A novel method for the preparation of silver/chitosan-O-meth

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...

Ngày tải lên : 05/05/2014, 15:26

8
634
0

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...

Ngày tải lên : 06/05/2014, 08:55

12
705
0

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approve...

Ngày tải lên : 20/06/2014, 04:20

4
403
0

Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

... of IP-10 in RA synovitis, because most of the leukocytes infiltrating the SF of rheumatoid joints are PMNs PMNs in the RA SF are in an activated state, and produce a variety of other inflammatory ... a potent angiogenic factor, namely vascular endothelial growth factor, was markedly induced by the interaction of FLS with synovial leukocytes via the integrin/ICA...

Ngày tải lên : 09/08/2014, 01:21

8
446
0

A novel algorithm for the reconstruction of an entrance beam fluence from treatment exit patient portal dosimetry images

... permission of the author An Abstract of A Novel Algorithm for the Reconstruction of an Entrance Beam Fluence from Treatment Exit Patient Portal Dosimetry Images by Nicholas N Sperling Submitted to the ... A Dissertation entitled A Novel Algorithm for the Reconstruction of an Entrance Beam Fluence from Treatment Exit...

Ngày tải lên : 29/10/2016, 15:54

245
577
0

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... Primer location Ampliﬁed band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...

Ngày tải lên : 23/03/2014, 13:20

11
475
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients ... A method for the early evaluation of the Ponseti (Iowa) technique for the treatment of idiopathic clubfoot J Pediatr Orthop 2003, 12(...

Ngày tải lên : 20/06/2014, 04:20

7
531
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients ... A method for the early evaluation of the Ponseti (Iowa) technique for the treatment of idiopathic clubfoot J Pediatr Orthop 2003, 12(...

Ngày tải lên : 20/06/2014, 07:20

7
802
0

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên : 21/06/2014, 01:20

9
469
0

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

... to study partial diﬀerence equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear diﬀerence equation under consideration In the case of...

Ngày tải lên : 23/06/2014, 00:20

12
257
0

Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

... et al.: A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Annals of General Psychiatry 2011 10:19 Competing interests The authors ... been developed The aims of the current study were to develop a novel and detailed standardized method of administration and scoring of...

Ngày tải lên : 09/08/2014, 01:21

10
474
0

Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

... Incubation Freshly cut blocks (about mm in width) of the phloem tissue were incubated in 0.05 M phosphate buffer (pH 7.4, 5°C) for 1-2 before staining for 30 at 37°C in a newly prepared ... characteristic of laccase and is the main criterion according to which the enzyme is classified (Mayer and Harel, 1979) Reaction (2) is one of the significant features of lacca...

Ngày tải lên : 09/08/2014, 03:24

4
355
0

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

... of all miR loci in the Ciona genome Altogether, miRTRAP generated an apparent false negative rate of approximately 5% and a false discovery rate of approximately 19% To systematically compare ... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nis...

Ngày tải lên : 09/08/2014, 20:21

12
552
0

báo cáo khoa học: "Detection of DNA mismatch repair proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening" doc

... ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair Nucleic Acids Research 1998, 26:117 3-1 178 Yamasaki Y, Matsushima M, Tanaka H, Tajiri S, Fukuda R, Ozawa ... proof of principle for this assay, we analyzed fresh blood samples from a population of individuals who are at high risk for having a germline MMR m...

Ngày tải lên : 10/08/2014, 10:21

7
334
0

báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

... Conclusion Sinus lifting before Le Fort I maxillary osteotomy is a particularly suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions and minor degree ... methodological approach of treating a patient with severe mandibular and posterior maxillary alveolar atrophy and skelettal class-III condi...

Ngày tải lên : 11/08/2014, 23:22

7
375
0

A novel method for the preparation of silver/chitosan-O-methoxy polyethylene glycol core shell nanoparticles

a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of cao nanoparticle