Hepatitis c infection in kidney transplant candidates and recipients

Báo cáo y học: "Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa" pdf

Báo cáo y học: "Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa" pdf

... resolutive HBV infection, HBV/HCV co-infected with overt HBV infection (HBsAg positives) and < /b> HBV/HCV co-infected with occult HBV infection (HBsAg negatives) The 30 patients with uncertain HBV status ... E, Coppola N, Scolastico C, Filippini P, Santantonio T, Stroffolini T, Piccinino F: Virologic and < /b> clinical expressions of < /b> reciprocal inhibitory effect of <...

Ngày tải lên: 12/08/2014, 01:21

6 516 0
Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot

Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot

... correlation between these two infections, which could influence the evolution of these diseases [11,12] Parallel and overlapping HIV and blood borne hepatitis < /b> epidemics in Africa and Influence ... parity and socio-demographic characteristics There was a low prevalence of Anti-HCV Authors' contributions RME and AAD carried out the clinical study and participated in the s...

Ngày tải lên: 18/06/2014, 18:20

3 400 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot

báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot

... data management, analyzed and interpreted the data, drafted the manuscript; EJ participated in the design of the study, collected the data and performed the statistical analysis BD and VM: participated ... regarding the psychosocial and physical impact of kidney transplantation [4,5] Kidney transplantation is the therapy of choice for endstage renal failure...

Ngày tải lên: 18/06/2014, 19:20

12 520 0
Báo cáo hóa học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" doc

Báo cáo hóa học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" doc

... correlation between these two infections, which could influence the evolution of these diseases [11,12] Parallel and overlapping HIV and blood borne hepatitis < /b> epidemics in Africa and Influence ... parity and socio-demographic characteristics There was a low prevalence of Anti-HCV Authors' contributions RME and AAD carried out the clinical study and participated in the s...

Ngày tải lên: 20/06/2014, 01:20

3 353 0
Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx

Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx

... is of little utility as a diagnostic tool because a high percentage of patients with chronic HCV infection display serum RF reactivity, and the frequency of RF increases in patients with articular ... Available online http:/ /arthritis- research.com/content/6/2/R137 Table Table Clinical and demographic characteristics of patients with RA Clinical and demographic charac...

Ngày tải lên: 09/08/2014, 01:23

5 313 0
Báo cáo y học: "Pancytopenia and atrial fibrillation associated with chronic hepatitis C infection and presumed hepatocellular carcinoma: a case report" pot

Báo cáo y học: "Pancytopenia and atrial fibrillation associated with chronic hepatitis C infection and presumed hepatocellular carcinoma: a case report" pot

... reported cases of acquired pancytopenia associated with viral hepatitis have occurred in the context of acute hepatitis rather than chronic infection, with bone marrow biopsy usually revealing a markedly ... indicated the abdomen Magnetic resonance imaging scan ofby the arrow with a Magnetic resonance imaging scan of the abdomen with a hepatocellular carcinoma indicat...

Ngày tải lên: 11/08/2014, 21:22

3 213 0
Báo cáo y học: "Occult Hepatitis B Infection in Egyptian Chronic Hepatitis C Patients: Prevalence, Impact on Pegylated " doc

Báo cáo y học: "Occult Hepatitis B Infection in Egyptian Chronic Hepatitis C Patients: Prevalence, Impact on Pegylated " doc

... to infection Conclusions In conclusion, detection of HBV DNA in HBsAg negative Egyptian chronic HCV patients is not a statistically significant cause of non-response of those patients to the current ... HBV: Hepatitis < /b> B Virus; HCC: Hepatocellular Carcinoma; HCV: Hepatitis < /b> C Virus; IU: International Unit; NR: Non-Responder; OBI: Occult Hepatitis < /b> B Infectio...

Ngày tải lên: 12/08/2014, 02:20

8 368 0
Báo cáo y học: "Adoptive transfer of splenocytes to study cell-mediated immune responses in hepatitis C infection using HCV transgenic mice" pptx

Báo cáo y học: "Adoptive transfer of splenocytes to study cell-mediated immune responses in hepatitis C infection using HCV transgenic mice" pptx

... the clinical course of hepatitis C infection HCV- specific CD4+ T cells are involved in eradication of the virus in acute infection but their responses are weak and insufficient in chronic hepatitis ... Adoptive transfer of splenocytes to study cell-mediated immune responses in hepatitis C infection using HCV transgenic mice Comparative Hep...

Ngày tải lên: 13/08/2014, 13:20

13 365 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGAT...

Ngày tải lên: 18/06/2014, 18:20

12 354 0
Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx

Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx

... Bracho MA, Carrillo-Cruz FY, Ortega E, Moya A, González-Candelas F: A new subtype of hepatitis C virus genotype 1: complete genome and phylogenetic relationships of an Equatorial Guinea isolate ... and participated in proofreading of the manuscript; FG -C coordinated the study, interpreted data, co-performed phylogenetic and genetic analyses and participate...

Ngày tải lên: 20/06/2014, 01:20

7 435 0
Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

... to data analysis and preparation of manuscript HO'S performed all the experiments and contributed to data analysis and preparation of manuscript CM contributed to the experiments and data analysis ... outer forward, OF (I), ATGGCATGGGATATGAT; outer reverse, OR (I), AAGGCCGTCCTGTTGA; inner forward, IF (I), GCATGGGATATGATGATGAA; inner reverse, IR (I), GTCCTGTTGATGTGCCA The PCR rea...

Ngày tải lên: 20/06/2014, 01:20

9 288 0
Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

... welladapted variant in these sites of < /b> replication AA: amino acids; ALT: alanine aminotransferase; AP: alkaline phosphatase; AST: aspartate aminotransferase; D: aspartic acid; DL-DNA: duplex linear DNA; ... extrahepatic patterns of < /b> HBV infection in a patient who was also infected with HIV and who was participating in a prospective study of < /b> acute hepatitis <...

Ngày tải lên: 11/08/2014, 17:21

7 348 0
Báo cáo y học: "Acute respiratory failure in kidney transplant recipients: a multicenter study" ppt

Báo cáo y học: "Acute respiratory failure in kidney transplant recipients: a multicenter study" ppt

... Cockwell P, Adu D, Ball S, Little MA, Ready A, Wheatley K, Borrows R: Calcineurin inhibitor sparing with mycophenolate in kidney transplantation: a systematic review and meta-analysis Transplantation ... healthcare system during dialysis and transplantation-related assessments Invasive fungal infections were associated with mortality in our study Candidiasis and aspergillosis are kno...

Ngày tải lên: 14/08/2014, 07:21

10 302 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

... Sustained eradication < /b> of < /b> hepatitis < /b> C < /b> virus < /b> by < /b> low-dose < /b> long-term < /b> interferon < /b> therapy < /b> in < /b> a < /b> renal < /b> transplant < /b> recipient < /b> with < /b> dual < /b> infection < /b> with < /b> hepatitis < /b> B and C < /b> viruses: a < /b> case report Journal of < /b> ... therapy < /b> [9,10] Attempt...

Ngày tải lên: 10/08/2014, 23:21

4 283 0
w