The German Criminal Code A Modern English Translation Studies in International and Comparative Criminal Law
The German Criminal Code A Modern English Translation Studies in International and Comparative Criminal Law
... Studies in International and Comparative Criminal Law General Editor: Michael Bohlander Criminal law had long been regarded as the preserve of national legal systems, and comparative research in criminal ... for international and comparative lawyers This can be attributed to numerous factors, such as the establishment of ad hoc international criminal tr...
Ngày tải lên: 13/10/2016, 11:18
Báo cáo sinh học: "The THO complex as a key mRNP biogenesis factor in development and cell differentiation" potx
... 2010, 8:1 Huertas P, Garc a- Rubio ML, Wellinger RE, Luna R and Aguilera A: An hpr1 point mutation that impairs transcription and mRNP biogenesis without increasing recombination Mol Cell Biol 2006, ... salt-resistant stable complex independent of UAP56 and Yra1 [4,5] In yeast, THO binds to active chromatin in an RNAindependent manner A plausible scenario is as follow...
Ngày tải lên: 06/08/2014, 19:21
A STUDY ON TRANSLATION OF ENGLISH RELATED TERMS IN FINANCE AND BANKING INTO VIETNAMESE
... Translation in the case of finance and banking 21 CHAPTER II: A STUDY ON TRANSLATION OF ENGLISH RELATED - TERMS IN FINANCE AND BANKING INTO VIETNAMESE 22 TYPICAL TERMS RELATING ... an overview on translation strategies and procedures commonly employed in translation of finance and banking terms In details, the graduation paper a...
Ngày tải lên: 11/12/2013, 23:55
The first three minutes a modern view of the origin of the universe s weinberg
... the same size and shape as our own galaxy They appear elliptical because most of them are viewed at a slant, and of course they are faint because they are so far away The idea of a universe filled ... certain class of objects which have the appearance of stars nevertheless have enormous red shifts, in some cases over 300 per cent! If these 'quasi-stellar objects' are as...
Ngày tải lên: 17/03/2014, 13:35
báo cáo hóa học: "The psychometric validation of a US English satisfaction measure for patients with benign prostatic hyperplasia and lower urinary tract symptoms" potx
... participated in the study design, analysis and interpretation of data and drafting the manuscript BM participated in the acquisition of data and the revision of the manuscript All authors read and approved ... additional useful information on patient satisfaction with BPH pharmacotherapy above and beyond what was already provided by global satisfaction A draft of the...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo y học: "Implementing the International Liaison Committee on Resuscitation guidelines on hypothermia after cardiac arrest. The German experience: still a long way to go" potx
... hypothermia after cardiac arrest: an advisory statement by the advanced life support task force of the International Liaison Committee on Resuscitation Circulation 2003, 108:118-121 Meade MO, Jacka MJ, ... for the indication and clinical use of therapeutic hypothermia [3] Even if the optimal duration and temperature of therapeutic hypothermia as well as different c...
Ngày tải lên: 12/08/2014, 23:23
A STUDY ON LEXICAL COHESION IN VIETNAMESE AND ENGLISH CORPORATE ADVERTISINGS
... precision and clarity are not affected and not making the ad boring to read Here are some more examples of synonyms: “Yield, earning and income” “Healthcare professional and “Grow and increase” clinician” ... care Healthcare market Care program Health examination Healthcare IT Care setting Healthcare professionals Care management Healthcare products Patient care Healthcare solutions...
Ngày tải lên: 29/01/2014, 10:43
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... 3329 7–3 3301 Fritz M & Muller V (2007) An intermediate step in the ¨ evolution of ATPases – the F1F0- ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP ... the rotor of eukaryal V1V0 ATPases has only half the number of ion-binding sites compared to F1F0 ATP syntheses This low H+ (Na+) ⁄ ATP ratio...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on th...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...
Ngày tải lên: 07/03/2014, 16:20