at the core of a virus

... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... contrast, the green algal PsbQ sequences have an accumulation of positively and negatively charged amino acids instead of the hydrophobic part Based on the knowledge that the N-terminal region of...

Ngày tải lên: 21/02/2014, 00:20

... ABCCC AESA AFB AFSB AFSOC AGM AIM AMRAAM AOR ASW ATFLIR ATO AWACS BAMS BDA BLU CAOC CAP CAS Antiaircraft Artillery Advanced Anti-Radiation Guided Missile Airborne Command and Control Center Active ... both wars, the performance of the Navy’s carrier air wings offered a strong validation of the final maturation of U.S carrier air power after more than a decade of programmatic setbacks and drift ... has, at long last, produced a direct return on investment by the sea services nearly half a generation later in a way that no one could have anticipated at the time Acronyms AAA AARGM ABCCC AESA...

Ngày tải lên: 15/03/2014, 16:20

... MMOH activation by catalase and oxygen MMOH was adsorbed onto the electrode as shown in Fig and then cycled from to )0.6 V at mVÆs)1 The arrow shows the effect of increasing catalase concentrations ... for the lack of catalytic current in the absence of catalase, presumably because the hydrogen peroxide inactivated MMOH Addition of MMOB to the MMOH-activated electrode produced an increase in ... enzyme and become aquated, whilst methane oxidation may be catalysed by nonaquated hydrogen peroxide at the active site A further complication arises when one considers that hydrogen peroxide is able...

Ngày tải lên: 17/03/2014, 09:20

Ngày tải lên: 12/07/2014, 11:00

... attainment of accurate pronunciation in a second language is a matter substantially beyond the control of educators’ They qualified their findings by stating that variables of formal training and ... extra designed materials that the teacher provided The materials are probably in type of paper or audio 2.5 Adjusting the achievement tests It is reasonable that the examination’s requirements and ... training and the quality of the training in pronunciation could affect the results, as would the area of pronunciation that had been emphasized, that is segmentals (individual sounds of a language) or...

Ngày tải lên: 07/09/2013, 13:45

... certifications So, what are these all about and why is there a new generation of credentials? One of the problems today is that there are an abundance of credentials in the IT world, making it increasingly ... relevant and simple So, Microsoft went back to the drawing board and created the latest generation of certifications based on industry and customer feedback with the goal of making them more targeted, ... programs Microsoft has been offering a variety of certifications from the early 90s on, and their program was due for an overhaul, and most of the changes to Microsoft’s certification program appear...

Ngày tải lên: 17/01/2014, 06:20

... certifications So, what are these all about and why is there a new generation of credentials? One of the problems today is that there are an abundance of credentials in the IT world, making it increasingly ... relevant and simple So, Microsoft went back to the drawing board and created the latest generation of certifications based on industry and customer feedback with the goal of making them more targeted, ... programs Microsoft has been offering a variety of certifications from the early 90s on, and their program was due for an overhaul, and most of the changes to Microsoft’s certification program appear...

Ngày tải lên: 17/01/2014, 09:20

... phases of the task For example, before a pairwork is carried out, the ESP teacher has to explain the demands of the task, the task with a random student as a model; and after the task, the feedback ... has been taught for many years at the 2nd stage with the duration of around 120 classes, each of which lasts 45 minutes The aim of this ESP course is to help students read and translate the materials ... was analyzed both quantitatively and qualitatively according to two facets: (1) the teachers and students’ perceptions of peerteaching; advantages and disadvantages of peer-teaching; and (2) the...

Ngày tải lên: 29/01/2014, 10:49

... Standard procedures were used for the preparation and ligation of DNA fragments, for the transformation of Escherichia coli and for the isolation of plasmid DNA from bacterial cells [51] Other ... respiratory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of ΔQCR9 ΔISP ΔBCS1 approximately 500 kDa was also found in this mutant strain when the ... speculate that the larger bc1 core structure acquires a higher stability against proteolytic degradation after incorporation of the two core proteins 1908 The minimal, yet stable, composition of the...

Ngày tải lên: 18/02/2014, 08:20

... read literally and historically as a true and accurate account of God's acts in real historical events It was assumed that the realism of the biblical narratives was in fact an indication that ... and the Egyptians could not drink the water (C) The realism of earlier biblical commentators led them to take this statement at face value It meant that the waters of the river actually became ... we think actually happened Or at least what the modern historian is able to reconstruct as the event The meaning of that event takes the place of the meaning of the text What has been the outcome...

Ngày tải lên: 19/02/2014, 14:20

... broad-based Financial Transactions Tax (FTT)—levied on the value of a wide range of financial transactions—and a Financial Activities Tax (FAT)—levied on the sum of the wages and profits of financial institutions ... This assumes, in addition, expanded regional initiatives in the U.S and Canada and the adoption of national mitigation targets in Japan, Australia and New Zealand, resulting in percent abatement ... at AfDB, Samuel Tumiwa at ADB, Josue Tanaka at EBRD, Matthias Zoellner at EIB and Walter Vergara at IDB Valuable comments were also provided by the UN and the UNDP Contributions to the preparation...

Ngày tải lên: 06/03/2014, 08:21

... appeal of these montages is the impossible task they attempt: all of film history in four minutes! Like the pre-cinematic appeal of miniaturization-based attractions, such as the Declaration of ... “MediaSpace” of advocacy marketing (the hallowed hall of the Academy Awards telecast venue itself) with a naturalization of cinema as performance a move moreover appropriate to marketing a commodity ... throughout the montage is the fact that they place the individual clips within a discourse of accumulation As images accumulate, our recognition of the movies they are taken from accumulates, and along...

Ngày tải lên: 07/03/2014, 15:20

... into pC4Meth94PhoE, the EcoRI/BamHI fragment of the plasmid was replaced by PCR fragments created using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) and the 94PhoE reverse ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C ... indicating that they are targeted to the Sec translocon via another targeting pathway In vitro cross-linking with the water-soluble cross-linker BS3 revealed that the G-10C and G-10L 94PhoE nascent...

Ngày tải lên: 08/03/2014, 09:20

... GEA Westfalia Separator is mostly used for waste water treatment (GEA, 2012) It consists of decanters and separators operating continuously that are efficient in clarification and separation, and ... well as reducing disposal costs Another alternative for wastewater treatment is to transport the waste water to the Iona Island Sewage Treatment facility via the Greater Vancouver Regional District ... Company, a brewpub located at Waterfront At SteamWorks, we asked how they dealt with waste grains, and found out that waste grains can be used for plant fertilizers and animal feed In fact, waste grains...

Ngày tải lên: 08/03/2014, 23:20

... gender-based analyses The authors of individual chapters have made use of population data from large Canadian surveys and administrative databases Data chosen for analysis depended largely on the availability ... indicating that women not appear to have a large biological survival advantage but, rather, are at lower risk of preventable deaths 17 MORTALITY, Life and Health Expectancy of Canadian Women • Health ... what a woman really wants is a home and children Data Gaps and Recommendations The author identified the following data gaps and made the following recommendations: • There is a paucity of data...

Ngày tải lên: 14/03/2014, 12:20

... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...

Ngày tải lên: 18/06/2014, 22:20

... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...

Ngày tải lên: 20/06/2014, 04:20

... used as descriptors for calculating the Euclidean distance matrix comparing all the individual trees Prior to the analysis, the data were standardised (zero mean and unit variance) Based on the ... range, mean annual precipitation is about 1500 mm with a peak in summer Mean annual temperature is about 5.5 °C; the mean of the coldest month (January) is ca –4 °C, and the mean of the warmest ... (LV3) The basal area of Norway spruce increased from the wettest subplot towards the drier ones at the edge of the bog For the living bog pines, the maximum basal area was found in the middle of the...

Ngày tải lên: 08/08/2014, 01:21

... Richards EJ: Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana BMC Plant Biol 2008, 8:92 38 Miura A, Nakamura M, Inagaki S, Kobayashi A, Saze H, Kakutani T: An Arabidopsis ... software [46] (http://katahdin.mssm.edu/kismeth/revpage.pl) was used to analyse the methylation data Once the data for each site were gathered, GraphPad software was used for statistical analysis ... lacking the restriction site For that purpose, we used an actin (GeneBank accession number AB199316.1) couple of primers (Forward: 5’-GGGATGATATGGAGAAGATATGG-3’ and Reverse: 5’-AAGCACAGCCTGGATAGC-3’)...

Ngày tải lên: 11/08/2014, 11:20