prevention of hepatitis c virus infection
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"
... genotype C in China [34]. Accumulated data suggest the importance of genotype, subgroup and recombination that may influence the biological characteristics of virus and clinical outcome of HBV infection. ... adolescent vaccinatin programmes in Italy. Vaccine 2000;18:S31-S34. 77. Chang MH, Chen CJ,cLai MS. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children. ... Characteristic Endemicity of infection Low (%) Intermediate (%) High (%) Chronic infection prevalence 0.5-2 2-7 ≥8 Past infection prevalence 5-7 10-60 70-95 Perinatal infection Rare Uncommon...
- 8
- 643
- 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... Hepatitis C virus all need to be elucidated. Conflict of interest The authors have declared that no conflict of interest exists. References 1. WHO. Global surveillance and control of hepatitis C. ... A, Braconier JH, Esteban JI, Hadziyannis SJ, Manns MP, Saracco G, Thomas HC, Trepo C. Epidemiology of hepatitis C virus infection in seven European Union countries: a critical analysis of the ... Ippolito F, Costantino A, Rapicetta M, Lecce R, Taliani G. High prevalence of hepatitis C virus infection in a small central Italian town: lack of evidence of parenteral exposure. Ital J Gastroenterol...
- 6
- 486
- 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
... development of complications, among different racial and ethnic groups with HCV infection. For unclear reasons, African Americans appear to have a higher rate of chronic HCV infection than Caucasians ... do not clear the virus by 6 months, and chronic hepatitis develops. The rate of chronic HCV infection is affected by many factors, including the age at time of infection, gender, ethnicity, ... gender No jaundice or symptoms during acute infection African American race HIV infection Immunosuppression Age at Time of Infection The chronicity rate in hepatitis C infection appears to...
- 6
- 530
- 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
... al . Journal of Medical Case Reports 2011, 5:246http://www.jmedicalcasereports.com/content/5/1/246Page 3 of 4 CAS E REP O R T Open AccessSustained eradication of hepatitis C virus bylow-dose ... transplant recipients [2]. Besidesaccelerated deterioration of liver function in chronicHCV infection, HCV-related glomerulopathy [3] andHCV-associated fibrosing cholestatic hepatitis [4] ... with HBV and HCV.IntroductionChronic hepatitis C virus (HCV) infection may lead tosevere sequels such as liver cirrhosis and hepatoma [1].It was recognized as an important cause of morbidityand...
- 4
- 282
- 0
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
... Rice CM. Efficient initiation of HCV RNA replication in cell culture. Science 2000; 290: 1972-4. 10. Bartosch B, Dubuisson J and Cosset FL. Infectious hepatitis C virus pseudo-particles containing ... Comparison of different replicon systems. A selection of different bicistronic and monocistronic replicon constructs including subgenomic and full-length HCV sequences is depicted schematically. ... polymerase, replicon 1. Introduction The hepatitis C virus (HCV) belongs to the Flaviviridae family and is the only member of the Hepacivirus genus. HCV infection is a major cause of chronic hepatitis, ...
- 6
- 497
- 1
Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"
... hepatocellular carcinoma. Cancer 1988;61:1942-56. 30. Benvegnue L, Fattovich G, Noventa F et al. Concurrent hepatitis B and C virus infection and risk of hepatocellular carcinoma in cirrhosis. Cancer ... Influence of hepatitis B virus genotypes on the progression of chronic hepatitis B liver disease. Hepatology 2003;37:19-26. 6. Chu CJ, Lok ASF. Clinical significance of hepatitis B virus genotypes. ... presence of any other independent hepatotoxic factors such as alcohol ingestion, HCV co -infection can contribute to progression to cirrhosis. Once cirrhosis is established, individuals can decompensate...
- 5
- 450
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... Pasteur, Paris,France). The primers used were VB1: 5Â-AAACATATGAGCATGAGCTACCACCTGGACC-3Â and VB3: 5Â-CTCGAGCTTCACAAGAAACTTCTGC-3Â. The PCR fragmentwas cleaved by the restriction enzymes Nde1 ... molecular clonepCV-J4L6S [21] kindly provided by J. Bukh (NIH, Beth-esda, MD, USA). The primers used were NS5Bj4s2:5Â-GATATCATGTCAATGTCCTATACGTGGAC-3Â andNS5Bj4r 5Â-AAACTCGAGGCGGGGTCGGGCACGAGACAGG-3Â. ... relevance of sequencesand ⁄ or structures implicated in this step of viral RNAreplication in the infected cells.Experimental proceduresRecombinant HCV RdRpThe recombinant HCV NS5B-D21 of H77...
- 15
- 597
- 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
... support infection technical difficulties of primary cell cultureHCV-LP Infection, morphogenesis cell attachmentvaccinationmorphogenesisno secretion of particlesindependence of CD81 for entryHCVpp ... (2003) Immunization with hepatitis C virus- like particles protects mice from recombinant hepatitis C virus vaccinia infection. Proc Natl Acad SciUSA 100, 6753–6758.58 Blanchard E, Brand D, Trassard ... particles pro-duced in insect cells using a recombinant baculoviruscontaining the cDNA of HCV structural proteins of genotype 1b or 1a [48]. HCV-like particles wereobserved by electron microscopy...
- 14
- 532
- 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... indicated by a dot.A63TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCG...
- 12
- 354
- 0
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx
... developed countries, HCV accounts for20% of cases of acute hepatitis, 70% of cases of chronic hepatitis, 40% of cases of end-stage cirrhosis, 60% of cases of hepatocell ular carcinoma, and 30% of livertransplants ... be causedby any of the known hepatitis viruses including hepatitis C virus. In addition, to the best of our knowledge thereare no reported cases of patients with chronic hepatitis C virus infection ... 8:59-65.doi:10.1186/1752-1947-4-268Cite this article as: Ioannou et al.: Aplastic anemia associated withinterferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report. Journal of Medical Case Reports...
- 5
- 352
- 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
... sequence(5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagcccctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). TheRluc:miR-328 binding site reporter constructs, in whichRluc is coupled ... HCV IRES nt 1-515 segment was amplified by PCRfrom pHCV7 7c using forward (5'-gcgcgcggatccgccagccccct-gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac-cgctcggaagtcttcc-3') ... (5'-gagagagaattccggtcgggacgctctggcc-3') and reverse (5'gcgcgcaagcttcttaat-gctttcgctttcc-3') oligonucleotides, and cloned in the EcoRI/HindIII sites of pBluescript II KS(+) vector (Invitrogen),...
- 13
- 362
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25