Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... the draft. JG made substantial contributions to thedata analysis. GB was substantially involved in the analysis,interpretation and drafting the manuscript.AcknowledgementsTo the Medical Statistics ... Open AccessAvailable online http://ccforum.com/content/9/5/R516R516Vol 9 No 5ResearchMedication errors: a prospective cohort study of hand-written and computerised...

Ngày tải lên: 25/10/2012, 10:39

... protein and increase its DNA-binding and transactivating func- tions. The SAF-1 DNA-binding and transcriptional activity is significantly increased in response to media- tors of signal transduction ... cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 172 CAACAAAGgtacatgc 1335 ctg...

Ngày tải lên: 07/03/2014, 02:20

... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame present in the plasmid in ... (S1278b) the kanMX cassette from plasmid pUG6 [12] was amplified by polymerase chain reaction (PCR) us...

Ngày tải lên: 07/03/2014, 15:20

... major group of pro- teins present at the PSD and two of them are LC8 binding partners. Gephyrin is critical for glycine- and GABA-receptor clustering and also interacts with many other proteins, including ... excitatory synapses. Only the DYNLL2 paralog was identified as an interactor of GKAP in vivo, and it was suggested that this interaction is involved in recruiting nN...

Ngày tải lên: 14/03/2014, 22:20

... Hideyuki Matsuda and Makoto Kawamukai Department of Applied Bioscience and Biotechnology, Faculty of Life and Environmental Science, Shimane University, Matsue, Japan The analysis of the structure and ... example, S. cerevisiae has ubiquinone-6, E. coli has ubiquinone-8, rats and Arabidopsis thaliana have ubiquinone-9, and humans and S. pombe have ubiquinone-10. The...

Ngày tải lên: 23/03/2014, 21:20

... paradigmatic mappings in the graphemic domain, and pairs them statistically with their corre- late(s) in the phonemic domain. These mappings are used to search and retrieve in the lexical ... records the changes in the phone- mic domain when the Mternation applies in the graphemic domain. At the end of the learning stage, we have in hand a set A...

Ngày tải lên: 31/03/2014, 21:20

... transcription of genes involved in hepatic, renal, and intestinal detoxification and genes of the innate and adaptive immune system. REV-ERBalpha, a nuclear orphan receptor acts as a strong transcriptional ... IKKb, as a way to inhibit activation of most NF-jB forms. While in ammation is a major factor that contributes to the development and progression of CAC a...

Ngày tải lên: 19/02/2014, 07:20

... sampra (sampras), 6, champion, steffi, verteidigt (defendending), martina, jovotna, navratilova GERMAN '01: TOPIC 91 ES AI in Lateinamerika La gripe aviar en América Latina AI in Latin ... language L 1 , the query is automatically translated into the assisting language L 2 and PRF performed in the assisting language. The resultant terms are translated back into L 1 u...

Ngày tải lên: 20/02/2014, 04:20

... would be the case with a thesaurus of a realistic size, proves to be much more challenging. For ex- ample, Alfonseca and Manandhar (2002) attain the learning accuracy' of 38% when assigning ... the original class of a test noun was tested. Their performance was evaluated in terms of precision and in terms of learning accu- racy (Hahn and Schattinger, 1998)...

Ngày tải lên: 08/03/2014, 21:20

... Smac/DIABLO promotes the activation of caspases, such as procaspase-9 and caspase-3, by binding to the inhibitor of apoptosis proteins and thus disrupts linkage of the caspase–inhibitor of apoptosis proteins ... forward, 5¢-CGGAATTCGGAGGGGACCCCAAGTGCAT-3¢; DR4 reverse, 5¢-CGGGATCCTCACTCCAAGGACA CGGCA-3¢;DR5forward,5¢-CGGAATTCTGCA AGTCTTTACTGTGGAA-3¢; DR5 reverse, 5¢-CGGA TCC...

Ngày tải lên: 23/03/2014, 17:22