... Kok FJ: The role of hepatitis B and hepatitis C viral infections in incidence of hepatocellular carcinoma in Sudan Transactions of the Royal Society of Tropical Medicine and Hygiene 2001, 95:487-491 ... usually practiced in Nyala Teaching Hospital blood bank as a preliminary screening test and thereby the risk of transfusing infected blood and establishment of new foci of infection exist In this ... that include direct blood contact might contribute the transmission of these viruses Conclusion The study concluded that the seroprevalence of HBV (6.25%) and HCV (0.65%) was in an intermediate and...
Ngày tải lên: 12/08/2014, 04:20
... normal colon tissue of CRC patients and colon carcinoma tissue were analyzed Fourteen samples (three from peripheral blood, five samples of unaffected colon, and six samples originating from carcinoma ... (healthy controls and carcinoma patients) compared to tissue samples (unaffected colon and carcinoma tissue, ** p < 0.0001) (B) HAC/PBGD was higher in blood samples of healthy controls than in samples ... of carcinoma patients, unaffected colonic mucosa, carcinoma tissue) one has to keep in mind the differences in sample sizes and applied tests The highly significant difference in CD between blood...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot
... two infections, which could influence the evolution of these diseases [11,12] Parallel and overlapping HIV and blood borne hepatitis epidemics in Africa and Influence of maternal (HIV) co-infection ... Journal 2007, 4:104 http://www.virologyj.com/content/4/1/104 mangers and health planners, so as to initiate the relevant vaccine and screening packages in the antenatal care clinics While, much ... prevalence of Anti-HCV Authors' contributions RME and AAD carried out the clinical study and participated in the statistical analysis and procedures, MAE participated in the analysis, IA coordinated...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" doc
... two infections, which could influence the evolution of these diseases [11,12] Parallel and overlapping HIV and blood borne hepatitis epidemics in Africa and Influence of maternal (HIV) co-infection ... Journal 2007, 4:104 http://www.virologyj.com/content/4/1/104 mangers and health planners, so as to initiate the relevant vaccine and screening packages in the antenatal care clinics While, much ... prevalence of Anti-HCV Authors' contributions RME and AAD carried out the clinical study and participated in the statistical analysis and procedures, MAE participated in the analysis, IA coordinated...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx
... polar amino acids in all samples Among polar amino acids positively charged amino acids were greater than negatively charged amino acid thus making it a basic stretch that might be involved in interacting ... Predictors of the efficacy of interferon therapy in chronic hepatitis C virus infection Tokyo-Chiba Hepatitis Research Group 1997, 113:558-66 Kaufman RJ: The Double-stranded RNA- activated Protein ... acids in sustained responders [11] In our local 3a strains, substitutions in rapid responder were found in hydrophilic amino acid histidine which was replaced by a neutral amino acid glutamine...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo khoa học: " Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats" pptx
... vaccination against hepatitis C virus (HCV): effect of expressing different forms of HCV E2 protein and use of CpGoptimized vectors in mice Vaccine 2002, 20:3263-3271 Lechmann M, Liang TJ: Vaccine ... needle injection and blood product hygiene Thus, development of a vaccine capable of preventing chronic HCV infection, if not preventing infection altogether, is essential for the control of HCV ... purified Caprine anti-HCV mono-specific IgG Following a washing step, using 0.05% (v/v) PBS-T20 (pH 7.2), and non specific binding sites was blocked by incubation with 0.2% Bovine serum albumin in...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"
... cryptogenic cirrhosis JAMA 2003;289(22):3000-4 Scheen AJ, Luyckx FH Nonalcoholic steatohepatitis and insulin resistance: interface between gastroenterologists and endocrinologists Acta Clin Belg ... the hepatitis C virus, in and of itself, can directly induce cytoplasmic lipid accumulation Further studies examining the genotype virus are warranted to further recognize the process involved in ... non-alcoholic steatohepatitis and certainly in our patients with HCV and metabolic steatosis HCV-Induced Steatosis The presence of steatosis on liver biopsy in patients with hepatitis C is more...
Ngày tải lên: 02/11/2012, 09:51
Arsenic speciation in environmental and biological samples extraction and stability studies
... found in rice, chicken, fish and soil, after acid digestion of raw samples and determination by HG-AFS, and the percentage of total arsenic in each extract The total arsenic in each extract was ... Analytica Chimica Acta 495 (2003) 85–98 Fig HPLC–ICP-MS chromatograms for chicken: (a) anionic column and (b) cationic column (as As) is given as a percentage of the total arsenic in the extract ... using M phosphoric acid as an extractant [14] No significant differences among species extraction were found for both soils as had occurred in the rice, chicken and fish samples Fig HPLC–ICP-MS chromatogram...
Ngày tải lên: 15/03/2014, 23:49
Báo cáo hóa học: "Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma" potx
... sequences used for CEA identification were: 5’-CCTGAAATGAAGAAACTACACCAGGGC-fluorescein and 5’-LC-Red 640-GCTATATCAGAGCAACCCCAACCAGCphosphate Real-time PCR monitoring was achieved by measuring the ... sequences used for GAPDH identification were: 5’-TCAACAGCGACACCCACTCCTfluorescein and 5’-LC-Red 640-CACCTTTGACGCT GGGGCT-phosphate Determination of CEA in serum samples Pre-operative serum samples ... http://www.translational-medicine.com/content/8/1/107 Cell lines To prepare for CEA-specific RT-PCR, two cell lines, SW-480 (colon cancer cell line) and SC-7901 (gastric cancer cell line) were used Lymphocytes were collected...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... gccagcccccuguugggggcgacacuccaccauagaucacuccccugugaggaacuacugucuucacgcagaaag domain I g g domain II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
... CTGCTGAATTTCCCAAAGAGGGCC BV19 TCCTCTCACTGTGACATCGGCCCA BV20 TGCCCCAGAATCTCTCAGCCTCCA BV21 GGAGTAGACTCCACTCTCAAG BV22 ATTCTGAACTGAACATGAGCTCCT BV24 GACATCCGCTCACCAGGCCTG BJ1.1 TCTGGTGCCTTGTCCAAAGAAAGC BJ1.2 CCTGTCCCCGAACCGAAGGTGTA ... BJ2.1 CCGTGTCCCTGGCCCGAAGAACTG BJ2.2 CTAGAGCCTTCTCCAAAAAACAGC BJ2.3 GGGTGCCTGGGCCAAAATACTGCG BJ2.4 GGGTCCCGGCGCCGAAGTACTGAA BJ2.5 CGCGTGCCTGGCCCGAAGTACTGG BJ2.6 GCTGCCGGCCCCGAAAGTCAGGAC BJ2.7 ... BV-, C - and BJ-specific primers PRIMER SEQUENCE CB1A GGGTGTGGGAGATCCTGC BV1 CCGCACAACAGTTCCCTGACTTGC BV3 CGCTTCTCCCTGATTCTGGAGTCC BV4 TTCCCATCAGCCGCCCAAACCTAA BV5 GATCAAAACGAGAGGACAGC BV6A GATCCAATTTCAGGTCATACTG...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "Endothelial progenitor cell biology in disease and tissue regeneration" doc
... marrow in response to paracrine signals generated by ischemic tissue and tumor cells including GM-CSF and VEGF, which play a critical role in mobilization of EPCs to ischemic tissues and tumors ... revascularization of ischemic and tumor tissues [7] Indeed previous clinical correlations have reported an increase in EPC circulation in breast, ovarian and pancreatic cancer patients with a positive correlation ... progression In tumors and ischemic tissues EPCs have a direct structural role of differentiating into mature endothelial cells and an indirect paracrine effect by secreting angiogenic factors Hypoxia in...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot
... detectable serum HCV -RNA The clinical relevance of this phenomenon is unclear Chemotherapy has been shown to increase serum transaminase concentrations in HCVRNA positive patients, an increase thought ... NH, Gerlach JT, Jung MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, Cerny A, Pape GR: Association of hepatitis C virus-specific CD8+ T cells with ... abbreviations HCV: Hepatitis C virus: RNA: Ribonucleic acid: ALT: Alanine aminotransferase: AST: Aspartate aminotransferase: ERCP: Endoscopic retrograde cholangiopancreatography Table 1: Selected blood...
Ngày tải lên: 11/08/2014, 10:22
báo cáo khoa học: " Musings on genome medicine: Hepatitis C David G Nathan and Stuart H Orkin" ppsx
... IL28B gene that encodes interferon lambda predicts both spontaneous clearance of HCV and response to interferon and ribavirin treatment in geno type hepatitis C infection Clearance and response to ... results were seen in those infected with viral genotype 1, which accounts for 65% of US cases of hepatitis C including the bulk of Caucasian and the vast majority of American Black patients [8] ... resemble the cytokine-releasing consequences of cancer chemotherapy, and the hemolytic anemia induced by ribavirin weakens patients still further American patients with genotype continue to respond...
Ngày tải lên: 11/08/2014, 12:20
Analysis of Pesticides in Food and Environmental Samples - Chapter 1 doc
... blockade of the g-aminobutyric acid-gated chlorine channels, inducing convulsions in insects 1.5.2.2 Inhibitors of Cholinesterase The target for many insecticides is an enzyme called acetylcholinesterase ... Name IUPAC Name Aldrin C1 2H8Cl6 p,p0 -DDT C1 4H9Cl5 Dieldrin C1 2H8Cl6O Dicofol C1 4H9Cl5O Endosulfan C9 H6Cl6O3S g-HCH C6 H6Cl6 Methoxychlor C1 6H15Cl3O2 Tetradifon C1 2H6Cl4O2S 1,2,3,4,10,10-Hexachloro-1,4,4a,5,8,8a-hexahydro-exo1,4-endo-5,8-dimethanonaphthalene ... Agrotecnicas S.L., 1997 a 25 8C 1.3.3 ORGANOCHLORINES Cl Cl O Cl Cl SO O Cl Cl CH CCl3 Cl Endosulfan ß 2007 by Taylor & Francis Group, LLC p,pЈ-DDT Cl These insecticides are characterized by three kinds...
Ngày tải lên: 12/08/2014, 04:22
Analysis of Pesticides in Food and Environmental Samples - Chapter 2 pdf
... CH3OH CH3OH CH3 H CH3 Cl N C O O + Cl N O C N CH3 O Cl CO2 + CH3OH O H O H CH3 N Cl H O H Supercritical fluid H H O O H O H O CH3 + Cl N C CH3 N O Cl H H H O O O CH3 CH3 CH3 FIGURE 2.3 Mechanisms ... LLC accessible Its main drawback is its apolar character, limiting its applicability to the extraction of hydrophobic compounds In order to overcome, at least to a certain extent, this drawback, ... hydrophobic interactions, but the presence of aromatic rings within the polymeric network leads to strong p–p* interactions with the aromatic rings present in the chemical structure of many pesticides...
Ngày tải lên: 12/08/2014, 04:22
Analysis of Pesticides in Food and Environmental Samples - Chapter 4 ppt
... methods in microarrays employ various techniques including fluorescence, luminescence, visible, electrochemical, Raman scattering, ß 2007 by Taylor & Francis Group, LLC SPR, and electrochemiluminescence, ... information such as assay precision, accuracy, detection limit, as well as overall method precision (including sample preparation and= or cleanup), accuracy, and detection limit when evaluating and interpreting ... reagents As the speci c species is captured, the mass on the chip surface increases and changes the speci c reflection angle In this technique, a herbicide such as atrazine may be detected in several...
Ngày tải lên: 12/08/2014, 04:22
Analysis of Pesticides in Food and Environmental Samples - Chapter 5 pdf
... assurance program, which must also include the staff training, * Co-operation on International Traceability in Analytical Chemistry y International Standard Organisation z International Electrotechnical ... (analytical sample) may be incorrectly selected Sample processing Decomposition of analyte during sample processing, cross-contamination of the samples Extraction=cleanup Incomplete recovery of ... providing clear instructions for the actual sampling operation including packing and shipping of samples The sampling method depends on the objectives of the analysis, and hence the sampling plan and...
Ngày tải lên: 12/08/2014, 04:22
Analysis of Pesticides in Food and Environmental Samples - Chapter 8 pdf
... Benzimidazoles Multiclass-fungicides Multiclass-insecticides Organochlorines Organophosphorus Pyrethroids Multiclass-fungicides Carbamates Multiclass-insecticides Multiclass-fungicides Carbamates, Pyrethroids ... Organochlorines Multiclass-insecticides Organochlorines Carbamates Organochlorines Pyrethroids Organochlorines Organophosphorus Multiclass-fungicides Solvent Methanol Acetone Ethyl acetate Acetone ... TABLE 8.5 Cleanup Techniques Used in the Analysis of Insecticides and Fungicides Class Insecticides Organochlorines Organophosphorus Pyrethroids Multiclass Fungicides Strobilurins Technique Solvent...
Ngày tải lên: 12/08/2014, 04:22