Anatomy and Function of a Gene: Dissection Through Mutation

... – bacteria – Used at replication forks that stalled because of unrepaired DNA damage – "Sloppy" DNA polymerase used instead of normal polymerase – Adds random nucleotides opposite damaged bases ... DNThai General observations of mutation rates • Mutations affecting phenotype occur very rarely • Different genes mutate at different rates • Rate of forward mutation is almost always h...

Ngày tải lên: 15/06/2017, 20:37

... mutagenic chemicals Cells have evolved a number of enzyme systems that repair DNA and thus minimize mutations Mutations are the raw material of evolution Although some mutations may confer a selective ... of an autosomal gene VNU-University of Science - DNThai Alkaptonuria: An inborn error of metabolism The biochemical pathway in humans that degrades phenylalanine and tyrosi...

Ngày tải lên: 15/06/2017, 20:38

... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria...

Ngày tải lên: 07/03/2014, 00:20

... this gene was designated naoA (nitroalkane-oxidizing enzyme gene) Expression of naoA in E coli To study the function of the naoA gene, it is necessary to obtain an adequate amount of NaoA protein ... recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers (phospho...

Ngày tải lên: 31/03/2014, 08:20

... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...

Ngày tải lên: 12/02/2014, 10:20

... domain of each subunit contributes to the formation of the hydrophilic pore ACh binding protein has structural and functional homology to the extracellular ligand binding domain of the nAChR, and ... development of selective drugs is the identification and pharmacological characterization of the various receptor subtypes, and the determination of their prec...

Ngày tải lên: 19/02/2014, 12:20

... C An et al Manduca sexta Spatzle ¨ Introduction A prominent feature of the innate immune systems of insects is the activation of serine proteinase cascade pathways in hemolymph, which function ... gene In the clade including Spatzle- 1, the branch lengths are noticeably longer and ¨ the bootstrap values are lower than in the other clades containing...

Ngày tải lên: 06/03/2014, 09:22

... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino...

Ngày tải lên: 08/03/2014, 16:20

... partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the reaction Analysis was ... B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms are 38.14 A ively It is the...

Ngày tải lên: 16/03/2014, 16:20

... alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction ... TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression and...

Ngày tải lên: 16/03/2014, 16:20

... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... retrieved from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A...

Ngày tải lên: 23/03/2014, 09:21

... treatment of human or bovine a-lactalbumin at temperatures of 50, 60 or even 80 °C have resulted in the generation of cytotoxic HAMLET or bovine a-lactalbumin made lethal to tumor cells (BAMLET) complexes ... HAMLET Cytotoxicity of ELOA complexes Similar to HAMLET, the assembly of equine lysozyme and oleic acid into ELOA complexes led to cytotoxic activit...

Ngày tải lên: 29/03/2014, 21:20

... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... Sampieri, F & Granier, C (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the a- and b-sites of the mammalian s...

Ngày tải lên: 31/03/2014, 09:20

... hypersensitivity-related proteins of Arabidopsis and tobacco; and (b) acyl transferases such as anthranilate N-hydroxy-cinnamoyl/benzoyl-transferase (NHCBT)-like protein of Arabidopsis and Dianthus caryophyllus, ... strawberry [9] and yeast AATs [33] CMAAT1 was capable of accepting branched alcohols such as 2- and 3-methylbutyl alcohol (also named amyl and isoamyl alcohols...

Ngày tải lên: 31/03/2014, 21:21

... 5’-GGGCATCACAGACCTGTTAT-3’ 5’-AAYATGGAYATHGAYTGYGA-3’ 5’-RTCDCCCCADATNCCRTA-3’ 5-CCAGAGCACGTTGGCATCAA-3 5-ACCATAGTCGGACTTGACCT-3 5’-GGTCTGCAACAACAAGCTCATC-3’ 5’–GAGTCGATGCCGTCTTGATC-3’ 5’-CGCCATATGAAAACAGCTGCCATT-3 ... Acta 1205:183–188 Gupta V, Prasanna R, Natarajan C, Srivastava AK, Sharma J (2010) Identification, characterization, and regulation of a novel antifungal chitosanase g...

Ngày tải lên: 21/06/2014, 19:20