unit1: A visit from a pen pal
A visit from a pen pal
... www.videobook.vn UNIT 1: A VISIT FROM A PEN PAL (Chuyến viếng thăm c a một người bạn qua thư) 1. Vocabulary pen pal (n): bạn qua thư (ch a gặp mặt) to correspond (v) (with sb): trao đổi thư từ Ex: ... yard is separated from the factory by a tall fence. (Sân nhà họ được ngăn cách với nhà máy bằng một hàng rào cao.) -» separate (adj): riêng biệt; khác nhau —» separation (n...
Ngày tải lên: 17/01/2013, 09:58
Unit 1: A visit from a pen pal
... Period: 06 Date of teaching: September 20 th , 2006 UNIT 1 : A VISIT FROM A PEN PAL LESSON 6 : LANGUAGE FOCUS I. Objectives : _ Practice in past simple and past simple with wish _ ... students will be able to use past simple, and past simple with wish II. Language contents: 1. Grammar : 2. Vocabulary : III. Techniques : Eliciting questions, asks and answers IV. Teaching aids : Tex...
Ngày tải lên: 21/06/2013, 01:27
Unit 1: A visit from a pen pal
... Call some students go to the board and write down. + Lan’s Malaysian pen pal came to visit her in Hanoi . Can you guess where she went and what she did during her stay ? + Ask students to read ... Date of teaching : September 13 th , 2007 UNIT 1 : A VISIT FROM A PEN PAL LESSON 1 : GETTING STARTED & LISTEN AND READ LANGUAGE FOCUS 3 I. Objectives : _ To introduce the topic...
Ngày tải lên: 21/06/2013, 01:27
Unit 1_ A visit from a penpal
... Compulsory second language Unit 1: a visit from a pen pal Imagine a foreign pen pal is coming to stay with you for a week, what activities are you planning for him/her during the visit? 1. to______________________( ... the places they visited. Answer these Qs. Created by TTM_titiempi Malaysia Viet Nam Area Population Capital city Climate Unit of currency Official relig...
Ngày tải lên: 26/06/2013, 01:27
unit 1: A visit from a penpal- t3,t4
... Tim and Carol are and that they are doing. - Listening and choosing the correct answers. - Comparing their answers with the partner’s. * key: a- 1 b-2 c-2 where Tim and Carol are and that they are ... map? 2. Which city is the capital of Vietnam? 3. How many regions are there in Vietnam? 2- While- reading - T introduce a the passage by showing the map and the picture about Malaysia. - T as...
Ngày tải lên: 16/09/2013, 13:10
Gián án Visit from a pen pal
... VISIT FROM A PEN PAL Lesson 2 Speak (Page 6-7) I. Objectives : By the end of the lesson, Ss will be able to make and respond to introduction as well as know how to scan for specific information ... 4 d 2 e 3 a 6 - Controlled Practice Substitution Drill - Production Personalization - T introduces 2 characters Maryam and Nga, they are waiting for outside the school, they are talk...
Ngày tải lên: 29/11/2013, 15:12
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... cttgtacacaccgcccgtc Primer and Probe Sequence (5’-3’) Reference MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc ... algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura. Environ.Tech., 14, 433-442. Park H.-D., Iwami C., Watanabe M. F., Harada K.-I., Okino T. and Hayashi H. (1998). Temporal variabili...
Ngày tải lên: 05/09/2013, 10:15
MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT pdf
... disinflationary programmes led agents to form their expectations based on timely data such as changes in interest rates and the exchange rate. Additionally, the Central Bank’s actions allowing a ... exchange rate and interest rate which are available at a high frequency and set in their anticipation of future inflation. In the framework of the model, inflationary expectations are as...
Ngày tải lên: 06/03/2014, 14:20