Analysis of the underwater emissions from outboard engines

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

... 17 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G. W BUSH IN THE U. S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A DATA ANALYSIS AND DISCUSSION 3.1 Analysis of data 3.1.1 Lexical choice By referring ... 14 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G. W BUSH IN THE U. S PRESIDENTIAL ELECTION 2004 FROM A PERSPEC...

Ngày tải lên: 18/12/2013, 10:08

44 579 0
Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

... b-amylase (Cys83, Cys96, Cys209 and Cys344) are homologous to those found in soybean b-amylase (Cys82, Cys97, Cys208 and Cys343) On the analogy of the soybean b-amylase, the active site of the ... for the b-amylase from C sepium using the X-ray coordinates of the soybean b-amylase (Fig 4) According to the Ramachandran plot of this model the f and c...

Ngày tải lên: 22/02/2014, 07:20

11 611 0
Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf

Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf

... exposed to the solvent (Fig S5B) Resolution of the structure of NADP+-bound FeR revealed that the nicotinamide moiety of NADP+ faces the re-side of the isoalloxazine ring, and that the 2Â-P-AMP ... claimed that His126 of A fulgidus FeR is one of the candidates for the ferric ion-binding residue based on the structure of the mercury-bound derivativ...

Ngày tải lên: 07/03/2014, 02:20

14 653 0
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

... we have purified, cloned and characterized Cyn d 24 as a novel pathogenesis-related protein from BGP Additionally, the identification of Cyn d 24 has identified the involvement of a novel class of ... AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S 112 Nicotiana AYA.N S-Q.AA NL HGQ AE -GDFMTAAKA.EM.V QY.DHD 118 Cyn d 24 DQGKM...

Ngày tải lên: 07/03/2014, 12:20

10 665 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

... tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon structures in Xenopus ... 2002 Functional analysis of Xenopus MGP gene promoter (Eur J Biochem 269) 1949 GGAAAC-3Â) for amplication of the region from )783 to +33, and (5Â-CCGGAGCTCGAGGG...

Ngày tải lên: 08/03/2014, 10:20

10 475 0
Báo cáo khoa học: Expression analysis of the nucleocytoplasmic lectin ‘Orysata’ from rice in Pichia pastoris ppt

Báo cáo khoa học: Expression analysis of the nucleocytoplasmic lectin ‘Orysata’ from rice in Pichia pastoris ppt

... expressed in Pichia strain X-33 with the addition of a signal sequence for secretion of the recombinant protein into the medium Approximately 12 mg of the recombinant lectin was purified from the medium ... similarly docked into the saccharide-binding site of Calsepa (RCSB Protein Data Bank code 1OUW) [28] Cartoons showing the docking of Man ⁄ MeMan in the m...

Ngày tải lên: 14/03/2014, 23:20

16 626 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên: 16/03/2014, 00:20

9 491 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

... like the Trp residue of the 183 Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R Jordanova et al Fig Immunohistological localization of Ag-NPA-1 in adult A galli and ... ligand binding and distribution of nematode protein Ag-NPA-1 Fig Immunogold electron microscopic localization of Ag-NPA-1 in a male A galli worm (A) Sect...

Ngày tải lên: 16/03/2014, 18:20

10 501 0
Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx

Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx

... dehydrogenase and prephenate dehydratase catalyze the biosynthesis of tyrosine and phenylalanine, respectively As this biosynthetic pathway is absent in mammals but is essential for the survival of bacteria ... Reddy PT (2006) Biochemical and structural characterization of the secreted chorismate mutase (Rv1885c) from Mycobacterium tuberculosis H37Rv: an *Ar...

Ngày tải lên: 17/03/2014, 17:20

12 514 0
Báo cáo khoa học: Thermodynamic analysis of the unfolding and stability of the dimeric DNA-binding protein HU from the hyperthermophilic eubacterium Thermotoga maritima and its E34D mutant pdf

Báo cáo khoa học: Thermodynamic analysis of the unfolding and stability of the dimeric DNA-binding protein HU from the hyperthermophilic eubacterium Thermotoga maritima and its E34D mutant pdf

... studied the thermal unfolding of both the wild-type HUTmar protein and its E34D mutant in acidic solutions (pH 4.00, 3.75 and 3.50) to improve the reversibility of unfolding and avoid postunfolding ... We report here the results of an extensive thermalstability study of a hyperthermophilic protein, the histonelike protein from T maritima (HUTmar-wt...

Ngày tải lên: 23/03/2014, 12:20

11 462 0
Báo cáo khoa học: Functional analysis of the methylmalonyl-CoA epimerase from Caenorhabditis elegans docx

Báo cáo khoa học: Functional analysis of the methylmalonyl-CoA epimerase from Caenorhabditis elegans docx

... MCE on the human glyoxalase structure shows that the Co2+ ion ˚ of the MCE is only 0.2 A from the position of the Zn2+ ion in the glyoxalase [19] and it was suggested that the formation of a symmetric, ... a detailed study of the structure and expression of the mce-1 gene in C elegans Results and Discussion Identification and sequence analysis of C elegans...

Ngày tải lên: 23/03/2014, 13:20

13 561 0
A Comparative Analysis of Carbon Dioxide Emissions in Coated Paper Production Key Differences between China and the U.S. pot

A Comparative Analysis of Carbon Dioxide Emissions in Coated Paper Production Key Differences between China and the U.S. pot

... 50% of the world’s overall growth in paper and paperboard (Barr and Demawan, 2005) China is now the second largest producer of paper, after the U.S., and coated paper is one of the fastest growing ... chains for China and the U.S The analysis tracks the energy used at each step in the paper and pulp manufacturing process It includes energy u...

Ngày tải lên: 24/03/2014, 05:20

53 623 0
Báo cáo khoa học: Structural analysis of the jacalin-related lectin MornigaM from the black mulberry (Morus nigra) in complex with mannose ppt

Báo cáo khoa học: Structural analysis of the jacalin-related lectin MornigaM from the black mulberry (Morus nigra) in complex with mannose ppt

... and that delineate the carbohydrate-binding cavity of the lectin protomer) A closer examination of the structure of 3728 the binding sites indicates that specificity of the Moraceae lectins is primarily ... β7 β1 N β10 N C D Fig The carbohydrate-binding site of MornigaM and other jacalin-related lectins (A) Ribbon diagram of the carbohydrate-binding site of M...

Ngày tải lên: 30/03/2014, 20:20

8 371 0
Báo cáo Y học: Structural analysis of the lipopolysaccharide from nontypeable Haemophilus influenzae strain 1003 potx

Báo cáo Y học: Structural analysis of the lipopolysaccharide from nontypeable Haemophilus influenzae strain 1003 potx

... Schweda, E.K.H (2001) A new structural type for Haemophilus influenzae lipopolysaccharide Structural analysis of the lipopolysaccharide from nontypeable Haemophilus influenzae strain 486 Eur J Biochem ... Hex4 glycoforms were indicated Ó FEBS 2002 Structural analysis of LPS from NTHi strain 1003 (Eur J Biochem 269) 811 Fig Negative ion ESI-MS spectrum o...

Ngày tải lên: 31/03/2014, 21:21

11 521 0
Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt

Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt

... different UL146 sequence groups In each case the sequence of the RT-PCR product was identical to the sequence of the PCR product derived from the viral genomic DNA The differences in the sizes of the ... comparative study of all of the genomic components of the ORFs from UL146 through UL147A and the first report of multiple overlapp...

Ngày tải lên: 19/06/2014, 08:20

18 395 0
w