for 30 s to an hour. Even when exposed for an hour, blots revealed that AOP2 was present only in RBC cytoplasm (Fig. 1C). AOP2 was not present in mouse, pig, or human plasma. By using SDS/PAGE (5 lL plasma per lane) and over- exposing Western blots so that concentrations of recom- binant AOP2 smaller than 4 ng per lane could easily be detected (Fig. 2), we determined that AOP2 was absent from porcine, murine, and human plasma (data not shown). To gain insight into how AOP2 interacts with itself or other proteins, RBC stroma proteins were examined using native PAGE. Under native conditions, AOP2 migrates as a molecule of approximately 130 kDa in contrast to the 32 kDa observed under reducing conditions (Fig. 3A). Because adding either reducing SDS or native, nonreducing sample buffer precipitated hemoglobin, we vortexed the sample before loading the gel to ensure uniform protein distribution. We used this precipitation of hemoglobin to study AOP2–hemoglobin interactions. When RBC stoma protein was incubated in nonreducing native sample buffer, and supernatant and hemoglobin pellets collected separately, electrophoresis on a native gel showed no AOP2 in the supernatant. This fact suggested that AOP2 coprecipitates with the hemoglobin fraction. Hemoglobin in its native state forms a 64-kDa tetramer consisting of four 16 kDa subunits; this hemoglobin complex is visible on the blots as white areas (Fig. 3A), because the large quantities of hemoglobin blocked nonspecific binding of antibodies during the immunostaining procedure. AOP2 binds to hemoglobin As AOP2 coprecipitated with hemoglobin, we tested whether AOP2 actually binds to the hemoglobin complex. Hemoglobin cross-linked to agarose beads were prepared and used as described; special care was taken to remove unbound proteins through extensive washing steps under high stringency conditions. As AOP2 could be detected in liver, heart, testis, and brain (data not shown), we used whole cell extracts of RBC, liver and heart as well as recombinant AOP2 for these experiments. Recombinant AOP2, as well as AOP2 isolated from liver and heart cells, binds to hemoglobin. Interestingly, when red blood cell extract, which contains high levels of AOP2 (as shown in Fig. 1), were used, no AOP2 bound to hemoglobin cross- linked to beads. The controls, which have NaCl/P i ,dem- onstrate that purchased hemagarose beads are free of AOP2 protein. Furthermore, AOP2 binding to hemagarose beads is specific, as it could not be blocked by addition of bovine serum albumin. Next, RBC, heart and liver cell extracts were incubated on a rolling platform for 1 h at 4 °C together with the anti- AOP2 IgG and protein A/G cross-linked to agarose beads. As expected AOP2 was immunoprecipitated from the cell extracts (Fig. 4B). Interestingly, large amounts of hemo- globin coprecipitated with the AOP2 from RBC extracts Fig. 2. Demonstration of sensitivity and linearity of the Western blot system used. AOP2 could be detected at 4 ng. Recombinant AOP2 was separated by SDS/PAGE under reducing conditions at increasing ng quantities. At 400 and 1000 ng, the formation of dimers can be observed where the amount of AOP2 added exceeds the reducing capacity of 2-mercaptoethanol. Fig. 3. AOP2 binds to and coprecipitates with hemoglobin. (A). Under nonreducing conditions, AOP2 migrates as a molecule complex of approximately 130 kDa. Hemoglobin (Hb) tetramers can be observed at 64 kDa as a light unstained band. These samples were RBC lysates separated on a 10% PAGE gel. (B). Under native conditions, AOP2 precipitated with hemoglobin. This Western blot was prepared after RBClysateinnativesamplebufferwaswarmedtoprecipitatehemo- globin. After centrifuging the lysate and the precipitated hemoglobin, 10 and 20 lL aliquots of supernatant and the washed and resuspended hemoglobin pellet were electrophoresed by native-PAGE on a 10% gel. Ó FEBS 2003 Distribution and function of antioxidant protein 2 (Eur. J. Biochem. 270) 337 (Fig. 4B), supporting the hypothesis that AOP2 binds tightly to hemoglobin complexes. Hemoglobin is visible as the unstained (lighter) areas in Western blots and as reddish-colored dots on PVDF membranes following protein transfer. Hemoglobin monomers (16 kDa), dimers (32 kDa) and tetramers (64 kDa) are readily recognizable on the blots because the large amounts of hemoglobin could not be reduced completely by the 2-mercaptoethanol present in sample buffer. These experiments indicated that AOP2 is tightly bound to the hemoglobin complex. The failure to precipitate any AOP2 with hemagarose (Fig. 4A) may indicate that all AOP2 in RBC is tightly bound to hemoglobin so that no free AOP2 protein is available to react with added hemagarose. To determine if AOP2 binds to the globin or the heme portion of hemoglobin, we incubated hemin, globulin and hemoglobin cross-linked to agarose beads with red blood cell lysate for 1 h at 4 °C. Beads were collected by centrifugation and extensively washed with high stringency buffer. Western blots revealed that AOP2 in red blood cell lysate bound only to hemin but not to globin (Fig. 4C). It is somewhat puzzling that AOP2 in red blood cell lysate bound to heme alone, but not to heme in hemoglobin. This might result if AOP2 has a higher affinity for isolated heme so that heme on agarose beads can successfully compete for AOP2 already bound to the endogenous hemoglobin in RBC lysate. Cysteine 47 is essential for AOP2-heme binding The binding of AOP2 and heme led us to investigate the mechanism by which AOP2 binds to heme. All peroxire- doxin proteins have a conserved cysteine residue corres- ponding to Cys47 in yeast peroxiredoxin [26]. To determine if the sulfur group of this cysteine bound to the iron in heme, heme cross-linked to agarose beads were preincubated for 30 min at 4 °Cwith25m M cysteine, 25 m M alanine, 25 m M serine, or NaCl/P i (as control). Subsequently, equal amounts of recombinant AOP2 were added and the mixture incubated for an additional hour at 4 °Conarotary platform. The supernatants were aspirated after a final wash and the pellets resuspended in 40 lL of reducing sample buffer. Aliquots of 20 lL were loaded per lane and separated by PAGE. Quantitation of the immunoblot reveals that hemagarose beads preincubated with cysteine inhibited the subsequent binding of AOP2 by 86%, while preincubation with alanine or serine had no effect (Fig. 5), indicating that AOP2 does bind to heme by its conserved cysteine. AOP2 prevents induced and spontaneous methemoglobin formation ROS oxidize hemoglobin to methemoglobin (metHb), which is unable to deliver oxygen to tissues. MetHb can form either spontaneously or be induced to form by many substances, including ascorbic acid at high doses [1,27]. To determine if the tight binding of AOP2 to hemoglobin could prevent MetHb from forming spontaneously, we compared the amount of MetHb in fresh hemoglobin to that formed after 72 h in three solutions: untreated hemoglobin, hemo- globin treated with 4 lgÆmL )1 AOP2, and hemoglobin treated with 5 m M ascorbic acid. After comparing the absorbance of these three solutions to that of MetHb (characteristic peak at 620–640 nm) [28] and unoxidized fresh Hb (576 nm), we concluded that treatment with AOP2 preventedtheoxidationofHbtometHb(Fig.6). We then determined whether AOP2 could prevent ascorbic acid-induced metHb from forming and whether such an effect would be dose-dependent. We prepared two samples of fresh hemoglobin combined with 5 m M ascorbic acid and containing either 2 lgor7lg of recombinant AOP2 per ml. MetHb formation was measured in these two samples after they had incubated for 48 and 120 h at 25 °C. MetHb was calculated as a ratio of absorbance at 575 and 626 nm according to published methods [28], with the slight modification of using the second peak of the hemoglobin spectrum instead the first at around 546 nm. As Table 1 shows, AOP2 did indeed prevent ascorbic acid-induced metHb from forming, and it did so in a dose-dependent manner. Fig. 4. AOP2 binds to hemoglobin. (A) Recombinant AOP2, and cytoplasm extracts from heart, liver, and RBC were incubated with hemoglobin bound to agarose beads. High stringency washing con- ditions were used to remove unbound proteins. Aliquots of beads were added to reducing SDS sample buffer, and the solutions loaded on a 10% gel. Recombinant AOP2, as well as AOP2 in heart and liver cells bound to hemoglobin, while the AOP2 present in RBC did not. BSA was added to some samples to block nonspecific binding sites on hemoglobinagarosebeads.(B)Lysatesofliver,heart,orRBCwere incubated with anti-AOP2 Ig and protein A/G cross linked to agarose beads. The anti-AOP2 Ig not only precipitates AOP2 in red blood cell lysate but also pulls down hemoglobin (indicated as lighter area in the Western blot) bound to AOP2. This is a further indicator of the tight interactions of AOP2 and hemoglobin in RBC. (C) Red blood cell lysate was incubated for 1 h at 4 °C on a rotating platform with agarose beads cross linked to hemin, globin, or hemoglobin. AOP2 bound to the heme molecule but not to globin or hemoglobin. Fig. 5. Cysteine is essential for AOP2 heme binding. Hemin, cross- linked to agarose beads, was used to study the involvement of cysteine in AOP2–heme interactions. AOP2 was incubated for 1 h at 4 °Cwith hemin-beads preincubated with NaCl/P i or (25 m M ) cysteine, serine or alanine for 30 min at 4 °C. Unbound AOP2 was removed by exces- sive washing. Cysteine blocks the binding of AOP2 to hemin while serine and alanine had no effect. 338 K. M. Stuhlmeier et al.(Eur. J. Biochem. 270) Ó FEBS 2003 Discussion We report on the distribution and function of AOP2 in the four cell types tested: granulocytes, lymphocytes, endothelial cells, and RBCs. All these cells are either exposed to or can release ROS and would therefore appear to benefit from mechanisms to protect themselves from ROS. RBCs are especially vulnerable because they have a high iron content, are exposed to high oxygen pressure [29], and cannot repair proteins or other molecules damaged by ROS. We demonstrated that AOP2 is a cytoplasmic protein widely present in lympho- cytes, endothelial cells, and RBC, but not in granulocytes. It was not present in plasma or in RBC membranes or nucleus. Aop2 belongs to a multigene family, the members of which each have multiple bands detectable by Southern blot [21,30,31]. It is unknown if these proteins function similarly in different cell types. Our data indicate that AOP2, in a dose-dependent manner, significantly protects RBCs from ROS by binding to hemoglobin, thus preventing both its induced and spontaneous oxidation to metHb. Another member of the peroxiredoxin protein family, the 25-kDa protector protein [32], has also been shown to suppress metHb formation and membrane lipid peroxidation. The alignment of the peroxiredoxin family members reveals that many of them have two highly conserved cysteine residues corresponding to the Cys47 and Cys170 in yeast peroxiredoxin. The N-terminal cysteine is con- served in all family members and the C-terminal is conserved in all except six members. AOP2 is among the family members with only one conserved cysteine. The eight other amino acids in the cysteine region of mamma- lian peroxiredoxin are 100% conserved, indicating an essential role in peroxiredoxin function. Furthermore, there is an additional motif of six conserved amino acids out of 11, as well as a region with six out of 15 conserved amino acids [21]. Both Cys47 and Cys170 were shown to be necessary to maintain peroxiredoxin polymers, but only the Cys47 region seems to be essential for antioxidant activity [33]. Because cysteine is often present to help bind heme groups to substrates, we investigated whether it was essential for binding the heme iron to AOP2. We found that heme preincubated with cysteine did not bind to AOP2, whereas heme preincubated with several other unrelated amino acids freely bound to AOP2. This result contrasted somewhat to those of others showing that yeast peroxiredoxin with mutant Cys47 cannot prevent the inactivation of glutamine synthetase induced by dithio- threitol/Fe 3+ /O 2 , indicating that Cys47 has an antioxidant rather than a binding function [33]. Nevertheless, the same study found that Cys47 is essential to maintain peroxire- doxin dimers, indicating that it does have a binding function. This was supported by our findings that recom- binant AOP2, not disassociated by a reducing agent, separated into large complexes of dimers and tetramers (data not shown). Because cysteine is almost always present to help bind heme groups to substrates, we investigated whether it was essential for binding the heme iron to AOP2. Through immunoprecipitation studies, we found that heme preincubated with cysteine did not bind to AOP2, whereas heme preincubated with several other unrelated amino acids freely bound to AOP2. Another member of the peroxiredoxin family also uses cysteine for binding to heme [34]. We addressed the functional importance of AOP2 in erythrocytes and found that, as can the well-known superoxide dismutase and catalase antioxidants, it was able to prevent hemoglobin oxidation (both induced and spontaneous). Hemoglobin is oxidized only at its iron atoms, which are sheltered in its hydrophobic pocket. Our Table 1. AOP2 prevents spontaneous as well as induced methemoglobin formation. The indicated reagents were added to aliquots of a freshly prepared hemoglobin solution. After 48 and 120 hours respectively at 25 °C, absorbency readings were recorded and the 570/626 nm ratio calculated. AOP2 was added at a molar ratio of 1 : 1060 (AOP2 (2 lgÆml )1 ) + ascorbic acid (5 m M )) and 1 : 303 (AOP2 (7 lgÆml )1 )+ascorbic acid (5 m M )) respectively. Reagent added to Hb solution Ratio 570/626 nm (48 h) Ratio 570/626 nm (120 h) None 7.6 6.0 Ascorbic acid (5 m M ) 4.1 3.7 AOP2 (2 lgÆmL )1 ) 8.7 6.7 AOP2 (7 lgÆmL )1 ) 10.9 9.1 AOP2 (2 lgÆmL )1 ) + ascorbic acid (5 m M ) 6.6 6.2 AOP2 (7 lgÆmL )1 ) + ascorbic acid (5 m M ) 7.5 8.3 Fig. 6. Methemoglobin formation is prevented by AOP2. AOP2 pre- vented metHb from forming spontaneously over a 72-h period. MetHb (peak absorbance around 622 nm) is nearly absent from fresh hemo- globin. Hemoglobin (peak absorbance at 576 nm) is partially oxidized over 72 h and oxidized more by ascorbic acid. AOP2 prevents Hb from being spontaneously oxidized to metHb. Ó FEBS 2003 Distribution and function of antioxidant protein 2 (Eur. J. Biochem. 270) 339 immunoprecipitation studies indicated that AOP2 bound with high affinity to the heme complex, supporting the hypothesis that it protects or restores hemoglobin to its active form. This hypothesis has yet to be confirmed. Because metHb is so undesirable, organisms need a redundant system to reduce its formation. RBCs, lacking the ability to replace damaged molecules, depend more than do other cells on efficient detoxifying systems: a lack of protective enzymes in RBCs would result in a surge of oxidation. Abnormal metHb formation has not been found in human acatalasemics [1], a further indicator that other molecules such as AOP2 might compensate for the missing catalase in these patients. AOP2 may well be a major antioxidant in RBCs, and its role in other cells is being investigated in our laboratories. Heme is the prosthetic group of several proteins and enzymes (myo- globin, cytochrome c, cytochrome P450, ubiquinol-cyto- chrome c reductase, cytochrome c oxidase, tryptophan pyrrolase, and NO synthase), and AOP2 may protect them also. This would explain its nearly ubiquitous presence and provide further evidence for its importance as a major protective protein. Acknowledgements The authors thank Ray Lambert for his editing skills. This work was supported in part by a grant from AstraZeneca, by the Austrian Ministry of Education, Science and Culture, Austrian Ministry of Social Security and Generations GZ.236.065/6-VI/B/10/01 (GZ:236.065/7-VIII/A/6/00), and the City of Vienna. References 1. Halliwell, B. & Gutteridge, J.M. (1998) Free Radicals in Biology and Medicine, 3rd edn. Oxford University Press Inc, New York, USA. 2. Denicola, A., Souza, J.M. & Radi, R. (1998) Diffusion of peroxy- nitrite across erythrocyte membranes. Proc.NatlAcad.Sci.USA 95, 3566–3571. 3. Lynch, R.E. & Fridovich, I. (1978) Permeation of the erythrocyte stroma by superoxide radical. J. Biol. Chem. 253, 4697–4699. 4. Matsuoka, I., Fujino, Y., Ogita, S. & Inoue, M. (1995) Impact of erythrocytes on mouse embryonal development in vitro. FEBS Lett. 371, 297–299. 5. Cha, M.K., Kim, H.K. & Kim, I.H. (1995) Thioredoxin-linked Ôthiol peroxidaseÕ from periplasmic space of Escherichia coli. J. Biol. Chem. 270, 28635–28641. 6. Cha, M.K., Yun, C.H. & Kim, I.H. (2000) Interaction of human thiol-specific antioxidant protein 1 with erythrocyte plasma membrane. Biochemistry 39, 6944–6950. 7. Kim, K., Kim, I.H., Lee, K.Y., Rhee, S.G. & Stadtman, E.R. (1988) The isolation and purification of a specific ÔprotectorÕ protein which inhibits enzyme inactivation by a thiol/Fe (III)/O 2 mixed-function oxidation system. J. Biol. Chem. 263, 4704–4711. 8. Chae, H.Z. & Rhee, S.G. (1994) A thiol-specific antioxidant and sequence homology to various proteins of unknown function. Biofactors 4, 177–180. 9. McGonigle, S., Dalton, J.P. & James, E.R. (1998) Peroxidoxins: a new antioxidant family. Parasitol. Today 14, 139–145. 10. Hofmann, B., Hecht, H.J. & Flohe, L. (2002) Peroxiredoxins. Biol. Chem. 383, 347–364. 11. Chae, H.Z., Kim, H.J., Kang, S.W. & Rhee, S.G. (1999) Char- acterization of three isoforms of mammalian peroxiredoxin that reduce peroxides in the presence of thioredoxin. Diabetes Res. Clin. Pract. 45, 101–112. 12. Chae, H.Z., Robison, K., Poole, L.B., Church, G., Storz, G. & Rhee, S.G. (1994) Cloning and sequencing of thiol-specific anti- oxidant from mammalian brain: alkyl hydroperoxide reductase and thiol-specific antioxidant define a large family of antioxidant enzymes. Proc. Natl Acad. Sci. USA 91, 7017–7021. 13. Bryk, R., Griffin, P. & Nathan, C. (2000) Peroxynitrite reductase activity of bacterial peroxiredoxins. Nature 407, 211–215. 14. Barr, S.D. & Gedamu, L. (2001) Cloning and characterization of three differentially expressed peroxidoxin genes from Leishmania chagasi. Evidence for an enzymatic detoxification of hydroxyl radicals. J. Biol. Chem. 276, 34279–34287. 15. Peshenko, I.V. & Shichi, H. (2001) Oxidation of active center cysteine of bovine 1-Cys peroxiredoxin to the cysteine sulfenic acid form by peroxide and peroxynitrite. Free Radic. Biol. Med. 31, 292–303. 16. Seo,M.S.,Kang,S.W.,Kim,K.,Baines,I.C.,Lee,T.H.&Rhee, S.G. (2000) Identification of a new type of mammalian peroxi- redoxin that forms an intramolecular disulfide as a reaction intermediate. J. Biol. Chem. 275, 20346–20354. 17. Zhou, Y., Kok, K.H., Chun, A.C., Wong, C.M., Wu, H.W., Lin, M.C., Fung, P.C., Kung, H. & Jin, D.Y. (2000) Mouse peroxir- edoxin V is a thioredoxin peroxidase that inhibits p53-induced apoptosis. Biochem. Biophys. Res. Commun. 268, 921–927. 18. Iakoubova, O.A., Pacella, L.A., Her, H. & Beier, D.R. (1997) LTW4 protein on mouse chromosome 1 is a member of a family of antioxidant proteins. Genomics 42, 474–478. 19. Phelan, S.A., Johnson, K.A., Beier, D.R. & Paigen, B. (1998) Characterization of the murine gene encoding Aop2 (antioxidant protein 2) and identification of two highly related genes. Genomics 54, 132–139. 20. Declercq, J.P., Evrard, C., Clippe, A., Stricht, D.V., Bernard, A. & Knoops, B. (2001) Crystal structure of human peroxiredoxin 5, a novel type of mammalian peroxiredoxin at 1.5 A resolution. J. Mol. Biol. 311, 751–759. 21. Phelan, S.A. (1999) AOP2 (Antioxidant Protein 2): Structure and function. Antiox. Redox. Signal. 1, 1–14. 22. Kim, T.S., Dodia, C., Chen, X., Hennigan, B.B., Jain, M., Feinstein, S.I. & Fisher, A.B. (1998) Cloning and expression of rat lung acidic Ca(2+) -independent PLA2 and its organ distribution. Am. J. Physiol. 274, L750–L761. 23. Kang, S.W., Baines, I.C. & Rhee, S.G. (1998) Characterization of a mammalian peroxiredoxin that contains one conserved cysteine. J. Biol. Chem. 273, 6303–6311. 24. Stuhlmeier,K.M.,Csizmadia,V.,Cheng,Q.,Winkler,H.&Bach, F.H. (1994) Selective inhibition of E-selectin, ICAM-1, and VCAM in endothelial cells. Eur. J. Immunol. 24, 2186–2190. 25. Dyer, R.B. & Herzog, N.K. (1995) Isolation of intact nuclei for nuclear extract preparation from a fragile B-lymphocyte cell line. Biotechniques 19, 192–195. 26. Chae, H.Z., Kim, I.H., Kim, K. & Rhee, S.G. (1993) Cloning, sequencing, and mutation of thiol-specific antioxidant gene of Saccharomyces cerevisiae. JBiolChem.268, 16815–16821. 27. Carr, A. & Frei, B. (1999) Does vitamin C act as a pro-oxidant under physiological conditions? Faseb J. 13, 1007–1024. 28. Salvati, A.M. & Tentori, L. (1981) Determination of aberrant hemoglobin derivatives in human blood. In Methods in Enzymology (Colowick, S.P. & Kaplan, N.O., eds), pp. 715–731. Academic Press Inc., New York, USA. 29. Mazor, D., Golan, E., Philip, V., Katz, M., Jafe, A., Ben-Zvi, Z. & Meyerstein,N.(1996)Redbloodcellpermeabilitytothiolcom- pounds following oxidative stress. Eur. J. Haematol. 57, 241–246. 30. Munz, B., Frank, S., Hubner, G., Olsen, E. & Werner, S. (1997) A novel type of glutathione peroxidase: expression and regulation during wound repair. Biochem. J. 326, 579–585. 340 K. M. Stuhlmeier et al.(Eur. J. Biochem. 270) Ó FEBS 2003 31. Frank, S., Munz, B. & Werner, S. (1997) The human homologue of a bovine non-selenium glutathione peroxidase is a novel kera- tinocyte growth factor-regulated gene. Oncogene 14, 915–921. 32. Lim, Y.S., Cha, M.K., Yun, C.H., Kim, H.K., Kim, K. & Kim, I.H. (1994) Purification and characterization of thiol-specific antioxidant protein from human red blood cell: a new type of antioxidant protein. Biochem. Biophys. Res. Commun. 199, 199–206. 33. Chae, H.Z., Uhm, T.B. & Rhee, S.G. (1994) Dimerization of thiol- specific antioxidant and the essential role of cysteine 47. Proc. Natl Acad. Sci. USA 91, 7022–7026. 34. Hirotsu,S.,Abe,Y.,Nagahara,N.,Hori,H.,Nishino,T.,Okada, K. & Hakoshima, T. (1999) Crystallographic characterization of a stress-induced multifunctional protein, rat HBP-23. J. Struct. Biol. 126, 80–83. Ó FEBS 2003 Distribution and function of antioxidant protein 2 (Eur. J. Biochem. 270) 341 . of antioxidant protein 2 is currently under- going reconsideration. This protein is currently named antioxidant protein 2 in humans and peroxiredoxin 5 in. interactions. Recombinant AOP2 prevented induced as well as noninduced methemoglobin formation in erythrocyte hemolysates, indicating its antioxidant proper- ties.