Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Question Answering as Question-Biased Term Extraction: A New Approach toward Multilingual QA" doc

Báo cáo khoa học: "Question Answering as Question-Biased Term Extraction: A New Approach toward Multilingual QA" doc

... whether an answer is correct is done by both automatic and manual evaluation. Auto- matic evaluation consists of exact matching and par- tial matching. Partial matching is useful for ab- sorbing ... Yiyuan Xia: Ques- tion Answering Using a Large Text Database: A Ma- chine Learning Approach: Proc. of EMNLP-2001, pp. 67–73 (2001). Marisu A. Pasca and Sanda M. Harabagiu: High Perfo...

Ngày tải lên: 08/03/2014, 04:22

8 358 0
Báo cáo khoa học: Surface density of cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface ppt

Báo cáo khoa học: Surface density of cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface ppt

... component of the cell wall of plants and the most abundant polymer in nature. In addition to the cell wall of terrestrial plants, cellulose is found in marine algae, marine animals and bacteria, and it ... the sample has a larger surface area available to the cellu- lase, or whether the sample is indeed more susceptible to degradation. In the present study,...

Ngày tải lên: 23/03/2014, 10:21

10 289 0
Báo cáo khoa học: "Extracting Noun Phrases from Large-Scale Texts: A Hybrid Approach and Its Automatic Evaluation" pot

Báo cáo khoa học: "Extracting Noun Phrases from Large-Scale Texts: A Hybrid Approach and Its Automatic Evaluation" pot

... Extracting Noun Phrases from Large-Scale Texts: A Hybrid Approach and Its Automatic Evaluation Kuang-hua Chen and Hsin-Hsi Chen Department of Computer Science and Information Engineering National ... on the grammatical relations. Both the syntactic head and the semantic head are useful in extracting noun phrases. For example, if the semantic head of a chunk is...

Ngày tải lên: 31/03/2014, 06:20

8 359 0
Tài liệu Báo cáo khoa học: "Statistical Decision-Tree Models for Parsing*" ppt

Tài liệu Báo cáo khoa học: "Statistical Decision-Tree Models for Parsing*" ppt

... limited lin- gnistic information, and comparing its performance to a state-of -the- art grammar-based parser on a common task. It remains to be shown that an accu- rate broad-coverage parser can ... Journal, and by the movement away from parsing-based approaches to text- processing in general. In this paper, I de- scribe SPATTER, a statistical parser based on de...

Ngày tải lên: 20/02/2014, 22:20

8 389 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... total and nonspecific binding [37]. To determine cell-associated (the sum of binding and internalization) and degraded 125 I-labeled HDL 3 -protein, the cells were incubated at 37 °C for 4 h as ... lipoprotein-associated cholesterol across the placenta from the maternal circulation [4–8]. The fact that the placenta binds and internalizes maternal lipoproteins both in v...

Ngày tải lên: 20/02/2014, 23:20

12 470 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173 CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT ... GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC...

Ngày tải lên: 06/03/2014, 22:21

13 563 0
Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

... CD analysis, are in keeping with the r eactive centre l oop of neuroserpin Portland being partially inserted into b-sheet A to adopt a conformation similar to an intermediate on the polymerization ... differences in the profiles of native wild-type and Ser52Arg neuroserpin (Fig. 5C). The profile for wild- type neuroserpin was comparable to that obtained for other ser...

Ngày tải lên: 07/03/2014, 16:20

8 495 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

... B, Navarro-Delmasure C, Pham Huu Chanh A, Catala J & Hollande E (2000) Modifications in the TXA(2) and PGI(2) plasma levels and some other bio- chemical parameters during the initiation and ... and action in human platelets and HEL cells [22,64]. Taken together, these findings have led to the proposal that clinically PPARc ligands may attenuate the synthesis and a...

Ngày tải lên: 07/03/2014, 21:20

20 432 0
Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot

Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot

... S., Watanabe ,A. ,Iriguchi,M.,Ishikawa ,A. ,Kawashima,K., Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M. & Tabata, ... °C. The intensityoftheRamanpeakofwaterwasusedasan internal standard. Thermal-induced unfolding measured by circular dichroism Thermal unfolding of NblA was car...

Ngày tải lên: 08/03/2014, 10:20

8 309 0
w