... of 24 Modul database dengan ms acces 2007 dari berbagai sumber Table matakuliah Table peserta Page 21 of 24 Modul database dengan ms acces 2007 dari berbagai sumber Buatlah relationship databasenya ... Page of 24 Modul database dengan ms acces 2007 dari berbagai sumber Memulai Access 2007 Microsoft Access 2007 yang untuk selanjutnya disi...
Ngày tải lên: 05/03/2014, 19:20
... stimulation of VEGF gene expression by agents such as LPS and VEGF not act through TNFa by an autocrine mechanism Activation of VEGF gene expression in RAW-264.7 cells with LPS and VEGF was distinct from ... show that the 3¢ UTR of VEGF mRNA plays a role in VEGF gene expression in mouse macrophages under in ammatory conditions We have introduced the 3¢ UTR of...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: The C-terminus of viral vascular endothelial growth factor-E partially blocks binding to VEGF receptor-1 docx
... VEGFR specificity of the viral VEGFs It has been hypothesized that the inability of viral VEGF to bind VEGFR-1 may be due to the absence of a functional groove on the receptorbinding face of the ... Deletion of the C-terminus of ORFVNZ 2VEGF increases its affinity for VEGFR-1 and VEGFR-2 To investigate the role of the ORFVNZ 2VEGF C-terminus in re...
Ngày tải lên: 23/03/2014, 07:20
báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx
... liver metastasis [18,19] Therefore, upregu- lation of LFA-1 expression on cancer cells at this early stage of the hepatic metastasis process may contribute to VEGF production by metastatic cells ... pro-metastatic role of this selected ensemble of proteins associated to the 3D -growth of CT26 colorectal carcinoma cells Conclusion This study demonstrates that cultu...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo sinh học: " Dengue virus serotype infection specifies the activation of the unfolded protein respon" pot
... clear that the ability of viruses to regulate cellular responses to infection is a key determinant for the physiological consequences of infection Since the activation of the UPR is on the one hand ... proliferation through the activation of specific components of the Unfolded Protein Response [31,32] These observations are also supported by the occurrenc...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pptx
... expression of sFlt-1 and VEGF -A in patients with hematological malignancies and chemotherapy-related FN, to gain insights about both potential roles of sFlt-1 in patients with febrile neutropenia and sepsis, ... Serum sFlt-1 and VEGF -A levels in FN Serum sFlt-1 and VEGF -A levels in patients with FN Box plots representing serial concentrat...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pdf
... expression of sFlt-1 and VEGF -A in patients with hematological malignancies and chemotherapy-related FN, to gain insights about both potential roles of sFlt-1 in patients with febrile neutropenia and sepsis, ... Serum sFlt-1 and VEGF -A levels in FN Serum sFlt-1 and VEGF -A levels in patients with FN Box plots representing serial concentrat...
Ngày tải lên: 20/06/2014, 03:20
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients an...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients an...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: "Sustained release of VEGF from PLGA nanoparticles embedded thermo-sensitive hydrogel in full-thickness porcine bladder acellular matrix" doc
... followed by a phase of sustained release with almost 75% of VEGF being released within 60 days The VEGF release from NPs-F127 gel embedded in full-thickness acellular porcine bladder matrix (Figure ... Cite this article as: Geng et al.: Sustained release of VEGF from PLGA nanoparticles embedded thermo-sensitive hydrogel in full-thickness porcin...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo toán học: "VEGF T-1498C polymorphism, a predictive marker of differentiation of colorectal adenocarcinomas in Japanese" docx
... C-7-allele probe T-7-allele probe GTGTGGGTGAGTGAGTGTGT GTGACCCCTGGCCTTCTC VIC-CTCCAACaCCCTCAAC FAM-CCAACgCCCTCAAC CCGAGCCGGAGAGGGA GCACCCAAGACAGCAGAAAGT VIC-CATGGTTTCgGAGGCC FAM-ATGGTTTCaGAGGCC ... colorectal adenocarcinomas in Japanese Biol Pharm Bull 2006; 29: 1449–53 Komoto C, Nakamura T, Sakaeda T, et al MDR1 haplotype frequencies in Japanese and Caucasian, and in Japanese patie...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo khoa học: " Definitive radiotherapy and Single-Agent radiosensitizing Ifosfamide in Patients with localized, irresectable Soft Tissue Sarcoma: A retrospective analysis" pptx
... this article as: Eckert et al., Definitive radiotherapy and Single-Agent radiosensitizing Ifosfamide in Patients with localized, irresectable Soft Tissue Sarcoma: A retrospective analysis Radiation ... The authors declare that they have no competing interests Authors' contributions All authors read and approved the final manuscript FE: acquisition of data an...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "Stanniocalcin-1 promotes tumor angiogenesis through up-regulation of VEGF in gastric cancer cells" ppt
... staining of STC-1 in tumor tissues of nude mice STC-1 was detected on the membrane of tumor cells (D) Immunohistochemical staining of PCNA in tumor tissues of nude mice PCNA was detected in the ... Signaling Technology, USA) at 1: 1000, and the anti-btubulin rat monoclonal antibody (Beyotime, China) at 1:1000 VEGF Assay VEGF content in tumor culture supernatants...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "VEGF attenuates development from cardiac hypertrophy to heart failure after aortic stenosis through mitochondrial mediated apoptosis and cardiomyocyte proliferation" potx
... hypertrophy to heart failure VEGF injection in compensatory hypertrophy heart was found to attenuate LV remodeling and to improve cardiac function through increased capillary density, preserved mitochondrial ... from cardiac hypertrophy to heart failure after aortic stenosis through mitochondrial mediated apoptosis and cardiomyocyte prolif...
Ngày tải lên: 10/08/2014, 09:21