hepatitis c virus treatment in hiv

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+1 sequence ... myc myc myc N6 (CCG414 fi TAA, Pro25 fi stop in core ORF) Deletion of core nts 342–514 ATG core+1 85 with optimal context GCCCCTCTATGG fi CCGCCACCATGG ATG core+1 85 with optimal context GCCCCTCTATGG...

Ngày tải lên: 30/03/2014, 03:20

18 365 0
Báo cáo y học: "i: Randomized controlled trial of Hepatitis B virus vaccine in HIV-1-infected patients comparing two different doses" ppt

Báo cáo y học: "i: Randomized controlled trial of Hepatitis B virus vaccine in HIV-1-infected patients comparing two different doses" ppt

... response in this cohort of HIVinfected patients vaccinated with HBV recombinant vaccine (60.7%) of the population fully immunized, increasing vaccine did not have a beneficial effect Risk factors ... virus- infected patients receiving highly active antiretroviral therapy to vaccination with 23-valent pneumococcal polysaccharide vaccine Clin Infect Dis 2003, 37:438-447 Kayatas M: Levamisole treatment ... that HIV- infected patients have a poor immunologic response to HBV vaccine, but a CD4 count threshold is ≥ 200 cell/mm3 appears to increase vaccination response independently to vaccine dosing,...

Ngày tải lên: 10/08/2014, 05:20

5 361 0
Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

... highest active HCV infection was 2.13% observed in age group 31-40 years People including in age group 21-30 years revealed 1.82% active HCV infection High prevalence of HCV infection in male ... Genetic Engineering; ICT: Immno-chromatographic Test; KP: Khyber Pukhtoonkhwa; M-MLV: Molony-murine leukemia virus; PCR: Polymerase chain reaction; RNA: Ribonucleic acid; RT PCR: Reverse transcription ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar...

Ngày tải lên: 12/08/2014, 02:20

5 268 0
Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

... enhanced the infection rate in this country [23] This type of practice is still common in the countryside especially in KPK province which needs effective check for minimizing the spread of HCV infection ... utilizing HCV RNA quantification kits (Sacace Biotechnologies, Italy) The SmartCycler II system is a PCR system by which amplification and detection were accomplished concurrently with TaqMan technology ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar...

Ngày tải lên: 12/08/2014, 04:20

7 368 0
Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

... non-injecting drugs, including the anti-HCV-positive individuals The risk of HCV infection associated with non-injecting drugs is probably linked to the usual practice of sharing of non-injecting ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar ... immunodeficiency virus (HIV) , hepatitis B virus, and hepatitis C virus in three groups of populations at high risk of HIV infection in Amritsar (Punjab), Northern India Jpn J Infect Dis 2001,...

Ngày tải lên: 12/08/2014, 04:20

6 381 0
Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

... anti-sense overlapping primers (S/7529/GFP- 5’-GCCTCCTCTATGCCCCCCATGGTGAGC AAGGGCGAG-3’ and (AS/7547-7564/GFP 5’TCCAGGCTCCCCCTCGAGCTTGTACA GCTCGTCCAT-3’) In the third step, the recombinant 531 bp DNA ... first amino acids of EGFP-N1 was amplified using a sense primer (S/7336-7360/HCV5’-CCTCCCCCAAGGAGACGCCGGACA-3’) and antisense primer (AS/7529/HCV- 5’CTCGCCCTTGCTCACCATG GGGGGCATAGAGGAGGC-3’) In the ... Epidemiology of Hepatitis C (HCV) infection Int J Med Sciences 2006, 3:41-46 Bartenschlager R: Hepatitis C virus molecular clones: from cDNA to infectious virus particles in cell culture Curr Opin Microbiol...

Ngày tải lên: 12/08/2014, 04:21

16 391 0
Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

... treatment Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light on HCVcc infectivity, 200-μl aliquots of HCVcc stock (2.5 × 104 FFU/ml) were placed in 48-well ... 10FFU/ml 56 C Effects of formaldehyde and glutaraldehyde treatments on HCVcc infectivity * 0 10 15 20 25 30 35 40 Minutes HCVcc in culture medium B 65 C Log 10FFU/ml 60 C 0 Minutes C HCVcc in human serum ... respectively, could reduce HCVcc infectivity from 4.1 × 104 FFU/ml to undetectable levels (Table 1) At these concentrations both aldehydes were also effective in inactivating HCVcc in the presence...

Ngày tải lên: 12/08/2014, 04:21

12 411 0
Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti ... participated in data collection and Statistical analysis GE Participated in drafting of the study design NS Participated in study coordination GP Participated in Data collection EO Contributed in ... being infected with HCV might suffer from insulin resistance resulting in more adverse effects of diabetes than those with HCV infection alone It was observed from this study that the occurrence...

Ngày tải lên: 12/08/2014, 04:21

5 463 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx

... inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hepatitis and such cytokines induce insulin resistance and glucose intolerance which could consequently cause ... G, Schattner A: Increased risk of type diabetes in noncirrhotic patients with chronic hepatitis C virus infection Mayo Clin Proc 2000, 75:355-359 Zein CO, Levy C, Basu A, Zein NN: Chronic hepatitis ... http://www.virologyj.com/content/6/1/110 Conclusion Competing interests The findings in this study showed a significant prevalence of Hepatitis C virus infection among individuals with possible genetic predisposition...

Ngày tải lên: 12/08/2014, 04:21

6 291 0
Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti ... participated in data collection and Statistical analysis GE Participated in drafting of the study design NS Participated in study coordination GP Participated in Data collection EO Contributed in ... being infected with HCV might suffer from insulin resistance resulting in more adverse effects of diabetes than those with HCV infection alone It was observed from this study that the occurrence...

Ngày tải lên: 12/08/2014, 04:22

5 209 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot

... inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hepatitis and such cytokines induce insulin resistance and glucose intolerance which could consequently cause ... G, Schattner A: Increased risk of type diabetes in noncirrhotic patients with chronic hepatitis C virus infection Mayo Clin Proc 2000, 75:355-359 Zein CO, Levy C, Basu A, Zein NN: Chronic hepatitis ... http://www.virologyj.com/content/6/1/110 Conclusion Competing interests The findings in this study showed a significant prevalence of Hepatitis C virus infection among individuals with possible genetic predisposition...

Ngày tải lên: 12/08/2014, 04:22

6 245 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... Doroudi T: The efficacy of blood donor screening in reducing the incidence of hepatitis C virus infection among thalassemic patients in Iran Transfusion Today 2002, 53:3-4 Alavian SM, Einollahi B, Hajarizadeh ... between hepatitis C virus genotypes and sources of infection in patients with chronic hepatitis C J Infect Dis 1995, 171:1607-1610 Dal Molin G, Ansaldi F, Biagi C, D'agaro P, Comar M, Croce L, ... Pistello M, Maggi F, Vatteroni L, Cecconi N, Panicucci F, Bresci GP, Bailly F, Wang QS, Martin JL, Trepo C: Prevalence of hepatitis C virus genotypes in Italy J Clin Microbiol 1994, 32:232-234 Ohno...

Ngày tải lên: 13/08/2014, 13:20

6 337 0
Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

... Antibodies to Hepatitis C BCP Basal Core Promoter cccDNA Covalently Closed Circular DNA CHC Chronic hepatitis C CMIA Chemiluminescent Microparticle Immunoassay EIA Enzyme Immunoassay ETV Entecavir FDA ... are currently infected with HCV infection, which is causing chronic liver diseases, inflammation, and long-term complications HCV infection is a public health problem in developing countries including ... evidence of HBV infection and 2%-7% are chronic carriers Many infections occur in adolescent and adults, but infection during infancy and children still contribute at high rate In low HBV prevalence...

Ngày tải lên: 03/03/2015, 21:05

64 465 0
Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

... tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta ... HHV-6A, HCV, and HIV Virus Primer Sequence (5' to 3') Reference HCV HCV HCV HCV HIV HIV HIV HHV-6 HHV-6 HCV 9.1 HCV 9.2 HCV 10.1 HCV 10.2 Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag ... Figure Cytopathic effects in CEM cells Cytopathic effects in CEM cells This picture represents the commonly observed cytopathic effects in triply-infected CEM cells Large cells are seen with increasing...

Ngày tải lên: 18/06/2014, 18:20

8 410 0
Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx

Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx

... tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta ... HHV-6A, HCV, and HIV Virus Primer Sequence (5' to 3') Reference HCV HCV HCV HCV HIV HIV HIV HHV-6 HHV-6 HCV 9.1 HCV 9.2 HCV 10.1 HCV 10.2 Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag ... Figure Cytopathic effects in CEM cells Cytopathic effects in CEM cells This picture represents the commonly observed cytopathic effects in triply-infected CEM cells Large cells are seen with increasing...

Ngày tải lên: 20/06/2014, 01:20

8 446 0
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... drugs (> years) increased the risk of HCV Recent Table 1: Prevalence of HIV and hepatitis C virus (HCV) infections among injection drug users in Vinnitsya, Ukraine HIV status # (%) HCV status # (%) ... continuous factors associated with HIV and hepatitis C virus (HCV) infections among injection drug users in Vinnitsya, Ukraine (Mean ± SD; p-value for significance of mean differences using Student's ... for HCV co-infection in HIV prevention and treatment programs Antiretroviral therapy for HIV and interferon/ribavirin schemes for HCV have proven effective in reducing mortality and increasing...

Ngày tải lên: 11/08/2014, 18:20

9 331 0
Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

... Positive predictive evidence early in the course of treatment could be used for reinforcing the importance of compliance in ensuring a successful outcome Conversely, negative predictive capability ... R, Sacchi P, Ciappina V, Zochetti C, Patruno S, Maiocchi L, Filice G: Viral dynamics and pharmacokinetics of peginterferon alpha-2a and peginterferon alpha-2b in naive patients with chronic hepatitis ... H: Early viral kinetics and treatment outcome in combination of high-dose interferon induction vs pegylated interferon plus ribavirin for naive patients infected with hepatitis C virus of genotype...

Ngày tải lên: 13/08/2014, 13:20

5 322 0
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

... (accession no AB093555) were 5¢-AAGCCATGATGAGCAACCTC-3¢ and 5¢-GTGTCC TGTTCCTTCCTCCAC-3¢ The sequences of sense and antisense primers for RIG-I (accession no NM_014314) were 5¢-AATGAAAGATGCTCTGGATTACTTG-3¢ ... (T-pIC and M-pIC) In T-pIC treatment, RIG-I and MDA5 mRNAs were clearly induced in PH5CH8 and HuH-7 cells, and TLR3 mRNA was induced only in PH5CH8 cells Moreover, there was no such induction in ... arrowheads indicate Cardif and the cleaved Cardif, respectively (B) Cardif is cleaved by NS3-4A in the cured Oc cells The Oc cells were cotransfected with the myc-Cardif (wild-type or mutant C5 08A)...

Ngày tải lên: 18/02/2014, 16:20

16 524 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...

Ngày tải lên: 20/02/2014, 01:20

15 598 0
w