0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Thạc sĩ - Cao học >

Characterization, activity and kinetics of a visible light driven photocatalyst

báo cáo hóa học:

báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

... work was supported in part by an Ontario Graduate Scholarship, Natural Sciences and Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun ... the manuscript TC conceived the study, advised on the design and coordination of the experiments, and edited the manuscript All authors read and approved the final version of the manuscript Acknowledgements ... factor was selectable in the 1.2-2.5 range, and was adjusted for each participant such that false activations due to blinks and movement were avoided and participants were able to activate the switch...
  • 10
  • 501
  • 0
Báo cáo y học:

Báo cáo y học: "Practising evidence-based medicine: the design and implementation of a multidisciplinary team-driven extubation protocol" pptx

... potentially accelerate decision-making with regard to extubation; and to assess the safety and feasibility of our approach Materials and method The intervention was carried out in a 14-bed medical/surgical ... evidence-based medicine into the setting of the ICU by promoting a multidisciplinary approach to extubation, and to design a protocol that was acceptable to all medical staff involved in the extubation ... criticism, and feedback was given on a regular basis Based on the feedback, the protocol was regularly re-evaluated and updated Nurses and RCPs responded favourably to the MDT-driven extubation protocol...
  • 6
  • 327
  • 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... questions of whether and how the enzymes structural dynamics inuence the kinetics of a-CT catalysis This was done by determining the changes in the global structural dynamics (DGHX) [38] for the ... the deprotonation and protonation rates of Ser195 thus reducing the kinetics of catalysis The results also suggest that the dynamics of the calcium binding site in this structural class of proteins ... between the enzymes conformational dynamics and active-site chemistry through domain motions [17,18,21,78] Conclusions In this article, we further demonstrate the value of chemical glycosylation as...
  • 17
  • 531
  • 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... ARA456 ARA457 ARA458 ARA459 ARA460 ARA477 ARA486 ARA487 ARA509 ARA510 ARA514 ARA515 CCTATTGAATTCAAAAGCCGG TAACCCCAATCTAGACAGTCC CTGCTGTAATAATGGGTAGAAGG GGAATTCCATATGCGTATTATGGCCAG TATTTACTCGAGAATCCCCTCCTCAGC ... TATTTACTCGAGAATCCCCTCCTCAGC CGGGATCCACCGTGAAAAAGAAAGAATTGTC GAATTCATAAAGAAGCTTTGTCTGAAGC CGGCGCGTCATATGGCCAGTCATGATA TGATACGCATATGTCACCGGCTGGC CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ... GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAG CGTGAATTCACCGAGCATGTCACCAAAGCC AATCAGAATGGGATCCGGTGA CGGCTGACATTCTGATTGACTTGGACGG CAATCAGAATGTCAGCCGGTGACACAGG CC AGT CAT GAT AAG CCT...
  • 14
  • 594
  • 0
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... retrieved from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and ... Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana Gene 288, 129–138 Tanaka S, Ikeda K, Ono M & Miyasaka H (2002) Isolation of several anti-stress genes...
  • 14
  • 347
  • 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

... of at least six classes of cytosolic GSTs in insects [2] The majority of GSTs are in the Delta and Epsilon classes, and the remaining enzymes are in the Omega, Sigma, Theta and Zeta classes The ... cockroach, Blattella germanica (L.) Pestic Biochem Physiol 61, 53–62 Yu SJ & Huang SW (2000) Purification and characterization of glutathione S-transferases from the German cockroach, Blattella germanica ... that there may not be allelic variants of BgGSTD1 in the German cockroach strain used in this report A Delta class GST from the German cockroach Detection of IgE against GSTs from the German cockroach...
  • 11
  • 426
  • 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

... CIP are indicated by the labelled arrows (B) A combination of N-terminal and C-terminal truncations of p35 produces a nonactivating fragment (154–279, CIP) that inhibits Cdk5 activity and binds ... using anti-p35 (C-19) Left lane, cotransfected with Cdk5, p35 and tau; Right lane, cotransfected with Cdk5, p25 and tau (B) Total tau and phospho -tau were analyzed by Western blot using anti -tau ... M., Murayama, M., Noguchi, K., Ishiguro, K., Imahori, K & Takashima, A (1998) Characterization of tau phosphorylation in glycogen synthase kinase- 3beta and cyclin dependent kinase- 5 activator...
  • 8
  • 329
  • 0
Báo cáo Y học: Thermodynamics and kinetics of the cleavage of DNA catalyzed by bleomycin A5 A microcalorimetric study pdf

Báo cáo Y học: Thermodynamics and kinetics of the cleavage of DNA catalyzed by bleomycin A5 A microcalorimetric study pdf

... absorbance for the reaction system after the cleavage Ó FEBS 2002 Thermokinetics of DNA cleavage catalyzed by BLM -A5 (Eur J Biochem 269) 2855 Table Thermodynamic and kinetic data of the cleavage ... cleavage of calf thymus DNA induced by BLM -A5 and those for the scission of calf thymus DNA mediated by two DNA- damaging agents, ADM and (1,10-phenanthroline)-copper Data are expressed as mean ... than k2 (in this case the cleavage efficiency) Therefore, BLM -A5 is not as efficient as a DNA- cleaving enzyme although the cleavage of DNA by BLM -A5 follows Michaelis–Menten kinetics The cleavage...
  • 9
  • 464
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

... biomarkers, and they participated in the data analyses AAH developed the customized Spotfire tool used for data analyses and reviewed statistical analyses YG participated in the assessment and ... assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood Journal of Translational Medicine 2010, 8:51 Page 13 of 13 ... this basic approach (ex vivo stimulation of whole blood) to develop pharmacodynamic biomarker assays for a candidate therapeutic antibody, Ab-01 Ab-01, a human antibody generated by phage display,...
  • 13
  • 528
  • 0
báo cáo hóa học:

báo cáo hóa học: "Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity monitor" pdf

... property Data Analysis Data were processed and analyzed after testing each subject The same time interval of BML and IDEEA data was analyzed for the three specific physical activities (gait, stepping, ... measure knee flexion angles and were calibrated by MiniSun, LLC One electrogoniometer was placed on the lateral surface of each knee, in line with the anatomic axes of the femur and tibia, and ... experiments, and assisted in analyzing the data and revising the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Patrick Duplessis for his assistance...
  • 10
  • 378
  • 0
báo cáo hóa học:

báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

... MOVCAR-9 MOVCAR-10 MOVCAR-1 MOVCAR-2 MOVCAR-9 MOVCAR-10 Figure Extra -and intracellular Muc16 expression by MOVCAR cells Extra -and intracellular Muc16 expression by MOVCAR cells (A) MOVCAR-10 cells ... cDNA was prepared cDNA was amplified with the following primer pairs from Integrated DNA Technologies: Muc16 5'-TGCCACCTACCAGTTGAAAG-3' and 5'-GTACCGCCAAGCAGATGAG-3'; GAPDH 5'-TGCTGAGTATGTCGTGGAGTCTA-3' ... ITS and 1% antibiotic-antimycotic The human epithelial ovarian tumor cell lines OVCAR-3, SKOV-3, and CAOV-3 were purchased from ATCC RT-PCR Total RNA was isolated from MOVCAR cell lines using the...
  • 7
  • 430
  • 0
Báo cáo y học:

Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

... daily at the time of analysis After developing parotid gland enlargement, lymphoma of the parotid gland was excluded by partial parotidectomy and histological examination After approval by the ... typically present in sera of patients with SS [18] and was also detected in the saliva or in salivary gland biopsies [19] of these patients In this regard, Martin et al described two salivary ... is inline with the assumption that plasma and memory B cells accumulate in the parotid gland but cannot clarify the origin of these cells Whatever the primary aberration in the induction of the...
  • 12
  • 441
  • 0
Báo cáo y học:

Báo cáo y học: "Biologic activity and safety of belimumab, a neutralizing anti-B-lymphocyte stimulator (BLyS) monoclonal antibody: a phase I trial in patients with systemic lupus erythematosus" potx

... and was safely administered to patients with SLE These findings supported the initiation of phase II studies investigating the safety and clinical activity of belimumab in patients with SLE and ... enrolled in the trial Eligible patients had stable SLE disease activity, as clinically judged by the principal investigator, for at least months before screening and were either maintained with no ... BLyS Anti-belimumab antibody present in the sample would bind to the immobilized belimumab, and competitively inhibit binding of europium-labeled BLyS Europium-labeled BLyS binding was quantitated...
  • 15
  • 478
  • 0
báo cáo khoa học:

báo cáo khoa học: " Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.)" pptx

... doi:10.1186/1471-2229-11-43 Cite this article as: Keeling et al.: Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.) BMC Plant Biology 2011 ... feeding and some distance away [29] Functional characterization of monoterpene synthases: (-)-Linalool synthases We characterized two new (-)-linalool synthases in Sitka spruce (PsTPS-Lin-1 and PsTPS-Lin-2) ... Martin D, Miller B, Rawat S, Bohlmann J: Traumatic resin defense in Norway spruce (Picea abies): methyl jasmonate-induced terpene synthase gene expression, and cDNA cloning and functional characterization...
  • 14
  • 357
  • 0
báo cáo khoa học:

báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt

... 20 Isolation and characterization of T-DNA flanking sequences Isolation of T-DNA flanks was accomplished with Thermal Asymmetric Interlaced-PCR (TAIL-PCR) and Inverse PCR (I-PCR) TAIL-PCR was ... Sequences were analyzed with BLASTn and BLASTx http://www.ncbi.nlm.nih.gov/BLAST/ programs against the GenBank database, and against a banana EST database donated by Syngenta to the Global Musa Genomics ... weather In Diseases of Banana, Abacá and Enset Edited by: Jones DR Wallingford, UK: CAB International; 2000:351-379 Robinson JC: Bananas and Plantains Crop Production Science in Horticulture Wallingford,...
  • 15
  • 283
  • 0

Xem thêm

Từ khóa: the isolation characterization and development of a novel class of potent antimitotic macrocyclic depsipeptides the cryptophycins5chromatin remodeling and kinetics of nf kappa b activation a complex interplaynatural mould and soil of a gardenthe life and death of a rogue apstructure and function of a dogs eyethe design and development of a solar powered refrigeratorinterpretation deals with the content and underlying of a wordcustomize the layout and appearance of a web pagethe purpose and objectives of a business druckerinterpretation deals with the content and underlying of a worklike and dislikes of a girllike and dislikes of a personthe contents and purpose of a contract of employmentgrowth phases and stages of a rice planttrue tale of the rise and fall of a championNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ