Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system

Ngày tải lên: 05/09/2013, 17:03

... article we outline a basic approach to treating metonymy properly in a multil- ingual machine translation system. This is the first attempt at treating metonymy in an machine translation environment. ... METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM Shin-ichiro Kamei* & Takahiro Wakao Computing Research Laborato...

Ngày tải lên: 23/03/2014, 20:20

... (Fig. 3A) . We also analyzed the spatial distribution of ammonia- and nitrite-oxidizing bacteria and the microprofiles of NH 4 + , NO 2 - , and NO 3 - in an autotrophic nitrifying biofilm that was initially ... stages of biofilm development, rather than an optimal adaptation to the actual microenvironments. Micro-scale Spatial Organization of Nitrifying Bacteria Although the bio...

Ngày tải lên: 05/09/2013, 08:40

Ngày tải lên: 07/09/2013, 12:58

... “morphemes are the minimal meaningful units which may constitute words or parts of words”. A morpheme may be defined as the minimal linguistics sign, a grammatical unit that is an arbitrary union of ... volcano on La Palma in the Canary Island would cause a tsunami – an enormous wave. The volcano is by the sea. If the volcano collapsed, 500 billion tones of rock would fall i...

Ngày tải lên: 14/12/2013, 16:45

... WSPC/B351 intro.tex x Ivan E. Brick & Tavy Ronen have appeared in The American Economic Review, The International Journal of Finance, The Journal of Banking and Finance, The Journal of Finance, The ... Journal of Financial Economics, The Journal of Financial & Quantitative Analysis, The Journal of Industrial Economics, The Journal of Money, Credit & Banking, The J...

Ngày tải lên: 19/02/2014, 13:20

... Eda K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous-pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc Natl Acad Sci USA 98, 5538–5543. 20 Kagawa ... Experimental procedures DNA A 74-mer ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular s...

Ngày tải lên: 06/03/2014, 09:22

... the change in the independent variable on the change in the pollutant. A positive coefficient means that an increase in the rate of change of per capita GDP results in a similar increase in the ... the contrary, China, India and Thailand actually have industrial activities of a similar magnitude to developed countries such as Hong Kong, Japan, Singapore and Korea. Th...

Ngày tải lên: 06/03/2014, 16:20

... The Authors Journal compilation ª 2009 FEBS 3617 Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast Martin A. M. Reijns*, Tatsiana Auchynnikava and ... C-terminal domain mutations. (B) Lsm8p N-terminal domain muta- tions and recombinant Lsm1p containing the Lsm8p N-terminal 10 amino acids. (C) Sm domain replacements; see Fig 2A for a...

Ngày tải lên: 07/03/2014, 02:20

...   1 2 21 22 11 21(1)(1)(12)11 1 2 8 2(1)(1)1 aaaaa aa aaaaaa aa GG GG E GG EG GG xcccxcxxc n xcxxccxx                                   21 1 211 aa aaaa a G G cnnx nn xcxxc    ;   12 11 11 aa a aa a G G GG G G xx xx    ; ... After determining ( KG, ) or ( ν,E ) for effective matrix, th...

Ngày tải lên: 14/03/2014, 13:20