0
  1. Trang chủ >
  2. Y Tế - Sức Khỏe >
  3. Y học thưởng thức >

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học:

Báo cáo khoa học: "Question Answering as Question-Biased Term Extraction: A New Approach toward Multilingual QA" doc

... whether an answer is correct is doneby both automatic and manual evaluation. Auto-matic evaluation consists of exact matching and par-tial matching. Partial matching is useful for ab-sorbing ... Yiyuan Xia: Ques-tion Answering Using a Large Text Database: A Ma-chine Learning Approach: Proc. of EMNLP-2001, pp.67–73 (2001).Marisu A. Pasca and Sanda M. Harabagiu: High Perfor-mance ... New Approach toward Multilingual QAYutaka SasakiDepartment of Natural Language ProcessingATR Spoken Language Communication Research Laboratories 2-2 -2 Hikaridai, Seika-cho, Soraku-gun, Kyoto,...
  • 8
  • 357
  • 0
Báo cáo khoa học: Surface density of cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface ppt

Báo cáo khoa học: Surface density of cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface ppt

... component of the cell wall of plants and the most abundant polymer in nature. In addition to the cell wall of terrestrial plants, cellulose is found in marine algae, marine animals and bacteria, and it ... the sample has a larger surface area available to the cellu-lase, or whether the sample is indeed more susceptible to degradation. In the present study, we thereforeinvestigated a novel approach ... of the enzyme (A max), in order to obtain the specific activity of Cel 7A for crystal-line cellulose.This approach has several advantages: (1) A maxpro-vides a measure of the surface area of...
  • 10
  • 289
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Extracting Noun Phrases from Large-Scale Texts: A Hybrid Approach and Its Automatic Evaluation" pot

... Extracting Noun Phrases from Large-Scale Texts: A Hybrid Approach and Its Automatic Evaluation Kuang-hua Chen and Hsin-Hsi Chen Department of Computer Science and Information Engineering National ... on the grammatical relations. Both the syntactic head and the semantic head are useful in extracting noun phrases. For example, if the semantic head of a chunk is the noun and the syntactic ... head to each chunk. Then, we extract the plausible maximal noun phrases according to the information of syntactic head and semantic head, and a finite state mechanism with only 8 states....
  • 8
  • 359
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Statistical Decision-Tree Models for Parsing*" ppt

... limited lin- gnistic information, and comparing its performance to a state-of -the- art grammar-based parser on a common task. It remains to be shown that an accu- rate broad-coverage parser can ... Journal, and by the movement away from parsing-based approaches to text- processing in general. In this paper, I de- scribe SPATTER, a statistical parser based on decision- tree learning techniques ... vo- cabulary having a unique representation. The word feature can take on any value of any word. The tag feature can take on any value in the part-of-speech tag set. The label feature can...
  • 8
  • 389
  • 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... total and nonspecific binding [37]. To determine cell-associated (the sum of binding and internalization) and degraded125I-labeled HDL3-protein, the cells were incubated at 37 °C for 4 h as ... lipoprotein-associated cholesterol across the placenta from the maternal circulation [4–8]. The fact that the placenta binds and internalizes maternallipoproteins both in vivo and in vitro [8] ... Immunochemicaldetection of SR-BI and SR-BII (a splice variant of SR-BIlacking the C-terminal portion [29]) was performed with a sequence-specific rabbit anti-SR-BI-peptide (496–509) and anti-SR-BII...
  • 12
  • 470
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT ... GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA ... Helsinki, Finland). The growth rate was cal-culated as the ratio of the absorbance of the experimentalwell to that of a blank well, and the IC50 was also calculated.Hoechst stainCells in exponential...
  • 13
  • 563
  • 0
Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

... CD analysis, are in keepingwith the r eactive centre l oop of neuroserpin Portland beingpartially inserted into b-sheet A to adopt a conformationsimilar to an intermediate on the polymerization ... differences in the profiles of native wild-type and Ser52Arg neuroserpin (Fig. 5C). The profile for wild-type neuroserpin was comparable to that obtained for other serpins, including a 1-antitrypsin and ... columnwas replaced by Ni-nitrilotriacetate agarose. The result-ing p roteins w ere a ssessed by SDS, nondenaturing and transverse urea gradient PAGE, and activity was assessedagainst tPA [6].Complex...
  • 8
  • 495
  • 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

... B, Navarro-Delmasure C, Pham Huu Chanh A, Catala J & Hollande E (2000) Modifications in the TXA(2) and PGI(2) plasma levels and some other bio-chemical parameters during the initiation and ... and action in human platelets and HEL cells [22,64]. Taken together, these findings haveled to the proposal that clinically PPARc ligands mayattenuate the synthesis and action of TXA2 and, in turn, ... gene(Kin342; 5¢-dAGCTGGACCAGGACAAAGGTCACGTT-3¢.(g) AP-1 (Kin189; 5¢-dGGTGGTGACTGATCCCTCAGGGC-3¢; corresponding to nucleotides )32 to ) 10 of Prm3).(h) October 1 ⁄ 2 (Kin195; 5¢-dTAATCACAAGCAAATCTTCTCTC-3¢...
  • 20
  • 432
  • 0
Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot

Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot

... S.,Watanabe ,A. ,Iriguchi,M.,Ishikawa ,A. ,Kawashima,K.,Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M.,Takazawa, M., Yamada, M., Yasuda, M. & Tabata, ... °C. The intensityoftheRamanpeakofwaterwasusedasaninternal standard.Thermal-induced unfolding measured by circulardichroismThermal unfolding of NblA was carried out in 20 mMsodium phosphate ... simulations of the fitted data, using10 000 iterations for each dataset. From this, the 95%confidence intervals were obtained and are reported for the molecular mass and the association constant parameters.CD...
  • 8
  • 308
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP