Endocrine Regulation of Kidney Function

... from 2/5 Endocrine Regulation of Kidney Function this family of hormones is atrial natriuretic hormone (ANH), a 28-amino acid peptide produced by heart atria in response to over-stretching of the ... Ca++ levels are permitted Major Hormones That Influence GFR and RFB 3/5 Endocrine Regulation of Kidney Function Chapter Review Endocrine hormones act from a distance and...

Ngày tải lên: 31/10/2017, 00:04

... issue are warranted Competing interests The author(s) declare that they have no competing interests References 532 Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin C as a ... filtration rate in renal transplant recipients Clin Chem 1999, 49:1866-1868 Coll E, Botey A, Alvarez L, Poch E, Quintó LI, Taurina A, Vera M, Piera C, Darnell A: Serum cystatin C as...

Ngày tải lên: 12/08/2014, 22:21

... comparisons of cardiac autonomic output in supine and prone postures, or in prone and sitting postures Although commonly assumed by patients undergoing manual therapy, effects of these postures on autonomic ... measures in supine and standing positions Clin Sci 2004, 106(1):61-66 Toyry J, Mantysaari M, Hartikainen J, Lansimies E: Day-to-day variability of cardiac autonomi...

Ngày tải lên: 13/08/2014, 14:20

... Thus, integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... Osmosensing and signaling in mammalian cell function F Schliess et al [7] On the other hand, hyperosmotic shrinkage prevents insulin-induced hepatocyte swelling...

Ngày tải lên: 18/02/2014, 16:20

... C-terminus Kinase domain and C-terminus SH3 domain and C-terminus SH2 domain and C-terminus SH3, SH2 domain and C-terminus N-terminal, SH3, SH2 domain and C-terminus N-terminal, SH3, SH2, kinase ... application of SH2 domain binding peptides, which results in blocking of the binding of the SH2 domain to the substrate and thereby preventing interac...

Ngày tải lên: 06/03/2014, 01:20

... in protein protein interaction are blue and the dehydrogenase domains of Tic3 2 and Tic6 2 are shown in green Tic1 10 contains two transmembrane domains at the proximal N-terminus The topology of ... surprising to find proteins with redox-active domains as Tic constituents Up to now, the ‘regulon’ of the Tic complex comprises three proteins: Tic6 2, Tic3 2...

Ngày tải lên: 07/03/2014, 03:20

... distribution of FEBS Journal 278 (2011) 319 0–3 203 ª 2011 The Authors Journal compilation ª 2011 FEBS 3193 Function and regulation of ABCA1 K Nagao et al Table Effects of mutations on the functions of ABCA1 ... re-secreted The internalized ABCA1 and apoA-I were reported to co-localize within late endosomes, and ABCA1 rapidly 3194 Fig Membrane meso-domain orga...

Ngày tải lên: 22/03/2014, 15:21

... Hospital using the serum level of cystatin C, and estimated GFR using Filler’s cystatin C-based formula Methods Page of During the study time frame, 71 antiretroviral-naïve HIV-infected children ... affect serum cystatin C levels Kidney Int 2009, 75:652-660 doi:10.1186/1758-2652-13-17 Cite this article as: Esezobor et al.: Kidney function of HIV-infected c...

Ngày tải lên: 20/06/2014, 08:20

... contain a large majority of the known genes and a bunch of predicted genes, many of which were detectable on the arrays,” says Hughes “The collection contains about 75% of the current RefSeq sequences, ... preliminary functional annotation for thousands of genes of unknown function is a major advance.” The Hogenesch group is also creating an atlas of mammalian genes [5] “...

Ngày tải lên: 06/08/2014, 18:21

... Primers and probes 11 β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: A...

Ngày tải lên: 09/08/2014, 08:22

... article as: Schuler et al.: Transcriptome analysis by GeneTrail revealed regulation of functional categories in response to alterations of iron homeostasis in Arabidopsis thaliana BMC Plant Biology ... incorporated into the GSEA tool of GeneTrail as individually defined categories Contrary to the GeneTrail- predefined categories the genes of MapM...

Ngày tải lên: 11/08/2014, 11:20

... bleomycin: selective deficiency of surfactant proteins B and C Am J Physiol Lung Cell Mol Physiol 2001, 281:L685-L696 Emery JL, Mithal A: The number of alveoli in the terminal respiratory unit of ... either saline or Dex SQ daily on days 1–14 followed by either IP CSO or RA daily on days 24–36: (1) Early Saline + Later CSO; (2) Early Saline + Later RA; (3) Early Dex + Later CSO; (4) Lat...

Ngày tải lên: 12/08/2014, 16:20

... production, and certainly involve the activation of other components downstream of the receptor, while the β2-AR may perform functions other than adenylyl cyclase activation [28], yet equally involved in ... adenylyl cyclase was not directly affected by LTD4 Relaxant responses to salbutamol in human bronchial rings The mean weight of the 24 bronchial rings was 91 ± mg The...

Ngày tải lên: 12/08/2014, 16:20

... resuscitation but without evidence of intrinsic kidney disease The aim was to investigate the single and combined haemodynamic and renal effects of plasma expansion by infusion of albumin and of the ... investigating the effects of plasma expansion on haemodynamics in patients with cirrhosis One actually reported an increase in SVRI after plasma expa...

Ngày tải lên: 13/08/2014, 08:21

Ngày tải lên: 14/11/2014, 06:05