Anticipated user experience in the early stages of product development

... for the early and late phases of the phrenic neurogram during eupnea as well as the phrenic burst during gasping were estimated The mean ratios for the early, late phase during eupnea and gasping ... not influence phrenic neurons responsible for the neural activities in the late phase of the phrenic neurogram during inspiration In addition, i...

Ngày tải lên: 19/06/2014, 10:20

... weekly intraarticular hyaluronan injection helped maintain the smoothness of the surface of the articular cartilage (Figure 2) Histological analyses demonstrated that 30 km of strenuous running induced ... development of osteoarthritis in the knee joints of rats after strenuous running exercise [3] They stimulated the rats intracranially to motivate them to...

Ngày tải lên: 09/08/2014, 10:22

... high-risk HPV E5-induced cell fusion may play a critical role in the early stage of HPV- associated cervical cancer However, it is widely accepted that increasingly deregulated expression of the E6-E7 ... early stage of HPV- associated cervical cancer This viewpoint will change our understanding of the mechanisms by which HPV induces cervical canc...

Ngày tải lên: 12/08/2014, 01:21

... are synthesized within viroplasms, which led to the hypothesis that the entering viral particles could serve as points of nucleation for the formation of viroplasms [8] In this work, the dynamics ... earlier stages of viroplasm formation, and in their work, following the expression of an NSP2 protein fused to EGFP in rotavirus SA-11 infected cells, they observed tha...

Ngày tải lên: 12/08/2014, 02:20

... (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAA TGGCGGCGGATGCTCTGAG3' and 5'GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCAGCAACTTCTTCTTGAT CCTTG3') The expression clone was inserted into the donor vector pDONR201, and subsequently transformed ... through PCR amplification with the primer LBa-1 (located on the TDNA insert: 5'TGGTTCACGTAGTGGGCCATCG3') and primers flanking the predicted inserts (5'AAAAACAAAAGCAGACA...

Ngày tải lên: 12/08/2014, 05:20

... recordings in the early stage of sepsis, we obtained EMG recordings of the rats in the first 24 hours after CLP We did not aim to observe clinical signs of sepsis; therefore, the animals were euthanized ... obtained during early periods of clinical sepsis indicated that the decrease in amplitude of CMAP was accompanied by an increase in duration without a...

Ngày tải lên: 13/08/2014, 03:20

... complexity (from 56 to 14 infusions) of the previously preferred treatment of eflornithine monotherapy [15-17] However, NECT administration remains labour-intensive, requiring days of infusions of ... mainly Page of because of the remoteness of the areas [1] These areas border others with a history of HAT in CAR and South Sudan In mid-2007, MSF launched projects...

Ngày tải lên: 13/08/2014, 15:21

... variables This finding may be related to the fact that the PK analyses were performed during the early phase of sepsis Also, as a first dose of antibiotic is largely influenced by Vd, the increased ... recommendations on dosing in severe infections, especially in the early phase of severe sepsis and septic shock Key messages • Recommended doses of pip...

Ngày tải lên: 13/08/2014, 21:20

... mutations in T4 that increase the synthesis of the early gene product rIIA [86] In fact, expression of several early genes increase in the T4 motA- infection, presumably because of a delay in the shift ... [reviewed in [36,37]] The formation of the RNA hairpin by an intrinsic terminator sequence may facilitate termination by destabilizing the RNA/DNA hybrid...

Ngày tải lên: 12/08/2014, 02:20

... difficulties in defining software requirements and business process modeling DEMO can help capture the business processes of the organization while RAD technique links these business processes to the software ... steps of the related transactions Capturing the business processes of the organization, it can be used as the starting point to design the supporting...

Ngày tải lên: 02/08/2015, 13:22

Ngày tải lên: 18/03/2014, 15:21

... to test the association between bullying behavior and early stages of suicidal ideation in a sample of Greek adolescents and to examine whether this is independent of the presence of psychiatric ... disorders on the one hand and suicidal ideation and psychiatric disorders on the other [50] In our study we confirmed the confounding effect of...

Ngày tải lên: 11/08/2014, 16:23

... endothelium and resulted in the formation of atherosclerosis (9) Javid et al also found that in the early stage of atherosclerosis, the number of Cx43 gap junction plaques increased and the diameter ... antagonists are mediated through decreasing VSMC seamless connections The present study aimed to detect the expression of Cx40 and Cx43 in the artery at...

Ngày tải lên: 26/10/2012, 09:39