The dark side of transformational leadership a critical perspective
The Dark Side of Universal Banking: Financial Conglomerates and the Origins of the Subprime Financial Crisis
... EPICENTER OF THE SUBPRIME FINANCIAL CRISIS .1043 IV CONCLUSION AND POLICY IMPLICATIONS 1046 The Dark Side of Universal Banking: Financial Conglomerates and the Origins of the Subprime Financial ... NUMBER Article The Dark Side of Universal Banking: Financial Conglomerates and the Origins of the Subprime Financial Crisis ARTHUR E WILMARTH, JR Since the subprime financial crisis began in ... around the world The immediate trigger of the crisis was the end of the housing booms in the United States and other countries and the associated problems in mortgage markets, notably the 206...
- 89
- 528
- 0
Báo cáo khoa học: Oxidative neuronal injury The dark side of ERK1/2 potx
... the cell type expressing activated ERK1/2 Although most acute neuronal injury studies focus upon neuronal expression of phospho -ERK1/2, activation of this kinase in surrounding glial or endothelial ... regulating ERK1/2 signaling through effects on scaffolding functions of Ó FEBS 2004 b-arrestins, or by modulating the activity of protein kinase C, which can activate Raf isoforms at the apex of the ERK1/2 ... Sequestration of ERK1/2 within discrete subcellular bodies could also affect the accessibility of ERK1/2 to its targets Clearly, a detailed analysis is needed of the targets of ERK1/2 that directly...
- 7
- 359
- 0
Báo cáo y học: "Alveolar microstrain and the dark side of the lung" ppt
... access the dark side of the lung, in other words, the lung interior, and define the architecture of parenchyma that is not Page of (page number not for citation purposes) anchored to the pleural ... Oeckler and Hubmayr colleagues equate the presence of alveolar deformation in the pleural plane with alveolar instability and injury The authors defend this assumption with the observation that in the ... alveolar microstrain of the non-dependent lung merely reflect derecruitment of the dependent lung[12]? Are interdependence forces truly large enough to strain pleural and/ or alveolar walls beyond their...
- 2
- 254
- 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
... derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA ... Transit peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75, and mToc75 with the ... Transit peptide of Toc75 A J Baldwin and K Inoue A B C Fig Effects of replacements of the most C-terminal tri-glycine segment within the polyglycine stretch of the Toc75 transit peptide with repeats...
- 9
- 496
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the ... Role of the Vps4 C-terminal helix Fig 11 A C-terminal helix is a characteristic feature of meiotic clade AAA ATPases Sequence alignments of some of the proteins listed in the PFAM database that...
- 23
- 490
- 0
Báo cáo y học: "First somatic mutation of E2F1 in a critical DNA binding residue discovered in well- differentiated papillary mesothelioma of the peritoneum" doc
... four Arginine residues contacting the DNA target (Figure 4, bottom) Since the crystal structure for the DNA binding domain of E2F4 was available, computational modeling of the mutation was amenable ... be located in the DNA binding domain of the protein To study the evolutionary conservation of the R166 residue, a CLUSTALW [14] analysis was performed on paralogues of the human E2F family and ... First somatic mutation of E2F1 in a critical DNA binding residue discovered in welldifferentiated papillary mesothelioma of the peritoneum Willie Yu1,2,3*, Waraporn Chan-On 1,2*, Melissa Teo4,...
- 40
- 426
- 0
báo cáo khoa học: " Oral bisphosphonate-related osteonecrosis of the jaws in rheumatoid arthritis patients: a critical discussion and two case reports" potx
... professor and the chairman of the Department of Physiology and Pathology, Division of Pathology at Araraquara School of Dentistry EMJ and RACM are professors and chairmen of the Department of ... maxillofacial region but did have a history of smoking During clinical examination a detachment of the marginal gingival (Figure 6a) associated with an increased probing depth value at the region of ... Cite this article as: Conte-Neto et al.: Oral bisphosphonate-related osteonecrosis of the jaws in rheumatoid arthritis patients: a critical discussion and two case reports Head & Face Medicine 2011...
- 7
- 285
- 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, ... TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The NheI-BamHI...
- 12
- 337
- 0
economics - freakonomics - a rogue economist explores the hidden side of everything - s d levitt & s j d~0
... 1b 2a3 4d4 ac4 2d2 3b141acd2 4a3 a12dadbcb 4a2 134141 db2abad1acbdda212b1acd2 4a3 a12dadbcb400000000 d4 3a3 a24acb 1d3 2b412acd2 4a3 a12dadbcb422143bc0 d4 3ab 4d1 ac3dd4342124 0d2 4a3 a12dadbcb400000000 1142340c2cbddadb4b1acd2 4a3 a12dadbcb4 3d1 33bc4 ... d4 2a3 adcacbddadbc42ac2c2ada2cda341baa3b24321 db1134dc2cb2dadb24c412c1ada2c 3a3 41ba20000000 d1 341431acbddad3c4c213412da2 2d3 d113 2a1 344b1b 1ba4 1a2 1a1 b2dadb24ca22c1ada2cd32413200000000 dbaa3 3d 2a2 bddadbcbca11c 2a2 accda1b2ba20000000 ... dba2ba21ac 3d2 ad3c4c4cd4 0a3 a12dadbcb400000000 d1 22ba2cacbd 1a1 321 1a2 d0 2a2 41 2d0 dbcb4adb4b3c0 14 4a3 adc4cbddadbcbc2c2cc4 3a1 2dadbcb4211ab343 d4 3aba3cacbddadbcbca42c 2a3 212dadbcb42344b3cb Classroom B db 3a4 31422bd131b4413cd42 2a1 acda33234 2d3 ab4c4...
- 257
- 281
- 0
THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY
... important to test the link between transformational leadership behaviors and affective employee engagement in the industry of retail and financial services in Ho Chi Minh City and also to explore employees’ ... and affective employee engagement by surveying the employees The target population of the study included the employees in Ho Chi Minh City currently working in the industry of retailing and financial ... leadership behaviors and affective employee engagement in the industry of retail and financial services in Ho Chi Minh City, Vietnam Of course, the data for the study is delimited to the surveyed employees...
- 84
- 510
- 1
The lender of last resort a critical analysis of the federal reserve’s unprecedented intervention after 2007
... them.) The high rate has the advantage of encouraging retention of the stock of the gold component of the monetary base at home as well as attracting additions to that stock from abroad And the ... Historical Federal Reserve data also are available on the FRED website maintained by the Federal Reserve Bank of St Louis See, also, a March 1936 pamphlet published by the Federal Reserve Bank of ... not necessarily endorse the classical approach but rather wish to examine whether the Fed has indeed—as some have suggested—followed that approach 2.2 Classical Theory of Lender of Last Resort Policy...
- 101
- 287
- 0
Constitutive testing of soil on the dry side of critical state
... OC clay and other hard soils, on the other hand, fall on the dry side of critical state The MCC model would highly over-predict the strength of soil on the dry side of critical state A Hvorslev ... examined the applicability of the critical state concept to the yielding of soft rocks, and found that the critical state is the ultimate state that can be reached by the homogenous deformation of soft ... predict soil behaviour in the sub -critical region (that is, the region on the wet side of critical state) fairly well, as the models were based on test results of normally to lightly overconsolidated...
- 387
- 714
- 0
Từ khóa: chapter 15 the dark side of data sciencethe dark side of netcatthe dark side of the moon revealeddebugging—the dark side of iphone developmentthe best of both worlds a critical pedagogy of placewhats at the other side of a black hole4 6 interior view of an intestinal bulb at 7 dpf this image is an expanded focus of 32 8 µm of z depth 320 stacks with a z stack size of 0 1 µm the intestinal folding has been started in the ventral side of the intestinal to shape the inton the dark sidethe softer side of systemsthe first law of thermodynamics is a restatement of thelooking at the other side of the cointhe first law of thermodynamics is a restatement of which of these lawsthe first law of thermodynamics is a restatement of the quizletthe first law of thermodynamics is a restatement of the law of conservation of momentumat the other side of heavenNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ