Alkali and Halotolerant Catalase from Halomonas sp. SK1: Overexpression in Escherichia coli, Purification, Characterization, and Genetic Modification

Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

... FkpA [11], these proteins are composed of N- and C-domains, which are spanned by a 40 amino acid long a3 helix The N-domain consists of a1 and a2 helices and an N-terminal region of a3 helix The ... FKBP22 variants containing either one of these domains and compare their activities and stabilities with those of the intact protein In this report, the...
Ngày tải lên : 23/03/2014, 13:20
  • 11
  • 332
  • 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...
Ngày tải lên : 12/02/2014, 10:20
  • 9
  • 497
  • 0
Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modifications and activity-based analyses doc

Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modifications and activity-based analyses doc

... Gevaert et al COFRADIC and protein modifications analysis of purine-binding proteins in a total lysate of human Jurkat T-cells [40] primary separation mAU 1400 COFRADIC analysis of protein processing ... [34,36] and N-glycosylation [39] – and describe the use of COFRADIC for studying interactions between small molecules and proteins The latter is a particular applicatio...
Ngày tải lên : 18/02/2014, 16:20
  • 13
  • 578
  • 0
Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

... mutations of a membrane protein can in uence the efficiency of integration into the native membrane and thus in uence the apparent transport activity The efficiency of protein incorporation into the E coli ... (b) the translocation pathway in UhpC for the transport of Glc6P; (c) the ability of UhpC to interact with UhpB in the transmission of the...
Ngày tải lên : 08/03/2014, 08:20
  • 8
  • 411
  • 0
Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx

Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx

... that GO and DAAO oxidize D-proline, D-alanine and D-2-aminobutyrate with similar relative efficiencies Analogously, GO and MSOX show a fairly similar activity on sarcosine and N-ethylglycine In ... possesses a wide substrate specificity In addition to sarcosine and glycine, even N-ethylglycine, ethylglycine ester, D-alanine, D-2-aminobutyrate, D-proline, D-pipecolate and N-...
Ngày tải lên : 08/03/2014, 16:20
  • 8
  • 482
  • 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... ¼ X A= MICA þ B=MICB Þ=n where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug ... Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against multidrug-...
Ngày tải lên : 16/03/2014, 00:20
  • 18
  • 494
  • 0
Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx

Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx

... may induce the cascade reaction of GluV8 activation, because recombinant proteins remain inside E coli cells, instead of being secreted from S aureus The conversion of amino acids adjacent to the ... samples, the mature form of GluV8 could be renatured even after exposure to heat in the presence of SDS Role of N-terminal Val69 in processing of the GluV8 pro...
Ngày tải lên : 16/03/2014, 06:20
  • 15
  • 370
  • 0
Báo cáo khoa học: nNOS inhibition, antimicrobial and anticancer activity of the amphibian skin peptide, citropin 1.1 and synthetic modifications pot

Báo cáo khoa học: nNOS inhibition, antimicrobial and anticancer activity of the amphibian skin peptide, citropin 1.1 and synthetic modifications pot

... dahleins 1.1 and 1.2 [53] and some synthetic modifications of lesueurin The solution structure of citropin 1.1 synthetic modification (A4K14 -citropin 1.1) The solution structure of the basic peptide citropin ... into the structure /activity relationships for the amphibian peptide citropin 1.1 The activities of citropin 1.1 are compared with th...
Ngày tải lên : 17/03/2014, 09:20
  • 13
  • 480
  • 0
Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot

Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot

... reconstitution of the oxidation of propionyl-CoA to pyruvate by the use of purified PrpC, PrpD, AcnB and PrpB from E coli PrpD and AcnB involved in the conversion of methylcitrate into 2-methylisocitrate ... methylcitrate into 2-methylisocitrate PrpD is involved in the dehydration of (2S,3S) -methylcitrate to 2-methyl-cisaconitate The elimination of water fro...
Ngày tải lên : 17/03/2014, 10:20
  • 11
  • 615
  • 0
Báo cáo Y học: DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regulation of both topoisomerase I and DNA gyrase docx

Báo cáo Y học: DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regulation of both topoisomerase I and DNA gyrase docx

... topoisomerase I is activated or DNA gyrase is inhibited to compromise DNA, and equal to: Hsupercoiling v ˆ kt v kt topoisomerase topoisomerase gyrase gyrase esupercoilingI ‡ esupercoiling I À esupercoiling ... esupercoiling À v kt v kt topoisomerase topoisomerase gyrase gyrase esupercoilingI ‡ esupercoiling I À esupercoiling À esupercoiling …4† The elasticities of...
Ngày tải lên : 18/03/2014, 01:20
  • 8
  • 476
  • 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTG...
Ngày tải lên : 23/03/2014, 21:20
  • 5
  • 435
  • 0
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

... theophylline The arrow points to the M-A2aTr316-H10 fusion protein Note that the main contamination, seen in lane 1, runs only marginally above the hA2aR fusion protein and is the main band in ... obtained, namely LysIle-Glu-Glu-Gly-Lys-Leu-Val-Ile-Trp corresponds to the N-terminus of the mature maltose-binding protein Binding of the fusion protein to the IMAC gel...
Ngày tải lên : 24/03/2014, 00:21
  • 11
  • 582
  • 0
Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf

Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf

... components, in contrast to the other translation initiation factors IF2 and translation initiation factor [22] IF1 contains an oligomer-binding motif with high homology to the RNA-binding domains of ribosomal ... common denominator for cspA and infA The compensation of the cold sensitivity of IF1 mutant strains by the inactivation of cspA is another functional link...
Ngày tải lên : 29/03/2014, 09:20
  • 12
  • 484
  • 0
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the bindin...
Ngày tải lên : 30/03/2014, 04:20
  • 12
  • 428
  • 0
Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

... sequence of oraE to those of known PLPdependent aminomutases reveals the presence of a conserved PLP-binding site, a lysine residue at position 629, at the C-terminus of the OraE protein [11] The binding ... alone, OraS protein can be expressed in a soluble form However, the OraE and OraS proteins were coexpressed in an Fig The over-expression of oraS and oraE at...
Ngày tải lên : 30/03/2014, 15:20
  • 5
  • 401
  • 0

Xem thêm