A case of effective neoadjuvant chemoradiotherapy with capecitabine for locally advanced sigmoid colon cancer

A case of locally advanced sigmoid colon cancer treated with neoadjuvant chemoradiotherapy

A case of locally advanced sigmoid colon cancer treated with neoadjuvant chemoradiotherapy

... chemoradiation for rectal cancer Anticancer Res 27(4C): 2877-2880, 2007 9) De Paoli A, Chiara S, Luppi G, et al: Capecitabine in combination with preoperative radiation therapy in locally advanced, ... defect with a longitudinal diameter of cm(apple core sign)in the sigmoid colon, indicating the existence of type advanced colon cancer b: After preoperative chemor...
Ngày tải lên : 08/01/2017, 20:50
  • 4
  • 381
  • 0
Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf

Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf

... setting There are data supporting the use of CT perfusion in acute stroke management [11] Relative MTT and absolute CBV are CT perfusion parameters that help define areas of infarct from areas of ... hyperperfusion state during the ictal state has also been shown with SPECT and f-MRI in patients with focal epilepsy [16,17] CT perfusion has the advantages of...
Ngày tải lên : 21/06/2014, 19:20
  • 4
  • 447
  • 0
Báo cáo khoa học: "Long-term results from a randomized phase II trial of neoadjuvant combined-modality therapy for locally advanced rectal cancer" ppt

Báo cáo khoa học: "Long-term results from a randomized phase II trial of neoadjuvant combined-modality therapy for locally advanced rectal cancer" ppt

... pelvic radiotherapy for locally advanced rectal cancer (phase I trial) J Med Assoc Thai 2006, 89:1874-1884 39 Wong SJ, Sadasiwan C, Erickson B: A phase I trial of preoperative capecitabine and concurrent ... V, Anderlih F, Oblak I, Strojan P, Zakotnik B: Capecitabine as a radiosensitizing agent in neoadjuvant treatment of locally advanced respectable rectal cance...
Ngày tải lên : 09/08/2014, 09:20
  • 8
  • 287
  • 0
Báo cáo khoa học: "A case of radiation-induced sternal malignant fibrous histiocytoma treated with neoadjuvant chemotherapy and surgical resection" potx

Báo cáo khoa học: "A case of radiation-induced sternal malignant fibrous histiocytoma treated with neoadjuvant chemotherapy and surgical resection" potx

... this related case, and we recommend its use in such cases In planning the surgical resection of the tumor after neoadjuvant chemotherapy, when possible, the size of the tumor before chemotherapy ... JC: Malignant fibrous histiocytoma: a retrospective study of 167 cases Cancer 1980, 45:167-178 Venn GE, Gellister J, Da Costa PE, Goldstraw P: Malignant fibrous histiocyt...
Ngày tải lên : 09/08/2014, 07:22
  • 4
  • 252
  • 0
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

... material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained in the ... of Comparing and Contrasting approach: 30 % instead of 10% of the students say that they are very good at English The same thing applies to the students wh...
Ngày tải lên : 07/11/2012, 15:06
  • 40
  • 644
  • 1
INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING   CONTRASTING APPROACH a CASE OF TOURISM STUDE

INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING CONTRASTING APPROACH a CASE OF TOURISM STUDE

... material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained in the ... Briefly, there are many activities for incorporating English cultural elements into the English training with the Comparing- Contrasting approach which are a...
Ngày tải lên : 07/09/2013, 13:41
  • 40
  • 420
  • 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA ... ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelat...
Ngày tải lên : 31/03/2014, 15:20
  • 10
  • 432
  • 0
Báo cáo khoa học: "A case of adrenal gland dependent hyperadrenocorticism with mitotane therapy in a Yorkshire terrier dog" pptx

Báo cáo khoa học: "A case of adrenal gland dependent hyperadrenocorticism with mitotane therapy in a Yorkshire terrier dog" pptx

... lanerda dedis-thgir eht fo margonosartlu lanidutignoL giF )B( ypareht enatotim retfa detaivella erew taoc-riah dedaf dna aicepola gnidulcni sngis lacinilC )A( enatotim fo noitartsinimda erofeb taoc-riah ... ypareht enatotim retfa ro erofeb ezis dnalg lanerda eht ni ecnereffid on saw erehT yticinegohce-repyh dna noitazilarenim dlim htiw ssam dnuor sa sraeppa dnalg lanerda ehT )worra( ssam dnal...
Ngày tải lên : 07/08/2014, 18:21
  • 4
  • 182
  • 0
Báo cáo y học: "A case of IgG4-related tubulointerstitial nephritis concurrent with Henoch-Schönlein purpura nephritis" pot

Báo cáo y học: "A case of IgG4-related tubulointerstitial nephritis concurrent with Henoch-Schönlein purpura nephritis" pot

... as: Tamai et al.: A case of IgG4-related tubulointerstitial nephritis concurrent with Henoch-Schönlein purpura nephritis Allergy, Asthma & Clinical Immunology 2011 7:5 Submit your next manuscript ... had symptoms of HSP systemically Therefore we made a diagnosis of concomitant HSP nephritis and IgG4-related TIN Recently, it has been reported that several IgG4-rela...
Ngày tải lên : 08/08/2014, 21:20
  • 5
  • 456
  • 0
báo cáo khoa học: "A male case of an undifferentiated carcinoma with osteoclast-like giant cells originating in an indeterminate mucin-producing cystic neoplasm of the pancreas. A case report and review of the literature" docx

báo cáo khoa học: "A male case of an undifferentiated carcinoma with osteoclast-like giant cells originating in an indeterminate mucin-producing cystic neoplasm of the pancreas. A case report and review of the literature" docx

... article as: Wada et al.: A male case of an undifferentiated carcinoma with osteoclast-like giant cells originating in an indeterminate mucin-producing cystic neoplasm of the pancreas A case report ... stroma was present An UC with OGCs originating in an indeterminate mucin-producing cystic neoplasm of the pancreas may also ha...
Ngày tải lên : 09/08/2014, 02:21
  • 6
  • 394
  • 0
Báo cáo khoa học: "A case of high-grade leiomyosarcoma of the bladder with delayed onset and very poor prognosis" pptx

Báo cáo khoa học: "A case of high-grade leiomyosarcoma of the bladder with delayed onset and very poor prognosis" pptx

... Cite this article as: Ricciardi et al., A case of high-grade leiomyosarcoma of the bladder with delayed onset and very poor prognosis World Journal of Surgical Oncology 2010, 8:16 ... Figure Leiomyosarcoma of the bladder (Smooth muscle actin) 50% were leiomyosarcomas, 20% rhabdomyosarcomas and the remainder consisting of other histologies as carcinosa...
Ngày tải lên : 09/08/2014, 03:21
  • 4
  • 252
  • 0
Báo cáo khoa học: "Case of a sigmoid colon cancer with metachronous metastases to the mesorectum and the abdominal wall" pdf

Báo cáo khoa học: "Case of a sigmoid colon cancer with metachronous metastases to the mesorectum and the abdominal wall" pdf

... H, Wada T, Kizaki T: Case of a sigmoid colon cancer with metachronous metastases of the stomach and the abdominal wall Nippon Shokakibyo Gakkai Zasshi 2009, 106(5):653-9 Kalaitzis et al World ... free of metastatic adenocarcinoma The patient had an uneventful recovery On rectum examination one year later a palpable extramucosal mass was noticed at the anteri...
Ngày tải lên : 09/08/2014, 03:21
  • 4
  • 463
  • 0
Báo cáo y học: " A case of penile fracture with complete urethral disruption during sexual intercourse: a case report" pps

Báo cáo y học: " A case of penile fracture with complete urethral disruption during sexual intercourse: a case report" pps

... postoperative day and they were mitigated with diazepam On day 12 the catheter was removed and on day 13 the patient was released home The antibiotic was continued at home for the next 10 days During ... Vigorous sexual intercourse is the main cause of penile fracture in the Western world Because of high energy trauma urethral rupture is associated in up to 38% of penile f...
Ngày tải lên : 11/08/2014, 10:22
  • 3
  • 325
  • 0
Báo cáo y học: "A fatal case of bupropion (Zyban) hepatotoxicity with autoimmune features: Case report" pot

Báo cáo y học: "A fatal case of bupropion (Zyban) hepatotoxicity with autoimmune features: Case report" pot

... However, as with many other drugs used in clinical practice, there are rare instances of idiosyncratic hepatotoxicity associated with bupropion use The previously published cases of bupropion hepatotoxicity ... three reports of severe but non -fatal bupropion hepatotoxicity published in the literature [2-4] The aim of this paper is to report the first fatal case...
Ngày tải lên : 11/08/2014, 10:23
  • 5
  • 251
  • 0

Xem thêm