Optimal sizing of grid PV hybrid system for ethio telecom access layer devices and its economic feasibility
Effect of red blood cell aggregation on arteriolar cell free layer formation and its physiological functions
... Effect of aggregation and flow reduction on mean and SD of cell- free layer widths 60 (d) Effect of aggregation and flow reduction on dynamics of cell- free layer formation ... EFFECT OF RED BLOOD CELL AGGREGATION ON ARTERIOLAR CELL- FREE LAYER FORMATION AND ITS PHYSIOLOGICAL FUNCTIONS ONG PENG KAI (B.Eng.(Hons.),NUS) A THES...
Ngày tải lên: 10/09/2015, 15:52
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Optimization of an Escherichia coli system for cell-free synthesis of selectively 15N-labelled proteins for rapid analysis by NMR spectroscopy pdf
... synthesis enhanced by T7 RNA polymerase Prior to the preparation of 15N-labelled samples of hCypA and analysis by NMR spectroscopy, the performance of the cell-free expression system was explored ... 2004 Cell-free synthesis of 15 N-labelled proteins (Eur J Biochem 271) 4087 Optimization of other conditions for in vitro protein synthesis Fig Cell-free...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 201...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo hóa học: " Research Article A New Hybrid Algorithm for Variational Inclusions, Generalized Equilibrium Problems, and a Finite Family of Quasi-Nonexpansive Mappings" pptx
... Journal of Mathematical Analysis and Applications, vol 279, no 2, pp 372– 379, 2003 G Bigi, M Castellani, and G Kassay, A dual view of equilibrium problems, Journal of Mathematical Analysis and ... Theory and Applications 32 W Nilsrakoo and S Saejung, “Strong convergence theorems for a countable family of quasiLipschitzian mappings and its applications,” Journal...
Ngày tải lên: 22/06/2014, 11:20
Báo cáo hóa học: " Research Article Optimal Design of Uniform Rectangular Antenna Arrays for Strong Line-of-Sight MIMO Channels" pdf
... geometrical model introduced for the uniform rectangular array (URA), which also incorporates the uniform linear array (ULA), we have investigated the optimal design for line -of- sight (LOS) channels ... include an analysis of the influence of nonoptimal design, and analytical expressions for the singular values of the LOS matrix are derived as a function of the quali...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo toán học: "The solution of the Ar T-system for arbitrary boundary" potx
... from the right (for the other choice of diagonal in the i-th tetrahedron from the bottom), and of what the three arguments of the H or V factors are (via the boundary values at the vertices of the ... weights that are Laurent monomials of the initial data This completes the proof of the Laurent positivity of the solutions of the Ar T -system for...
Ngày tải lên: 08/08/2014, 12:22
Development of a liposomal nanodelivery system for nevirapine ppsx
... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... 12 mice housed individually in standard breeding cages Electronic system for the recording of locomotor activity The locomotor activity of the animal is recorded automatically by means of microwave ... parameters of locomotor activity Conclusion The aim of this study was to develop an apparatus consisting of a battery of radar sensors to allow th...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Reliability of the TekScan MatScan® system for the measurement of plantar forces and pressures during barefoot level walking in healthy adults" potx
... to determine the reliability of the TekScan MatScan® system in assessing plantar forces and pressures during level barefoot walking using a test-retest analysis of thirty healthy asymptomatic ... instrument for assessing plantar forces and pressures during barefoot level walking in healthy participants taken one week apart The system...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: " Comparative efficacy of the Cognitive Behavioral Analysis System of Psychotherapy versus Supportive Psychotherapy for early onset chronic depression: design and rationale of a multisite randomized controlled trial" ppt
... Behavioral Analysis System of Psychotherapy versus Supportive Psychotherapy for early onset chronic depression: design and rationale of a multisite randomized controlled trial BMC Psychiatry 2011 11:134 ... K: The efficacy of imipramine and psychotherapy in early- onset chronic depression: a reanalysis of the National Institute...
Ngày tải lên: 11/08/2014, 15:22
Development of inorganic organic hybrid materials for waste water treatment
... Heavy metals in waste water 1.1.3 1.1 Organic pollutants in waste water 10 10 1.2.2 1.3 Water treatment 1.2.1 Removal of Cr(VI) from waste water 1.2 12 Removal of dyes from waste water Adsorption ... future for inorganic- organic hybrid materials on water treatment XVI PAGE LIST OF TABLES Table 1.1 Heavy metals in some major industries Table 1.2 Uses...
Ngày tải lên: 09/09/2015, 08:18
A baculovirus cre 1oxp hybrid system for AAVS1 locus directed transgene delivery
... through a myosin phosphatase activity [47] Studies have revealed that the AAVS1 also serves as a specific integration site for AAV serotype (AAV2), a human parvovirus that contains a single-stranded ... A Baculovirus- Cre/ loxP Hybrid System for AAVS1 LocusDirected Transgene Delivery Chrishan J A Ramachandra (B.Sc (Hons.), Queen Mary, University of London) A Th...
Ngày tải lên: 09/09/2015, 18:56
Development of liquid crystal based system for biomolecule and nanomaterial characterization
... DEVELOPMENT OF LIQUID CRYSTAL- BASED SYSTEM FOR BIOMOLECULE AND NANOMATERIAL CHARACTERIZATION DENY HARTONO (BEng, Institut Teknologi Bandung, Indonesia) A THESIS SUBMITTED FOR THE DEGREE OF ... types of LCs based on the shape of LC molecules: (A) calamitic and (B) discotic Source: Liquid Crystal Technology Group, Oxford University Based on the driving fo...
Ngày tải lên: 14/09/2015, 08:41
Development of an integrated treatment system for ink effluent
... complexity in ink effluent The high organic contents and high strength colour ink effluent are the characteristics for the ink- jet ink effluent in majority of the cases 2.2 Biodegradability of Ink Effluents ... 2.1 Inkjet Ink Effluents 2.1.1 Inkjet Technologies 2.1.2 Drop-on-demand Inkjet Printing 2.1.3 Components of Inkjet Ink 10 2.2 Biodegradability of Ink Ef...
Ngày tải lên: 04/10/2015, 15:52