Whole Genome Sequencing

Báo cáo y học: "Analysis of genetic systems using experimental evolution and whole-genome sequencing" docx

Báo cáo y học: "Analysis of genetic systems using experimental evolution and whole-genome sequencing" docx

... al.: Analysis of one million base pairs of Neanderthal DNA Nature 2006, 444:330-336 51 Kellis M, Birren BW, Lander ES: Proof and evolutionary analysis of ancient genome duplication in the yeast ... phenotypes produced by seemingly dissimilar genetic changes, functional connections within and between genetic modules [28-29] can now be revealed by experimental evolution couple...

Ngày tải lên: 14/08/2014, 17:22

5 222 0
Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

... with type II alleles, enabled detection of local allelic variants and preliminary genotype-phenotype associations This is the first whole genome sequencing of a recombinant T gondii strain and ... the quality of information generated and availability of the putative parental strains to this natural recombinant provide an excellent basis for a better underst...

Ngày tải lên: 14/08/2014, 21:20

17 324 0
Báo cáo y học: "Whole genome sequencing of a single Bos taurus animal for single nucleotide polymorphism discovery" potx

Báo cáo y học: "Whole genome sequencing of a single Bos taurus animal for single nucleotide polymorphism discovery" potx

... These artifacts include cases where all sequenced variant alleles at a given position are only indicated by reads from one strand and have a lower than average base quality at the variant position ... calculated by the ELAND alignment software [9] To account for the varying read quality, we trimmed the ends of reads when necessary to a minimum of 32 bases Read mapping, subsequent...

Ngày tải lên: 14/08/2014, 21:21

8 241 0
Whole Genome Sequencing

Whole Genome Sequencing

... abnormalities can be discovered 4/6 Whole- Genome Sequencing using microarrays, whereas whole- genome sequencing can provide information about all six billion base pairs in the human genome Although the study ... 5/6 Whole- Genome Sequencing uses only deoxynucleotides uses labeled dNTPs A Whole- genome sequencing can be used for advances in: the medical field agriculture...

Ngày tải lên: 31/10/2017, 01:10

6 96 0
Báo cáo y học: "eening the human exome: a comparison of whole genome and whole transcriptome sequencing" pot

Báo cáo y học: "eening the human exome: a comparison of whole genome and whole transcriptome sequencing" pot

... reached a plateau of between 0.6 and 0.75 at greater than 10 reads, far earlier than the 50 reads needed for specificity stability in the eight lane dataset The specificity also decayed at a much ... protocol: randomly fragment the DNA by nebulization, end repair, add a single A base, adaptor ligation, run a gel to isolate 300-bp fragments, and PCR amplification The...

Ngày tải lên: 09/08/2014, 20:22

8 299 0
A phylogenomic study of the genus Alphavirus employing whole genome comparison ppsx

A phylogenomic study of the genus Alphavirus employing whole genome comparison ppsx

... cho thấy hai nhánh Salmon Pancreatic Disease Virus Sleeping Disease Virus nhánh có chung thủy tổ thủy tố chúng lồi alphavirus q khứ phân ly khỏi nhóm alphavirus cách thành cơng Hơn n a, kết nghiên ... xa so với lồi khác nhóm Alphavirus Điều thú vị cuối báo tác giả nhận thấy toàn genome Rubella đóng vai trò nhóm ngoại (nhóm đối chứng) lý tưởng cho việc nghiên cứu phát sinh chủng lồi nh...

Ngày tải lên: 02/07/2014, 11:21

5 153 0
Báo cáo y học: " Genome-wide comparative analysis of the Brassica rapa gene space reveals genome shrinkage and differential loss of duplicated genes after whole genome triplicatio" potx

Báo cáo y học: " Genome-wide comparative analysis of the Brassica rapa gene space reveals genome shrinkage and differential loss of duplicated genes after whole genome triplicatio" potx

... and Bna genomes but absence of this peak in the Br genome and between the other Brassica genomes strongly supports the hypothesis that duplicated genes from the 3R event were lost in the Br genome ... tions Further genome sequencing will help resolve the synteny in the uncovered and/ or the scattered genome regions Rearrangement of the B rapa genome...

Ngày tải lên: 09/08/2014, 20:20

18 487 0
Báo cáo y học: "Whole-genome resequencing of Escherichia coli K-12 MG1655 undergoing short-term laboratory evolution in lactate minimal media reveals flexible selection of adaptive mutation" pptx

Báo cáo y học: "Whole-genome resequencing of Escherichia coli K-12 MG1655 undergoing short-term laboratory evolution in lactate minimal media reveals flexible selection of adaptive mutation" pptx

... previously reported the sequencing of E coli following short-term (approximately 40 days) adaptive evolution in glycerol minimal media to obtain its computationally predicted phenotype [10] The ... media E coli K-12 MG1655 that has undergone adaptation in lactate M9 minimal media shows fitness gains of a magnitude similar to those observed in glycerol M9 m...

Ngày tải lên: 09/08/2014, 20:20

12 293 0
Báo cáo y học: "Mutation discovery in mice by whole exome sequencing" potx

Báo cáo y học: "Mutation discovery in mice by whole exome sequencing" potx

... Trembath R, Jeffery S: Rapid identification of mutations in GJC2 in primary lymphoedema using whole exome sequencing combined with linkage analysis with delineation of the phenotype J Med Genet ... exome sequencing provides sufficient coverage of flanking intron sequence to positively identify potentially damaging, noncoding mutations in the intron sequences immediately flanking t...

Ngày tải lên: 09/08/2014, 23:20

12 313 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... troglodytes Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TC...

Ngày tải lên: 09/08/2014, 23:20

36 447 0
báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx

báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx

... mode of transmission, we evaluated each SNP for association with intrauterine and intrapartum transmission Intrauterine transmission was estimated by infant HIV status at birth Intrapartum transmission ... original institutional review board approval was obtained to ensure the approval of large-scale genotyping of SNPs across the genome Power analysis Power was calculated b...

Ngày tải lên: 11/08/2014, 12:20

11 294 0
Báo cáo y học: "Comparative whole genome sequence analysis of wild-type and cidofovir-resistant monkeypoxvirus" doc

Báo cáo y học: "Comparative whole genome sequence analysis of wild-type and cidofovir-resistant monkeypoxvirus" doc

... identification and whole genome sequence comparisons of CDV-R and WT Zaire 79-005 The genome of the seed stock used in the analysis (WT Zaire 79-005) was sequenced and compared with the genome of the ... 10.1186/1743-422X-7-110 Cite this article as: Farlow et al., Comparative whole genome sequence analysis of wild-type and cidofovir-resistant monkeypoxv...

Ngày tải lên: 12/08/2014, 04:20

15 317 0
Báo cáo y học: "Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle" pptx

Báo cáo y học: "Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle" pptx

... et al R134.5 Figure microarray mRNA Examples ofanalysis decay profiles for each stage determined by Examples of mRNA decay profiles for each stage determined by microarray analysis Four example ... Decay rates in the early hours after invasion are rapid and tightly distributed, but by the end of the cycle global decay rates decrease considerably, causing a lengt...

Ngày tải lên: 14/08/2014, 07:22

12 324 0
Báo cáo sinh học: "Results of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercross" potx

Báo cáo sinh học: "Results of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercross" potx

... availability and family structure, we selected a set of 528 F2 individuals to perform a whole genome scan in search for QTL affecting growth and carcass characteristics These F2 individuals are ... Piétrain boars were mated to 20 Large Whole genome QTL scan in a Piétrain × Large White F2 population 373 White sows to generate an F1 generati...

Ngày tải lên: 14/08/2014, 13:21

17 260 0
w