Cu based organic frameworks as catalysts for c c and c n coupling reactions
tóm tắt luận án cu based organic frameworks as catalysts for c c and c n coupling reactions (tiếng anh)
... including Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY) and Cu( BDC); ii)Catalytic studies of Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY) on C C coupling reactions between amine compounds ... measurements CHAPTER CATALYTIC STUDIES OF Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY), Cu( BDC) ON C C AND C N COUPLING REACTIONS 3.1 Introduction Cu3...
Metal organic frameworks IRMOF 8, ZIP 9, MOF 199 and IRMOF 3 as catalysts for the friedel crafts acylation, knoevenagel, aza michael and paal knorr reactions
... NGUYEN THI LE LIEN METAL- ORGANIC FRAMEWORKS IRMOF- 8, ZIF -9, MOF1 99 AND IRMOF- 3 AS CATALYSTS FOR THE FRIEDEL CRAFTS ACYLATION, KNOEVENAGEL, AZA- MICHAEL AND PAAL- KNORR REACTIONS Major: Organic chemical ... measurements, given the high surface area materials of the four MOFs synthesized in this study The four MOFs: IRMOF- 8, ZIF -9, MOF...
metal-organic framworks irmof-8, zif-9, mof-199 and irmof-3 as catalysts for friedel-crafts acylation, knoevenagel, azamichel and pall-knorr reactions
... reaction and Paal-Knorr reaction, by IRMOF-8, ZIF-9, MOF-199, IRMOF-3, respectively CHAPTER EXPERIMENTAL 2.1 Synthesis of MOF catalysts Four types of MOFs- IRMOF-8, ZIF-9, MOF-199, and IRMOF-3 ... reaction For the development of greener processes, moisture-insensitive and easy handling solid acid catalysts are desired Furthermore, the use of solid acid catalysts off...
Community-Based Social Marketing as a Planning Tool - Community and Regional Planning Masters Project pptx
... products and services Community- Based Social Marketing as a Planning Tool September/2002 Page 17 Chapter Community- Based Social Marketing 4. 1- Social Marketing The term social marketing was coined ... Community- Based Social Marketing as a Planning Tool Community- Based Social Marketing as a Planning Tool September/2002 Page v...
Báo cáo hóa học: " Cross-layer based adaptive wireless traffic control for per-flow and per-station fairness" ppt
... article as: Visoottiviseth et al.: Cross-layer based adaptive wireless traffic control for per-flow and per-station fairness EURASIP Journal on Wireless Communications and Networking 2011 2011:97 Submit ... prioritized ACK scheme; WLAN-ATC: wireless LAN adaptive traffic control; WLANs: wireless local area networks; WTC: wireless traffic control Author de...
Báo cáo y học: "Biomarkers as tools for improved diagnostic and therapeutic monitoring in systemic lupus erythematosis" potx
... with lupus disease activity indices or other clinical features was determined High IFN scores were positively associated with increased disease activity as indicated by the SLEDAI and the Systemic ... B-lymphocyte activating factor in systemic lupus erythematosus and rheumatoid arthritis in relation to autoantibody levels, disease measures and time Lupus 2006, 15:570-576...
Báo cáo khoa học: " Establishment of one-step SYBR green-based real time-PCR assay for rapid detection and quantification of chikungunya virus infection" pps
... doi:10.1186/1743-422X-7-13 Cite this article as: Ho et al.: Establishment of one-step SYBR greenbased real time-PCR assay for rapid detection and quantification of chikungunya virus infection Virology Journal 2010 ... Page of Figure One-step SYBR green-based RT-PCR for detection of CHIKV infection (A) Amplification profile and (B) the standard cur...
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGA...
Polymeric membranes based on CO2 philic materials for hydrogen purification and flue gas treatment
... POLYMERIC MEMBRANES BASED ON CO2- PHILIC MATERIALS FOR HYDROGEN PURIFICATION AND FLUE GAS TREATMENT CHEN HANG ZHENG (B Eng., National University of Singapore, Singapore) A THESIS SUBMITED FOR ... 687-689 [7] Song C, Introduction to hydrogen and syngas production and purification technologies In: Liu K, Song C, Subramani V, editors Hydrogen and syngas p...
An indoor positioning system based on robust location fingerprint for wi fi and bluetooth
... AN INDOOR POSITIONING SYSTEM BASED ON ROBUST LOCATION FINGERPRINT FOR WI- FI AND BLUETOOTH A.K.M MAHTAB HOSSAIN (B Sc., Bangladesh University of Engineering & Technology (BUET), M Eng., Asian ... Justification of SSD as a robust fingerprint 58 4.3.3 Comparison of SSD and RSS as Location Fingerprint 61 4.3.4 Comparison of SSD with Other Robust Location Fing...
Latest developments on application of heterogenous basic catalysts for an efficient and eco friendly synthesis of biodiesel
... methanol and M ammonium hydroxide [36] A study on continuous process for development of biodiesel by porous zirconia, titania and alumina micro particulate for simultaneous esterification and transesterification ... have shown conversion ranging from 85% to 95% and have taken longer reaction time for completion of reaction and thus will need further modification for a h...
Development of transition metal catalyzed c s and c c cross coupling reactions
... of cross- coupling reactions of aryl halides in the processes of C C, C N and C S bond forming reactions In this dissertation, we have developed new cross- coupling protocols for the synthesis of ... Suzuki and Heck couplings) reactions under mild conditions Chapter 2: Decarboxylative C S Cross- Coupling CHAPTER Synthesis of Vinyl Sulfides by Copper -Catal...
Ruthenium carbonyl complexes as homogeneous catalysts for x h activation (x = c, n, o, si
... RUTHENIUM CARBONYL COMPLEXES AS HOMOGENEOUS CATALYSTS FOR X- H ACTIVATION (X = C, N, O, Si) TAN SZE TAT (B.Sc (HONS), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT ... Catalysis 1.2 Ruthenium Carbonyl Complexes as Catalysts 1.2.1 Mononuclear Ruthenium (0) Complexes 10 1.2.2 Halogencarbonyl Ruthenium Complexes 15...
Tài liệu Environmental, Health and Safety Guidelines for Large Volume Petroleum-based Organic Chemicals Manufacturing pptx
... caprolactam, and other volatile organic compounds (VOCs) and semivolatile organic compounds (SVOC) APRIL 30, 2007 Environmental, Health, and Safety Guidelines LARGE VOLUME PETROLEUM-BASED ORGANIC CHEMICALS ... processing, handling, storage and transport of primary feedstock and final products in VCM manufacture Environmental, Health, and Safety Guideline...
Testof English as a Foreign Language™ Information and Registration BULLETIN for Computer-based and Paper-based Testing pptx
... 113 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... This bulletin contains information about the computer-based and paper-based formats of the test A separate Registration and Information Bulletin is available about TOEFL Inte...
Từ khóa:
- heteropolyacids as catalysts for mtbe synthesis
- an approach to sociocultural aspects as catalysts for urban redevelopment
- stem progenitor cell clones as models for neural development and transplantation
- dpp 4 activity as bm for dose selection and go nogo decisions
- cdk as targets for cancer therapy and imaging
- vesicular arbuscular endomycorrhizae as determinants for plant growth and survival
- what s wrong with procedural based languages such as c
- borazine based precursors for si b c n ceramics
- polyborosilazanes as precursors for si b c n ceramics