Hepatitis c virus infection in patients on maintenance dialysis

... liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32( 10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: Alterations of glucose ... The prevalence rate of 11% recorded in this study is in agreement with the work of [5] who also recorded 11.5% against 2. 5% when prevalence of HCV infection was checked among...

Ngày tải lên: 12/08/2014, 04:21

... liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32( 10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: Alterations of glucose ... The prevalence rate of 11% recorded in this study is in agreement with the work of [5] who also recorded 11.5% against 2. 5% when prevalence of HCV infection was checked among...

Ngày tải lên: 12/08/2014, 04:22

... (40-50 years) people Third highest active HCV infection was 2.13% observed in age group 31-40 years People including in age group 21-30 years revealed 1.82% active HCV infection High prevalence of ... have no active HCV infection The absence of HCV infection in this age group may be due to their least exposure to some of the high risk factors causing HCV such as expo...

Ngày tải lên: 12/08/2014, 02:20

... genotypes/subtypes, and the factors associated with HCV infection in long-distance truck drivers in Brazil A cross-sectional study was carried out in a population of long-distance truck drivers in ... 81 truck drivers who reported illicit drug use, the majority had used non-injecting drugs, including the anti-HCV-positive individuals The risk of HCV infection associated...

Ngày tải lên: 12/08/2014, 04:20

... G, Schattner A: Increased risk of type diabetes in noncirrhotic patients with chronic hepatitis C virus infection Mayo Clin Proc 2000, 75:355-359 Zein CO, Levy C, Basu A, Zein NN: Chronic hepatitis ... inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hepatitis and such cytokines induce insulin resistance and glucose intolerance w...

Ngày tải lên: 12/08/2014, 04:21

... G, Schattner A: Increased risk of type diabetes in noncirrhotic patients with chronic hepatitis C virus infection Mayo Clin Proc 2000, 75:355-359 Zein CO, Levy C, Basu A, Zein NN: Chronic hepatitis ... inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hepatitis and such cytokines induce insulin resistance and glucose intolerance w...

Ngày tải lên: 12/08/2014, 04:22

... http://www.comparative-hepatology.com/content/5/1/4 body), splenomegaly, ascitis, edema, cirrhosis, grade and stage of liver biopsy, and child score and status (inactive, chronic, cirrhotic and active) of ... molecular epidemiology of HCV by the introduction of subtype 1a and 3a from USA and Southeast Asia into their young drug addicts [44] Our results are in accorda...

Ngày tải lên: 13/08/2014, 13:20

... doi:10.1186/1743-422X-7-311 Cite this article as: Scagnolari et al.: Differential expression of interferoninduced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon ... http://www.virologyj.com/content/7/1/311 Page of Table Baseline expression of microRNAs and MxA-mRNA in healthy controls and in patients...

Ngày tải lên: 12/08/2014, 02:20

... life-threatening complication of PEG-IFNa 2a treatment Abbreviations AA: aplastic anemia; AIHA: autoimmune hemolytic anemia; EBV: Epstein-Barr virus; HAA: hepatitis -associated aplastic anemia; Hb: ... Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report Journal of Medical Case R...

Ngày tải lên: 11/08/2014, 03:21

... alleles with HCV infection were observed in either Caucasians or nonCaucasians in the present study The associations of HLA- class II alleles with HCV infection The protective associations of DRB1*0101 ... the outcome of HCV infection Therefore, recognition of racial differences in HLA associations is likely important in studying the immune response...

Ngày tải lên: 12/08/2014, 04:21

... Int J Med Sci 2005 of HBV infection was based on positive HBsAg The case definition for < /b> confirmed acute HBV infection includes the presence of HBsAg combined with IgM antibody to the HBV core ... reporting Year-to-year trends in the rate of HBV infection in both Canadian-born and non-Canadianborn children are shown in Fig Amongst Canadian-born children, the rate of newly id...

Ngày tải lên: 02/11/2012, 11:08

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplificatio...

Ngày tải lên: 30/03/2014, 03:20

... genotypespecific PCR assay Figure-2 shows a typical agarose gel showing different HCV genotype-specific bands (HCV1a & HCV-3a) Pattern of HCV genotypes in the study population The distribution of HCV genotypes ... Mass vaccination in the recent past in which un-sterilized syringes were used might have enhanced the infection rate in this country [23] This type of practice is...

Ngày tải lên: 12/08/2014, 04:20

... 5’TCCAGGCTCCCCCTCGAGCTTGTACA GCTCGTCCAT-3’) In the third step, the recombinant 531 bp DNA fragment (F3) containing last amino acids of EGFP-N1 and 177 amino acids of NS 5A (nt 75478077) was amplified ... doi:10.1186/1743-422X-7-36 Cite this article as: Hazari et al.: Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells...

Ngày tải lên: 12/08/2014, 04:21

... Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light on HCVcc infectivity, 200-μl aliquots of HCVcc stock (2.5 × 104 FFU/ml) were placed in 48-well ... tested concentration, is highly effective in eliminating the infectivity of both extracellular and intracellular HCVcc particles Discussion In this study, a detailed analysis was co...

Ngày tải lên: 12/08/2014, 04:21