Cu based organic frameworks as catalysts for c c and c n coupling reactions

... including Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY) and Cu( BDC); ii)Catalytic studies of Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY) on C C coupling reactions between amine compounds ... measurements CHAPTER CATALYTIC STUDIES OF Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY), Cu( BDC) ON C C AND C N COUPLING REACTIONS 3.1 Introduction  Cu3...

Ngày tải lên: 18/06/2015, 17:07

... NGUYEN THI LE LIEN METAL- ORGANIC FRAMEWORKS IRMOF- 8, ZIF -9, MOF1 99 AND IRMOF- 3 AS CATALYSTS FOR THE FRIEDEL CRAFTS ACYLATION, KNOEVENAGEL, AZA- MICHAEL AND PAAL- KNORR REACTIONS Major: Organic chemical ... measurements, given the high surface area materials of the four MOFs synthesized in this study The four MOFs: IRMOF- 8, ZIF -9, MOF...

Ngày tải lên: 20/05/2016, 15:58

... reaction and Paal-Knorr reaction, by IRMOF-8, ZIF-9, MOF-199, IRMOF-3, respectively CHAPTER EXPERIMENTAL 2.1 Synthesis of MOF catalysts Four types of MOFs- IRMOF-8, ZIF-9, MOF-199, and IRMOF-3 ... reaction For the development of greener processes, moisture-insensitive and easy handling solid acid catalysts are desired Furthermore, the use of solid acid catalysts off...

Ngày tải lên: 10/05/2014, 21:59

... products and services Community- Based Social Marketing as a Planning Tool September/2002 Page 17 Chapter Community- Based Social Marketing 4. 1- Social Marketing The term social marketing was coined ... Community- Based Social Marketing as a Planning Tool Community- Based Social Marketing as a Planning Tool September/2002 Page v...

Ngày tải lên: 29/03/2014, 23:20

... article as: Visoottiviseth et al.: Cross-layer based adaptive wireless traffic control for per-flow and per-station fairness EURASIP Journal on Wireless Communications and Networking 2011 2011:97 Submit ... prioritized ACK scheme; WLAN-ATC: wireless LAN adaptive traffic control; WLANs: wireless local area networks; WTC: wireless traffic control Author de...

Ngày tải lên: 20/06/2014, 22:20

... with lupus disease activity indices or other clinical features was determined High IFN scores were positively associated with increased disease activity as indicated by the SLEDAI and the Systemic ... B-lymphocyte activating factor in systemic lupus erythematosus and rheumatoid arthritis in relation to autoantibody levels, disease measures and time Lupus 2006, 15:570-576...

Ngày tải lên: 09/08/2014, 14:22

... doi:10.1186/1743-422X-7-13 Cite this article as: Ho et al.: Establishment of one-step SYBR greenbased real time-PCR assay for rapid detection and quantification of chikungunya virus infection Virology Journal 2010 ... Page of Figure One-step SYBR green-based RT-PCR for detection of CHIKV infection (A) Amplification profile and (B) the standard cur...

Ngày tải lên: 12/08/2014, 04:21

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGA...

Ngày tải lên: 14/08/2014, 16:21

... POLYMERIC MEMBRANES BASED ON CO2- PHILIC MATERIALS FOR HYDROGEN PURIFICATION AND FLUE GAS TREATMENT CHEN HANG ZHENG (B Eng., National University of Singapore, Singapore) A THESIS SUBMITED FOR ... 687-689 [7] Song C, Introduction to hydrogen and syngas production and purification technologies In: Liu K, Song C, Subramani V, editors Hydrogen and syngas p...

Ngày tải lên: 09/09/2015, 17:55

... AN INDOOR POSITIONING SYSTEM BASED ON ROBUST LOCATION FINGERPRINT FOR WI- FI AND BLUETOOTH A.K.M MAHTAB HOSSAIN (B Sc., Bangladesh University of Engineering & Technology (BUET), M Eng., Asian ... Justification of SSD as a robust fingerprint 58 4.3.3 Comparison of SSD and RSS as Location Fingerprint 61 4.3.4 Comparison of SSD with Other Robust Location Fing...

Ngày tải lên: 14/09/2015, 08:25

... methanol and M ammonium hydroxide [36] A study on continuous process for development of biodiesel by porous zirconia, titania and alumina micro particulate for simultaneous esterification and transesterification ... have shown conversion ranging from 85% to 95% and have taken longer reaction time for completion of reaction and thus will need further modification for a h...

Ngày tải lên: 08/10/2015, 23:24

... of cross- coupling reactions of aryl halides in the processes of C C, C N and C S bond forming reactions In this dissertation, we have developed new cross- coupling protocols for the synthesis of ... Suzuki and Heck couplings) reactions under mild conditions   Chapter 2: Decarboxylative C S Cross- Coupling CHAPTER Synthesis of Vinyl Sulfides by Copper -Catal...

Ngày tải lên: 10/09/2015, 15:50

... RUTHENIUM CARBONYL COMPLEXES AS HOMOGENEOUS CATALYSTS FOR X- H ACTIVATION (X = C, N, O, Si) TAN SZE TAT (B.Sc (HONS), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT ... Catalysis 1.2 Ruthenium Carbonyl Complexes as Catalysts 1.2.1 Mononuclear Ruthenium (0) Complexes 10 1.2.2 Halogencarbonyl Ruthenium Complexes 15...

Ngày tải lên: 09/09/2015, 18:57

... caprolactam, and other volatile organic compounds (VOCs) and semivolatile organic compounds (SVOC) APRIL 30, 2007 Environmental, Health, and Safety Guidelines LARGE VOLUME PETROLEUM-BASED ORGANIC CHEMICALS ... processing, handling, storage and transport of primary feedstock and final products in VCM manufacture Environmental, Health, and Safety Guideline...

Ngày tải lên: 14/02/2014, 03:20

... 113 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... This bulletin contains information about the computer-based and paper-based formats of the test A separate Registration and Information Bulletin is available about TOEFL Inte...

Ngày tải lên: 02/04/2014, 05:20