DEVELOPMENT OF A REAL-TIME SUPPORTED SYSTEM FOR FIREFIGHTERS ON-DUTY

Development of a liposomal nanodelivery system for nevirapine ppsx

Development of a liposomal nanodelivery system for nevirapine ppsx

... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...

Ngày tải lên: 10/08/2014, 05:21

9 359 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 201...

Ngày tải lên: 23/03/2014, 14:20

5 347 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

... Ó FEBS 20 02 Photoactivatable CRF2 receptor antagonist (Eur J Biochem 26 9) 528 9 [21 ] and astressin [22 ], a conformationally constrained nonselective CRF peptide antagonist [ 12, 23], we were ... USA) was used to monitor radioactivity Photolysis of ATB-[His 12] Svg( 12) 40), and its radioactively labeled analog 125 I-labeled ATB-[His 12] Svg( 12) 40) Photolysis was performed a...

Ngày tải lên: 31/03/2014, 08:20

7 345 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... Percentage Dose ( %) Figure DVH Comparison of ANFIS and manual planning for a prostate case DVH Comparison of ANFIS and manual planning for a prostate case rized overview of the differences of discrete ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a...

Ngày tải lên: 09/08/2014, 10:20

16 511 0
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx

Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx

... 12 mice housed individually in standard breeding cages Electronic system for the recording of locomotor activity The locomotor activity of the animal is recorded automatically by means of microwave ... parameters of locomotor activity Conclusion The aim of this study was to develop an apparatus consisting of a battery of radar sensors to allow th...

Ngày tải lên: 10/08/2014, 09:20

8 586 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelof...

Ngày tải lên: 10/08/2014, 21:23

7 436 0
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

... than descriptive form Templates are created specifically for a particular setting and can be filled in by the reporting physician Synoptic reports are of great value because they ensure that all ... enablers and barriers to the use and sustainability of clinical synoptic reports; and to provide any suggestions or recommendations for implementation and sustainability of the sy...

Ngày tải lên: 11/08/2014, 05:21

6 440 0
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... implemented for rectal cancer in North America [16] Aims The specific aims of this project are to develop a synoptic MRI report for primary rectal cancer, and...

Ngày tải lên: 11/08/2014, 16:20

6 351 0
w