... genotype C in China [34]. Accumulated data suggest the importance of genotype, subgroup and recombination that may influence the biological characteristics of virus and clinical outcome of HBV infection. ... adolescent vaccinatin programmes in Italy. Vaccine 2000;18:S31-S34. 77. Chang MH, Chen CJ,cLai MS. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children. ... Characteristic Endemicity of infection Low (%) Intermediate (%) High (%) Chronic infection prevalence 0.5-2 2-7 ≥8 Past infection prevalence 5-7 10-60 70-95 Perinatal infection Rare Uncommon...
Ngày tải lên: 02/11/2012, 11:12
Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf
Ngày tải lên: 12/08/2014, 04:22
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... Hepatitis C virus all need to be elucidated. Conflict of interest The authors have declared that no conflict of interest exists. References 1. WHO. Global surveillance and control of hepatitis C. ... A, Braconier JH, Esteban JI, Hadziyannis SJ, Manns MP, Saracco G, Thomas HC, Trepo C. Epidemiology of hepatitis C virus infection in seven European Union countries: a critical analysis of the ... Ippolito F, Costantino A, Rapicetta M, Lecce R, Taliani G. High prevalence of hepatitis C virus infection in a small central Italian town: lack of evidence of parenteral exposure. Ital J Gastroenterol...
Ngày tải lên: 02/11/2012, 09:56
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
... development of complications, among different racial and ethnic groups with HCV infection. For unclear reasons, African Americans appear to have a higher rate of chronic HCV infection than Caucasians ... do not clear the virus by 6 months, and chronic hepatitis develops. The rate of chronic HCV infection is affected by many factors, including the age at time of infection, gender, ethnicity, ... gender No jaundice or symptoms during acute infection African American race HIV infection Immunosuppression Age at Time of Infection The chronicity rate in hepatitis C infection appears to...
Ngày tải lên: 02/11/2012, 09:56
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
... al . Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246 Page 3 of 4 CAS E REP O R T Open Access Sustained eradication of hepatitis C virus by low-dose ... transplant recipients [2]. Besides accelerated deterioration of liver function in chronic HCV infection, HCV-related glomerulopathy [3] and HCV-associated fibrosing cholestatic hepatitis [4] ... with HBV and HCV. Introduction Chronic hepatitis C virus (HCV) infection may lead to severe sequels such as liver cirrhosis and hepatoma [1]. It was recognized as an important cause of morbidity and...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
... Rice CM. Efficient initiation of HCV RNA replication in cell culture. Science 2000; 290: 1972-4. 10. Bartosch B, Dubuisson J and Cosset FL. Infectious hepatitis C virus pseudo-particles containing ... Comparison of different replicon systems. A selection of different bicistronic and monocistronic replicon constructs including subgenomic and full-length HCV sequences is depicted schematically. ... polymerase, replicon 1. Introduction The hepatitis C virus (HCV) belongs to the Flaviviridae family and is the only member of the Hepacivirus genus. HCV infection is a major cause of chronic hepatitis, ...
Ngày tải lên: 02/11/2012, 10:00
Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"
... hepatocellular carcinoma. Cancer 1988;61:1942-56. 30. Benvegnue L, Fattovich G, Noventa F et al. Concurrent hepatitis B and C virus infection and risk of hepatocellular carcinoma in cirrhosis. Cancer ... Influence of hepatitis B virus genotypes on the progression of chronic hepatitis B liver disease. Hepatology 2003;37:19-26. 6. Chu CJ, Lok ASF. Clinical significance of hepatitis B virus genotypes. ... presence of any other independent hepatotoxic factors such as alcohol ingestion, HCV co -infection can contribute to progression to cirrhosis. Once cirrhosis is established, individuals can decompensate...
Ngày tải lên: 02/11/2012, 11:17
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... Pasteur, Paris, France). The primers used were VB1: 5Â-AAACATATGA GCATGAGCTACCACCTGGACC-3Â and VB3: 5Â-CTCG AGCTTCACAAGAAACTTCTGC-3Â. The PCR fragment was cleaved by the restriction enzymes Nde1 ... molecular clone pCV-J4L6S [21] kindly provided by J. Bukh (NIH, Beth- esda, MD, USA). The primers used were NS5Bj4s2: 5Â-GATATCATGTCAATGTCCTATACGTGGAC-3Â and NS5Bj4r 5Â-AAACTCGAGGCGGGGTCGGGCACGAGA CAGG-3Â. ... relevance of sequences and ⁄ or structures implicated in this step of viral RNA replication in the infected cells. Experimental procedures Recombinant HCV RdRp The recombinant HCV NS5B-D21 of H77...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
... support infection technical difficulties of primary cell culture HCV-LP Infection, morphogenesis cell attachment vaccination morphogenesis no secretion of particles independence of CD81 for entry HCVpp ... (2003) Immunization with hepatitis C virus- like particles protects mice from recombinant hepatitis C virus vaccinia infection. Proc Natl Acad Sci USA 100, 6753–6758. 58 Blanchard E, Brand D, Trassard ... particles pro- duced in insect cells using a recombinant baculovirus containing the cDNA of HCV structural proteins of genotype 1b or 1a [48]. HCV-like particles were observed by electron microscopy...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... indicated by a dot. A 63 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCG...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx
... developed countries, HCV accounts for 20% of cases of acute hepatitis, 70% of cases of chronic hepatitis, 40% of cases of end-stage cirrhosis, 60% of cases of hepatocell ular carcinoma, and 30% of liver transplants ... be caused by any of the known hepatitis viruses including hepatitis C virus. In addition, to the best of our knowledge there are no reported cases of patients with chronic hepatitis C virus infection ... 8:59-65. doi:10.1186/1752-1947-4-268 Cite this article as: Ioannou et al.: Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report. Journal of Medical Case Reports...
Ngày tải lên: 11/08/2014, 03:21