The human homolog of insect derived grow

Genomics 64, 277–285 (2000) doi:10.1006/geno.1999.6099, available online at http://www.idealibrary.com on The Human Homolog of Insect-Derived Growth Factor, CECR1, Is a Candidate Gene for Features of Cat Eye Syndrome M Ali Riazi,* ,† Polly Brinkman-Mills,† Thuan Nguyen,‡ Huaqin Pan,‡ Stacey Phan,‡ Fu Ying,‡ Bruce A Roe,‡ Junko Tochigi,§ Yoshiko Shimizu,§ Shinsei Minoshima, ¶ Nobuyoshi Shimizu, ¶ Manuel Buchwald,* and Heather E McDermid† ,1 *Program in Genetics and Genomic Biology, Research Institute, The Hospital for Sick Children, Toronto, Ontario M5G 1X8, Canada; †Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada; ‡Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma 73019-0370; §Department of Medical Genetics, Kyorin University School of Health Science, Tokyo, Japan; and ¶Department of Molecular Biology, Keio University School of Medicine, Tokyo, Japan Received October 4, 1999; accepted December 13, 1999 Cat eye syndrome (CES) is a developmental disorder with multiple organ involvement, associated with the duplication of a 2-Mb region of 22q11.2 Using exon trapping and genomic sequence analysis, we have isolated and characterized a gene, CECR1, that maps to this critical region The protein encoded by CECR1 is similar to previously identified novel growth factors: IDGF from Sarcophaga peregrina (flesh fly) and MDGF from Aplysia californica (sea hare) The CECR1 gene is alternatively spliced and expressed in numerous tissues, with most abundant expression in human adult heart, lung, lymphoblasts, and placenta as well as fetal lung, liver, and kidney In situ hybridization of a human embryo shows specific expression in the outflow tract and atrium of the developing heart, the VII/ VIII cranial nerve ganglion, and the notochord The location of this gene in the CES critical region and its embryonic expression suggest that the overexpression of CECR1 may be responsible for at least some features of CES, particularly the heart defects © 2000 Academic Press INTRODUCTION Cat eye syndrome (CES, MIM 115470) is a developmental disorder associated with duplication of the proximal long arm of human chromosome 22 CES is characterized by unilateral or bilateral coloboma, preauricular skin tags and pits, imperforate anus, absent or hypoplastic kidneys, mental retardation, and congenital heart malformations, particularly total Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No AF190746 To whom correspondence should be addressed Telephone: (780) 492-5377 Fax: (780) 492-9234 E-mail: hmcdermi@gpu.srv ualberta.ca anomalous pulmonary venous connection (TAPVC) (Schinzel et al., 1981; Freedom and Gerald, 1973) The duplication usually takes the form of a supernumerary bisatellited isodicentric chromosome, resulting in four copies of the region (Schinzel et al., 1981; McDermid et al., 1986), though interstitial duplications are also known to result in CES (Knoll et al., 1995) The CES critical region duplicated in all patients has been mapped to approximately Mb, from the centromere to D22S57 (Mears et al., 1995; McDermid et al., 1996), based on a patient with an unusual supernumerary r(22) and all the typical features of CES The only functional gene reported in this region to date is the epsilon subunit of ATPase, ATP6E (Baud et al., 1994), which localizes to the distal region of the CES critical region (Fig 1A) In addition, the apoptotic agonist BID has been shown to map just distal to the critical region and is duplicated in all CES patients except the child with the supernumerary r(22) (Footz et al., 1998) To identify additional genes using positional cloning approaches, the CES critical region was partially cloned into yeast artificial chromosomes (YACs) (McDermid et al., 1996) However, the apparent instability of YACs in this region led to the construction of a contig composed of bacterial artificial chromosomes (BACs) and P1 artificial chromosomes (PACs) (Johnson et al., 1999) Using exon trapping, an expression-independent approach for the isolation of gene segments from genomic clones (Buckler et al., 1991), and analysis of genomic sequence, we have now identified CECR1 (for cat eye syndrome critical region gene 1) The predicted CECR1 protein has significant similarity to insect-derived growth factor (IDGF) (Homma et al., 1996), isolated from the flesh fly Sarcophaga peregrina The location of CECR1, its expression profile, and its putative role in growth regulation make this an attractive candidate gene to play a role in at least some of the features associated with CES 277 0888-7543/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved 278 RIAZI ET AL FIG The location and structure of CECR1 (A) The CES critical region spans from the centromere to D22S57 on 22q11.2 The location of CECR1 in the critical region and the cosmids and PACs used for isolation and determining the orientation of the CECR1 cDNA sequence are shown The CECR1 gene contains nine exons The open reading frame is shown with shaded boxes All exons are located within the first 30 kb of the PAC P143i13 sequence, while only the first two exons reside on PAC P238M15 (B) The CECR1 cDNA sequence derived from the sequences of the fetal heart EST (AA348024) and the 5Ј RACE product The open reading frame is shown in capital letters CECR1 contains a large 3Ј UTR, rich in Alu and LINE repeats The regions similar to Alu sequences are indicated with a dark gray background, while the sequences similar to LINEs are shown with a light gray background The exon/exon junctions are shown with asterisks The sequences used as primers for PCR and RACE are underlined, and the canonical poly(A) ϩ adenylation signal is delineated with a box The arrow at position 2793 indicates the 3Ј end of the EST cDNA AI613429, although no canonical poly(A) ϩ signal sequence is found within the surrounding sequence MATERIALS AND METHODS Exon trapping The cosmids 41A6 and 41A7 were obtained by probing a chromosome 22-only cosmid library (de Jong et al., 1989) with a probe made to locus D22S43 These cosmids are probably identical and the result of well-to-well cross-contamination The cosmid clones were digested with BamHI and shotgun cloned into the BamHI-digested exon-trapping vector pSPL3B (BRL) The resulting plasmids were subjected to exon trapping according to the manufacturer’s instructions (BRL) The same methodology was used to amplify exons from a PAC (P238M15) in the region (Johnson et al., 1999) Southern and Northern analyses Cosmid DNA was prepared using a kit (Qiagen Inc.), and PAC DNAs were prepared according to Sternberg, (1990) Genomic DNA from hybrid cell line GM010888, which carries chromosome 22 as its only human component, and normal lymphoblast cell line GM3657 (both from the NIHMS Mutant Cell Repository) was digested with either SstI or PstI and electrophoresed A Southern blot from this gel was hybridized with a probe made to the trapped exon of CECR1 Adult and fetal multiple tissue Northern blots were purchased from Clontech Inc In addition, a Northern blot containing approximately ␮g of poly(A) ϩ RNAs from different lymphoblast cell lines was used Poly(A) ϩ RNA was isolated using a poly(A) ϩ mRNA extraction kit (Promega Inc.) To obtain a probe, the CECR1 open reading frame was amplified with PCR using primers f1 (ATGGCCCATCTGAGCGGCCAGC) and r1 (TAGAGGGCTGGCTAGCTTCTCC) A [ 32P]dCTP-labeled probe from this PCR fragment was hybridized to the Northern blots in 50% formamide, 5ϫ SSPE, 10ϫ Denhardt solution, 2% SDS, and 0.4 mg/ml boiled herring sperm DNA The blots were washed for 2ϫ 10 in 2ϫ SSC/1% SDS at room temperature, followed by 1ϫ 10 in 0.1ϫ SSC/0.1% SDS at 50°C 5Ј rapid amplification of cDNA ends and RT-PCR Total RNA was extracted from approximately 5ϫ 10 cells from a lung fibroblast-like cell line, CCL135, obtained from American Type Culture Collection (ATCC) CCL135 originates from a biopsy of normal lung tissue from a 16-year-old male with osteogenic sarcoma (ATCC) 5Ј RACE (rapid amplification of cDNA ends) (Frohman et al., 1988) was performed on ␮g of total RNA using the 5Ј RACE system from BRL Life Technologies Inc Primer ra1 (CTCATTGGCCAGCTCCTCCTTG) was used to construct the primary cDNA strand, and primers ra2 (AACAACAGATGGCCCGTGTTTCA) and ra3 (ATTGCCACAGCCAACAGCAAG) were used as nested primers for PCR amplification of the 5Ј end of CECR1 For RT-PCR, 2–5 ␮g of total RNA was reverse-transcribed and amplified with primers f2 (GGATTCTGCTGGAGGATTATCG) and r2 (AAAGTAAGGCAGCTTAACGCCA) using an RT-PCR kit purchased from BRL Inc., according to the manufacturer’s instructions Sequencing The EST 54445 (GenBank Accession No AA348024) obtained from The Institute for Genomic Research was sequenced by the shotgun sequencing method (Kawasaki et al., 1997) The 5Ј RACE product was sequenced by the sequencing facility of the Hospital for Sick Children (Toronto, Ontario, Canada) Embryonic RNA in situ hybridization A 0.6-kb fragment of CECR1 was amplified by PCR using primers f2 and r2 (Fig 1B) and subcloned into pGEM-T vector (Promega Inc.) The sense and antisense digoxigenin-labeled RNA probes were prepared using the DIG RNA labeling kit (Boehringer Mannheim Inc.) A 35-day formalinfixed human embryo was embedded in a paraffin block Slides were PUTATIVE GROWTH FACTOR IN CAT EYE SYNDROME REGION 279 FIG 1—Continued prepared by cutting 4-␮m sections from the paraffin block according to standard procedures To perform in situ hybridization, the slides were first dewaxed in xylene and a graded series of ethanol solutions, and then the rest of the protocol of Breitschopf et al (1992), was followed with minor modifications The slides were counterstained with hematoxylin solution provided in the HistoMouse-SP kit (Zymed Inc.) according to the instructions RESULTS Identification and Mapping of CECR1 in the CES Critical Region Using exon trapping, we amplified a 365-bp putative exon from a pool of two cosmids (41A6 and 41A7) and separately from PAC P238M15, all in the vicinity of D22S43 in the CES critical region (Fig 1A) Localization to the CES critical region was confirmed by hybridization of the exon to the cosmid and PAC clones A BLASTN search of the EST database with the se- quence of this exon detected a 3.7-kb EST cDNA from fetal heart (GenBank Accession No AA348024), which was shotgun sequenced RT-PCR was performed using primers r2 and f2 to demonstrate expression in a lung cell line (CCL135, not shown) A 5Ј RACE reaction was then performed on total RNA from CCL135 cells to obtain the putative start of translation and resulted in the amplification of an approximately 250-bp fragment that extended the sequence by 173 bp The sequences of the 5Ј RACE and cDNA were combined to derive the final cDNA sequence of CECR1 (Fig 1B), which contains a 1536-bp open reading frame potentially encoding a 511-residue protein No Kozak consensus sequence adjacent to the first ATG of CECR1 or a stop codon upstream of this ATG was detected To determine the exon/intron junctions of this gene, we compared the sequence of CECR1 cDNA with the genomic sequence of the PACs P238M15 (Accession No 280 RIAZI ET AL AC005399) and P143i13 (Accession No AC005300), which also established the genomic size (approximately 30 kb) and orientation (telomere to centromere) of the CECR1 gene (Fig 1A) The sequence of the cDNA was different from the genomic sequence in positions within the open reading frame, resulting in amino acid changes CECR1 has nine identified exons and contains a relatively large 3Ј untranslated region (UTR) of approximately 2.2 kb The 3Ј UTR sequence is rich in Alu and LINE repeats as indicated in Fig 1B Within the 2.2-kb 3Ј UTR, the largest region of unique DNA is only 109 bp The presence of repeats in the untranslated regions of cDNAs has been demonstrated in about 5% of the cDNA sequences identified (Makalowski et al., 1996) Since the CES critical region is rich in repetitive sequences and truncated nonfunctional gene fragments from other chromosomes (Riazi et al., 1999; Eichler et al., 1997), we hybridized a labeled exon probe to a Southern blot containing SstI- and PstIdigested DNA from cell lines GM010888 (which contains human chromosome 22) and GM3657 (normal human) Only one band, specific to chromosome 22, was detected (data not shown) This suggests that CECR1 is uniquely located on chromosome 22, with no closely related sequence in the human genome No cross-hybridization to a putative rodent Cecr1 was seen CECR1 Protein Similarity to Growth Factors and ADA The CECR1 DNA sequence was searched against the nonredundant (nr) and dbest databases using the BLASTN program Other than the original EST and genomic sequence, no similar DNA sequences were detected in these databases However, using the BLASTP and TBLASTN programs against the nonredundant database, the CECR1 protein sequence shows similarity to insect-derived growth factor (IDGF, Accession No BAA11812, P value of ϫ 10 Ϫ93) from the flesh fly Sarcophaga peregrina (Homma et al., 1996), mollusk-derived growth factor (MDGF, Accession No AAD13112, P value 10 Ϫ100), atrial gland-specific antigen (AGSA, Accession No P15287, P value of 10 Ϫ52) from Aplysia californica (sea hare) (Sossin et al., 1989), and Glossina morsitans morsitans salivary gland growth factor-1 and -2 (TSGF-1 and -2, Accession Nos AF140521 and AF140522, P values of ϫ 10 Ϫ80 and ϫ 10 Ϫ98, respectively) The overall protein similarity of CECR1 is approximately 59% to MDGF and IDGF (Fig 2) and 55% to TSGF-1 and -2 The C-terminal halves of all these proteins also have significant similarity to adenosine deaminase (ADA) from a number of organisms including human and mouse The best ADA similarity is to a putative ADA from Streptomyces coelicolor (Accession No CAA19890) All the residues forming the ADA catalytic domain and the surrounding amino acids are highly conserved in CECR1, MDGF, and IDGF (Fig 2) (Mohamedali et al., 1996) Most of these residues are also conserved in the TSGF-1 and -2 proteins Kyte–Doolitle analysis (Kyte and Doolittle, 1982) for hydrophobicity detects a short hydrophobic region at the N-terminus of CECR1 (Fig 3A) Similarly, a short hydrophobic region is also detected at the N-termini of IDGF and MDGF These residues may represent signal peptides as predicted by the SignalP program (Nielsen et al., 1997), therefore indicating that CECR1 may be a secretory protein like IDGF In addition to these known genes, the CECR1 protein has similarity to a number of uncharacterized EST cDNAs from Drosophila melanogaster A summary of the extent of similarity of CECR1 to MDGF, IDGF, TSGF-1 and -2, AGSA, mouse adenosine deaminase, and the Drosophila ESTs, as well as the possible location of the signal peptide and ADA domain, is shown in Fig 3B CECR1 Is Expressed in Various Fetal and Adult Tissues Northern blot analysis using a probe made from the whole open reading frame of CECR1 revealed expression in various adult and fetal organs Two independent adult tissue Northern blots were probed and gave consistent results As shown in Fig 4, CECR1 is strongly expressed in the adult heart, lung, lymphoblasts, and placenta as well as fetal lung, liver, and kidney Weaker expression is seen in adult pancreas and liver, with faint expression in adult and fetal brain CECR1 also shows strong expression in adult spleen (not shown) Three different transcript sizes (1.0, 3.5, and 4.4 kb) were detected, indicating that CECR1 undergoes alternative splicing Transcripts of 3.5 and 4.4 kb were both expressed in fetal lung, but in other tissues one of the two transcripts dominated The 3.5-kb transcript was expressed in heart, pancreas, lymphocytes, kidney, and fetal kidney, while the 4.4-kb transcript was expressed in placenta, lung, liver, and fetal liver The 1.0-kb transcript is seen only in skeletal muscle, where it is the only visible transcript, and in pancreas To explain the difference between the alternative 3.5- and 4.4-kb transcripts, a short unique sequence in the 3Ј UTR of CECR1 (78 bp, starting at position 2500 in Fig 1B) was used for a BLAST similarity search and detected an additional human EST cDNA (AI613429) The sequence of this cDNA ends at position 2793 (Fig 1B) with a run of As and therefore represents a transcript 1.1 kb shorter than the CECR1 cDNA we characterized in this study Therefore alternative polyadenylation sites may explain the two major CECR1 transcript sizes We further studied the embryonic expression of CECR1 in a 35-day human embryo using RNA in situ hybridization Sense and antisense digoxigenin-labeled RNA probes, from the region amplified by PCR using primers f2 and r2, were hybridized to the embryo sections Specific signals were detected only with the PUTATIVE GROWTH FACTOR IN CAT EYE SYNDROME REGION 281 FIG Protein similarity of CECR1 to MDGF and IDGF as determined by BLASTP Identical residues are shown with a black background, and similar residues are shown with a gray background The CECR1 protein has approximately 39% identity and 59% similarity to these proteins The C-terminus of the three proteins has significant similarity with the adenosine deaminase enzyme The functional residues in the catalytic domain of ADA, indicated with asterisks, and the surrounding residues are highly conserved in CECR1, MDGF, and IDGF antisense probe As indicated in Fig 5, CECR1 RNA was detected in the outflow tract and atrium of the heart, the VII/VIII cranial nerve ganglion, the notochord, and the placenta DISCUSSION Overexpression of a gene or genes located in the critical region of 22q11.2 presumably leads to the abnormal fea- tures of CES A number of genes are likely to be present in the duplicated region, though it is not known whether CES is a contiguous gene syndrome with involvement of more than one gene Several microdeletion syndromes with multiple organ system involvement such as Angelman and Alagille syndromes, which were initially thought to be caused by multiple genes, have been associated with deletions or mutations in one gene (reviewed in Budarf and Emanuel, 1997) 282 RIAZI ET AL FIG Structure of CECR1 compared to other family members (A) Kyte–Doolittle hydrophobicity map of CECR1, MDGF, and IDGF shows a similar short hydrophobic region at the N-termini of these proteins These residues are predicted to function as signal peptides, using the SignalP program for signal peptide prediction (B) The predicted domains and similarities to CECR1 (shaded regions in other proteins) are indicated in this diagram The CECR1 C-terminus demonstrates similarity to ADA and therefore may have ADA activity The region of similarity to Drosophila ESTs is also shown The putative ADA domain, signal peptide (SP), and a region of similarity to all other family members in the N-terminus of CECR1 are shown with black, hatched, and dotted boxes, respectively Until now the only gene reported to be present in the CES critical region was ATP6E (Baud et al., 1994) ATP6E is a widely expressed housekeeping gene (Baud et al., 1994) and therefore is unlikely to play a major role in the variable developmental defects seen in these patients The 2-Mb CES critical region is expected to be reasonably gene poor, since the proximal half (centromere to D22S9) is known to contain a large number of nonfunctional gene segments and repeats (reviewed in Eichler et al., 1997) Examples of known gene fragments in the area include NF1-related sequence (Regnier et al., 1997), vWFP (Eikenboom et al., 1994), ALD (Eichler et al., 1997), and KCNMB3R (Riazi et al., 1999) These gene fragments are hypothesized to be the result of duplication and transposition of segments of functional genes from other chromosomes Here we report the identification and characterization of CECR1, mapping to the CES critical region Southern blot analysis suggests that this is the only copy of this gene in the genome The identified cDNA (AF190746) contains a putative ORF coding for 511 amino acid residues While this cDNA probably represents the larger 4.4-kb transcript seen on a Northern blot, the second EST cDNA with a shorter 3Ј UTR (AI613429) probably represents the 3.5-kb transcript Therefore, the difference between the two transcripts appears to be in the size of the 3Ј UTR and not the ORF Because the identified cDNA (AF190746) is only 3.95 kb, a small amount of sequence may still need to be identified to have the full cDNA representing the 4.4-kb transcript Although our RACE PCR extended the cDNA sequence by 173 bp, no upstream stop codon or Kozak sequence in the vicinity of the putative first ATG was detected The location of PUTATIVE GROWTH FACTOR IN CAT EYE SYNDROME REGION 283 CECR1 may account for some of the other features of CES such as renal malformations Isolation of the mouse homologue and its use in producing a developmental profile of expression will address this issue The protein encoded by the CECR1 ORF has significant similarity to IDGF in the flesh fly, to MDGF and AGSA in the sea hare, and to TSGF-1 and -2 in G moristans IDGF has been biochemically purified from the embryonic cell line NIH-Sape-4 of the flesh fly (Sa peregrina) and shown to be a growth factor Addition of IDGF stimulates the proliferation of NIH-Sape-4 cells in conditioned medium, with a specific activity comparable to that of mammalian growth factors (Homma et al., 1996) The expression of a significant amount of IDGF at various developmental stages (when a high rate of cell proliferation is required) indicates an imFIG Northern blot analysis of CECR1 Adult human and fetal Northern blots were hybridized with a probe made from the full open reading frame of CECR1 The probe was also hybridized to a blot containing RNA from the lymphoblast cell line HSC93 CECR1 appears to undergo alternative splicing, resulting in transcripts of approximately 4.4, 3.5, and kb in size The lower panels represent the hybridization with either ␤-actin (adult tissues and lymphoblast) or GAPDH (fetal tissues) as loading controls RNA size markers of 4.4 and 1.3 kb are also indicated the putative start codon matches the approximate length of the related genes IDGF and MDGF The first ATG of IDGF, MDGF, AGSA, TSGF-1, and TSGF-2 RNAs also lacks a Kozak consensus sequence, indicating that this family of RNAs may not use a scanning model for translation initiation (Kozak, 1989) Such cases have been reported before, and interestingly, these RNAs encode mostly potent regulatory proteins, such as growth factors, and cytokines This suggests that a weak ATG context for the initiation of translation in these RNAs may be necessary to modulate the expression of proteins that could be harmful if overexpressed (reviewed in Kozak, 1991) In addition, mapping the hydrophobic region of the CECR1 protein sequence detects a distinct hydrophobic region at the most N-terminus of this protein, similar to IDGF and MDGF (Fig 3A), suggesting that our cDNA represents the full open reading frame of this gene The CECR1 RNA is expressed in a number of adult and fetal organs including the embryonic heart The specific localized expression of CECR1 in the outflow tract and atrium of the developing human heart suggests a function for this gene in cardiovascular development and the heart defects (commonly TAPVC) associated with CES In TAPVC the pulmonary veins, which are normally connected to the left atrium, drain into the right atrium or one of the systemic veins This defect has a high mortality rate in newborns if not surgically corrected In addition, the expression in other tissues such as the fetal kidney according to our Northern analysis and the VII/VIII cranial nerve ganglion (precursor to the facial and acoustic ganglions, respectively) suggests that the overexpression of FIG Human embryonic expression of CECR1 (A) CECR1 RNA is detected, indicated by arrows, in the developing heart (H), notochord (N), the VII/VIII cranial nerve ganglion (G), placenta (P), cells adjacent to forebrain (B), and neural tube (NT) using in situ hybridization (B) The expression in the heart is localized to the outflow tract (OT) and atrium (A) of the heart The ventricle (V) is also indicated (C) Hybridization with the sense probe resulted in only minor signals in the neural tube in the caudal region of the embryo and in the placenta 284 RIAZI ET AL portant developmental function for IDGF Due to the extensive homology with IDGF, CECR1 might also be a growth factor with a function during early development The abnormal overexpression of a putative growth factor such as CECR1 may interfere with the normal development of some of the organs affected in CES patients by increasing cell proliferation The functions of MDGF and TSGF-1 and -2 are not clear AGSA is also a protein of unknown function localized to the secretory dense core vesicles of the atrial glands in the sea hare (Sossin et al., 1989) The similarity of the C-termini of CECR1 and its orthologs to ADA also suggests that CECR1 may have adenosine deaminase activity ADA is an enzyme of purine metabolism that catalyzes the hydrolytic deamination of adenosine or 2Ј-deoxyadenosine to inosine or 2Ј-deoxyinosine and thus regulates the intracellular and extracellular concentration of adenosine (Wiginton et al., 1986; reviewed in Franco et al., 1997) Adenosine is a potent modulator of cell proliferation and migration in addition to mediating a variety of physiological effects such as vasodilatation (reviewed in Dubey et al., 1996) This nucleoside has been known to have angiogenic and vasculogenic effects in vivo and in vitro (Dusseau et al., 1986; Ethier et al., 1993) In contrast to its mitogenic effect on (some) endothelial cells (Meininger et al., 1988), both endogenous adenosine and exogenous adenosine inhibit the growth of rat vascular smooth muscle cells (Dubey et al., 1996) and cardiac fibroblasts (Dubey et al., 1997) The multiple effects of adenosine on different cell types may be due to the nature of the adenosine receptors on the surface of these cells Due to significant conservation of the residues within the ADA catalytic domain at the Ctermini of CECR1, IDGF, MDGF, and TSGF-1 and -2, we propose that this novel family of secreted proteins may, in part, exert their functions by regulating the concentration of extracellular adenosine Since adenosine plays an important role during development, the overproduction of CECR1 could disturb the homeostasis of adenosine and result in the various features of CES ACKNOWLEDGMENTS We thank Dr Steve Bamforth for providing the human embryo, Angela Johnson and Dana Shkolny for the help with 5Ј RACE, and Lucine Bosnoyan-Collins for providing the lymphoblast Northern blot This research was supported by grants from the Medical Research Council of Canada (H.E.M., M.B.) and the Canadian Cystic Fibrosis Foundation (M.B.), by NIH–NHGRI Grant HG00313 (B.A.R.), as well as by Grants in Aid for Scientific Research on Priority Areas and Scientific Research from the Ministry of Education, Science, Sports, and Culture of Japan (N.S) and the Fund for “Research for the Future” Program from the Japan Society for the Promotion of Science (S.M.) REFERENCES Baud, V., Mears, A J., Lamour, V., Scamps, C., Duncan, A M., McDermid, H E., and Lipinski, M (1994) The E subunit of vac- uolar H( ϩ)-ATPase localizes close to the centromere on human chromosome 22 Hum Mol Genet 3: 335–339 Breitschopf, H., Suchanek, G., Gould, R M., Colman, D R., and Lassmann, H (1992) In situ hybridization with digoxigenin-labeled probes: Sensitive and reliable detection method applied to myelinating rat brain Acta Neuropathol 84: 581–587 Buckler, A J., Chang, D D., Graw, S L., Brook, J D., Haber, D A., Sharp, P A., and Housman, D E (1991) Exon amplification: A strategy to isolate mammalian genes based on RNA splicing Proc Natl Acad Sci USA 88: 4005– 4009 Budarf, M L., and Emanuel, B S (1997) Progress in the autosomal segmental aneusomy syndromes (SASs): Single or multi-locus disorders? Hum Mol Genet 6: 1657–1665 de Jong, P J., Yokobata, K., Chen, C., Lohman, F., Pederson, L., McNich, J., and Van Dilla, M (1989) Human chromosome-specific partial digest libraries in lambda and cosmid vectors Cytogenet Cell Genet 51: 985 Dubey, R K., Gillespie, D G., Mi, Z., and Jackson, E K (1997) Exogenous and endogenous adenosine inhibits fetal calf seruminduced growth of rat cardiac fibroblasts: Role of A2B receptors Circulation 96: 2656 –2666 Dubey, R K., Gillespie, D G., Mi, Z., Suzuki, F., and Jackson, E K (1996) Smooth muscle cell-derived adenosine inhibits cell growth Hypertension 27: 766 –773 Dusseau, J W., Hutchins, P M., and Malbasa, D S (1986) Stimulation of angiogenesis by adenosine on the chick chorioallantoic membrane Circ Res 59: 163–170 Eichler, E E., Budarf, M L., Rocchi, M., Deaven, L L., Doggett, N A., Baldini, A., Nelson, D L., and Mohrenweiser, H W (1997) Interchromosomal duplications of the adrenoleukodystrophy locus: A phenomenon of pericentromeric plasticity Hum Mol Genet 6: 991–1002 Eikenboom, J C., Vink, T., Briet, E., Sixma, J J., and Reitsma, P H (1994) Multiple substitutions in the von Willebrand factor gene that mimic the pseudogene sequence Proc Natl Acad Sci USA 91: 2221–2224 Ethier, M F., Chander, V., and Dobson, J G., Jr (1993) Adenosine stimulates proliferation of human endothelial cells in culture Am J Physiol 265: H131–H138 Footz, T K., Birren, B., Minoshima, S., Asakawa, S., Shimizu, N., Riazi, M A., and McDermid, H E (1998) The gene for death agonist BID maps to the region of human 22q11.2 duplicated in cat eye syndrome chromosomes and to mouse chromosome Genomics 51: 472– 475 Franco, R., Casado, V., Ciruela, F., Saura, C., Mallol, J., Canela, E I., and Lluis, C (1997) Cell surface adenosine deaminase: Much more than an ectoenzyme Prog Neurobiol 52: 283–294 Freedom, R M., and Gerald, P S (1973) Congenital cardiac disease and the “cat eye” syndrome Am J Dis Child 126: 16 –18 Frohman, M A., Dush, M K., and Martin, G R (1988) Rapid production of full-length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer Proc Natl Acad Sci USA 85: 8998 –9002 Homma, K., Matsushita, T., and Natori, S (1996) Purification, characterization, and cDNA cloning of a novel growth factor from the conditioned medium of NIH-Sape-4, an embryonic cell line of Sarcophaga peregrina (flesh fly) J Biol Chem 271: 13770 –13775 Johnson, A., Minoshima, S., Asakawa, S., Shimizu, N., Shizuya, H., Roe, B A., and McDermid, H E (1999) A 1.5-Mb contig within the cat eye syndrome critical region at human chromosome 22q11.2 Genomics 57: 306 –309 Kawasaki, K., Minoshima, S., Nakato, E., Shibuya, K., Shintani, A., Schmeits, J L., Wang, J., and Shimizu, N (1997) One-megabase sequence analysis of the human immunoglobulin lambda gene locus Genome Res 7: 250 –261 PUTATIVE GROWTH FACTOR IN CAT EYE SYNDROME REGION Knoll, J H., Asamoah, A., Pletcher, B A., and Wagstaff, J (1995) Interstitial duplication of proximal 22q: Phenotypic overlap with cat eye syndrome Am J Med Genet 55: 221–224 Kozak, M (1989) The scanning model for translation: An update J Cell Biol 108: 229 –241 Kozak, M (1991) An analysis of vertebrate mRNA sequences: Intimations of translational control J Cell Biol 115: 887–903 Kyte, J., and Doolittle, R F (1982) A simple method for displaying the hydropathic character of a protein J Mol Biol 157: 105–132 Makalowski, W., Zhang, J., and Boguski, M S (1996) Comparative analysis of 1196 orthologous mouse and human full-length mRNA and protein sequences Genome Res 6: 846 – 857 McDermid, H E., Duncan, A M., Brasch, K R., Holden, J J., Magenis, E., Sheehy, R., Burn, J., Kardon, N., Noel, B., and Schinzel, A., et al (1986) Characterization of the supernumerary chromosome in cat eye syndrome Science 232: 646 – 648 McDermid, H E., McTaggart, K E., Riazi, M A., Hudson, T J., Budarf, M L., Emanuel, B S., and Bell, C J (1996) Long-range mapping and construction of a YAC contig within the cat eye syndrome critical region Genome Res 6: 1149 –1159 Mears, A J., el-Shanti, H., Murray, J C., McDermid, H E., and Patil, S R (1995) Minute supernumerary ring chromosome 22 associated with cat eye syndrome: Further delineation of the critical region Am J Hum Genet 57: 667– 673 Meininger, C J., Schelling, M E., and Granger, H J (1988) Adenosine and hypoxia stimulate proliferation and migration of endothelial cells Am J Physiol 255: H554 –H562 Mohamedali, K A., Kurz, L C., and Rudolph, F B (1996) Sitedirected mutagenesis of active site glutamate-217 in mouse adenosine deaminase Biochemistry 35: 1672–1680 Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G (1997) A 285 neural network method for identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites Int J Neural Syst 8: 581–599 Regnier, V., Meddeb, M., Lecointre, G., Richard, F., Duverger, A., Nguyen, V C., Dutrillaux, B., Bernheim, A., and Danglot, G (1997) Emergence and scattering of multiple neurofibromatosis (NF1)-related sequences during hominoid evolution suggest a process of pericentromeric interchromosomal transposition Hum Mol Genet 6: –16 Riazi, M A., Brinkman-Mills, P., Johnson, A., Naylor, S L., Minoshima, S., Shimizu, N., Baldini, A., and McDermid, H E (1999) Identification of a putative regulatory subunit of a calciumactivated potassium channel in the dup(3q) syndrome region and a related sequence on 22q11.2 Genomics 62: 90 –94 Schinzel, A., Schmid, W., Fraccaro, M., Tiepolo, L., Zuffardi, O., Opitz, J M., Lindsten, J., Zetterqvist, P., Enell, H., Baccichetti, C., Tenconi, R., and Pagon, R A (1981) The “cat eye syndrome”: Dicentric small marker chromosome probably derived from a no 22 (tetrasomy 22pter to q11) associated with a characteristic phenotype Report of 11 patients and delineation of the clinical picture Hum Genet 57: 148 –158 Sossin, W S., Kreiner, T., Barinaga, M., Schilling, J., and Scheller, R H (1989) A dense core vesicle protein is restricted to the cortex of granules in the exocrine atrial gland of Aplysia california J Biol Chem 264: 16933–16940 Sternberg, N (1990) Bacteriophage P1 cloning system for the isolation, amplification, and recovery of DNA fragments as large as 100 kilobase pairs Proc Natl Acad Sci USA 87: 103–107 Wiginton, D A., Kaplan, D J., States, J C., Akeson, A L., Perme, C M., Bilyk, I J., Vaughn, A J., Lattier, D L., and Hutton, J J (1986) Complete sequence and structure of the gene for human adenosine deaminase Biochemistry 25: 8234 – 8244  ... for some of the other features of CES such as renal malformations Isolation of the mouse homologue and its use in producing a developmental profile of expression will address this issue The protein... al., 1997) The multiple effects of adenosine on different cell types may be due to the nature of the adenosine receptors on the surface of these cells Due to significant conservation of the residues... sequence, while only the first two exons reside on PAC P238M15 (B) The CECR1 cDNA sequence derived from the sequences of the fetal heart EST (AA348024) and the 5Ј RACE product The open reading frame