... samples from allantoic from all NA One-step RT -PCR amplification of NA gene from all NA subtypes using animal samples from allantoic fluids A fragment of approximately 253 bp was amplified using ... representation of 3,337 available sequences in the NCBI database at the time the study was conducted All NA subtypes were aligned against the NA10R primer and a...
Ngày tải lên: 20/06/2014, 01:20
... to analyse any differences between the PDZ- binding activities of the human and avian NS1 proteins A PDZ array assay had previously been reported, using a large number of isolated PDZ domains, and ... Human (H) NS1, together with the non -PDZ- binding mutant of Avian NS1 (Aa), plus the avian human-like (Ah) and the human avian-like (Ha) mutants Lower panel GS...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development" doc
... only against linear epitopes but also against conformational epitopes Above described results indicate that eM2 is a valid and versatile vaccine candidate to induce protective immunity against any ... G, Ali M, Wan H, Murakami A, Yammanuru A, Han T, Cox NJ, Bankston LA, Donis RO, Liddington RC, Marasco WA: Structural and functional bases for broad-spectrum neutralization...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus)" pptx
... New York 1987 doi:10.1186/1743-422X-7-174 Cite this article as: Goyal et al.: Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus) Virology Journal 2010 ... reaction Abbreviations AIV: avian influenza virus; HPAI: highly pathogenic avian influenza virus; LPAI: low pathogenic avian influenza virus; NIH: National Instit...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " Highly pathogenic avian influenza A virus H5N1 NS1 protein induces caspase-dependent apoptosis in human alveolar basal epithelial cells" docx
... that the NS1 protein of influenza A virus H5N1 was able to induce apoptosis in A5 49 cells Involvement of caspases in NS1- induced apoptosis B C Figure H5N1 NS1 protein induces apoptosis in A5 49 ... cell apoptosis Recently, It has been reported that avian influenza virus A/ HK/483/97 (H5N1) NS1 protein- induced apoptosis in human lung epi...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf
... 22:477-481 Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody- forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/ or subcutaneous administration ... peptide vaccine that contains ectodomains of matrix protein Vaccine 2003, 21:2616-2626 Slepushkin VA, Katz JM, Black RA, Gamble WC, Rota PA, Cox NJ: Protection...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " In vitro inhibition of human influenza A virus replication by chloroquine" pot
... demonstrates an inhibitory effect against the replication of human influenza A virus H1N1 and H3N2, in vitro and further studies to explore its therapeutic and prophylactic potential against influenza ... respectively Only a handful of drugs are able to inhibit influenza A virus replication and the increasing prevalence of resistance to these drugs demands newe...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... polymerase leads to the synthesis of run-off transcripts with the sequence: AGUAGAAACAAGGGUGUUUUUUCCCGGGAAUUCGGAUCCACACCCUGCUUUUG CUand AGCAAAAGCAGGGUGUGUGGAUCCGAAUUCCCGGGUAAAAAACACCCUUGUUUCUACU, ... that replication of influenza virus is regulated by stabilization of replicative intermediates J Virol 2004, 78:9568-9572 Nakagawa Y, Oda K, Nakada S: The PB1 subunit alone can cataly...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps
... clade 2. 3, and 92% for clade 2 .1 (Table 1) Table H5N1 clinical samples and rRT-PCR results Samples /virus clade NS TS TA Plas PF Stool Total 0 10 rRT-PCR positive Clade 10 Clade 2 .1 17 0 25 23 Clade ... potentially pandemic H5N1 influenza virus in eastern Asia Nature 20 04, 430(6996) :20 9- 21 3 WHO: Evolution of H5N1 avian influenza viruses in...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx
... The M2 protein comprises 97 amino acids – 24 in the extracellular domain, 19 in the transmembrane domain, and 54 in the cytoplasmic domain Extracellular domain of M2 is recognized by hosts' immune ... avian influenza A virus pool [1] In avian species, influenza A viruses are in an evolutionary stasis [1] In contrast, all gene segments of mammalian viruses...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "The role of RNA folding free energy in the evolution of the polymerase genes of the influenza A virus" potx
... only one of them was used in the analysis As we explained above, the choice of focusing on the ORF was dictated by the fact that the majority of the sequences in the database contain partial ... independent of the concurrent amino acid changes in the polymerase and NP genes, and independent of the codon usage bias In addition, human influenza A str...
Ngày tải lên: 14/08/2014, 21:20
The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury
... disruption of the capillary-alveolar barrier function results in the leakage of inflammatory exudates, edema fluid and plasma proteins into the lung interstitium and alveolar spaces and the collapse of ... et al, 2010) 2.5 Influenza virus and host defences During an acute influenza virus infection, both arms of immunity: Innate and adaptive, are importa...
Ngày tải lên: 13/10/2015, 16:41
Báo cáo hóa học: " Prevalence of Influenza A viruses in wild migratory birds in Alaska: Patterns of variation in detection at a crossroads of intercontinental flyways" potx
... Figure Geographical location of sampling sites in Alaska in 2006 and 2007 Geographical location of sampling sites in Alaska in 2006 and 2007 Hunter-harvest sampling locations are noted in red Live ... viruses in the context of sources of variation in prevalence and future sampling designs for monitoring and detection of avian influenza viruses Results Avian...
Ngày tải lên: 20/06/2014, 01:20