Theory and practice in twentieth–century Vietnamese kí: studies in the history and politics of a literary genre (LV thạc sĩ)

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... C An et al Manduca sexta Spatzle ¨ Introduction A prominent feature of the innate immune systems of insects is the activation of serine proteinase cascade pathways in hemolymph, which function ... gene In the clade including Spatzle- 1, the branch lengths are noticeably longer and ¨ the bootstrap values are lower than in the other clades containing...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTT...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... 2002 Aromatic stacking in API (Eur J Biochem 269) 4153 Fig Stick models of the reactive site in bovine trypsin and API The catalytic triad residues of trypsin and API are Ser195–His57– Asp102 and ... because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases, the replacement of this aspar...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

... authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written ... resonance imaging scan with fat saturation and gadolinium enhancement The cortical mass is seen as a low signal with an enhancing rim (arrows) Figure (arrow) to shows...

Ngày tải lên: 11/08/2014, 21:22

3 306 0
Báo cáo y học: " Leadership is the essential non-technical skill in the trauma team - results of a qualitative study" pps

Báo cáo y học: " Leadership is the essential non-technical skill in the trauma team - results of a qualitative study" pps

... Marini A, Zoia R, Rodriguez A, Scalea T, Milan Trauma Care Study Group: Trauma deaths in an Italian urban area: an audit of pre-hospital and in- hospital trauma care Injury 2002, 33:55 3-5 62 Chua ... arrest team [19] Validity and Transferability The initial aim of our study was to unveil which non-technical skills trauma team members considered important in the...

Ngày tải lên: 13/08/2014, 23:20

9 289 0
Tributary and canonization the research on VietSino relationship from 1802 1885 (LV thạc sĩ)

Tributary and canonization the research on VietSino relationship from 1802 1885 (LV thạc sĩ)

... dynasty and Qing dynasty take a major part Unfortunately, there is no research focus on the tributary and canonization of diplomatic relations between China and Vietnam from the year 1802 to 1885 ... enhancing their relationships in economy, politics, culture and other fields With the continuing expansion of foreign relations , the strategic thinking of diplomat...

Ngày tải lên: 11/09/2017, 15:40

136 531 0
Writing Theory and Practice in the Second Language Classroom: A Selected Annotated Bibliography potx

Writing Theory and Practice in the Second Language Classroom: A Selected Annotated Bibliography potx

... language research in this area is just beginning However, initial research suggests a correlation between reading and writing ability in second language learning and the transfer of reading /writing ... towards audiolingualism, oral language took precedence in the classroom over all Writing Theory and Practice in the Second Language Classroom other m...

Ngày tải lên: 24/03/2014, 19:20

42 757 1
báo cáo khoa học: " Prevalence and consequences of patient safety incidents in general practice in the Netherlands: a retrospective medical record review study" potx

báo cáo khoa học: " Prevalence and consequences of patient safety incidents in general practice in the Netherlands: a retrospective medical record review study" potx

... and setting Practice type A retrospective medical record review study of 1,000 patients was undertaken to investigate the prevalence of patient safety incidents in general practice in the Netherlands ... reporting of patient safety incidents by healthcare professionals may be more appropriate for attaining a more in- depth understanding of p...

Ngày tải lên: 10/08/2014, 10:23

7 310 1
Advances in Theory and Applications of Stereo Vision Part 1 docx

Advances in Theory and Applications of Stereo Vision Part 1 docx

... i.e the incorrectly matched points usually due to errors in feature detection and/ or in matching Finally the evolution of the 2 Stereo Vision Advances in Theory and Applications of Stereo Vision ... The robustness 10 10 Stereo Vision Advances in Theory and Applications of Stereo Vision Fig Performance as a function of noise against the prese...

Ngày tải lên: 10/08/2014, 21:22

25 387 0
w