... authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written ... resonance imaging scan with fat saturation and gadolinium enhancement The cortical mass is seen as a low signal with an enhancing rim (arrows) Figure (arrow) to shows...
Ngày tải lên: 11/08/2014, 21:22
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
... coastal-zone management, integrated river basin management and/or ecosystem-based river basin management (Nakamura, 2003) Embedded in these approaches are the concepts of participatory management and adaptive ... and evaluating management strategies, is that of policy analysis 22 Chapter1 Policy analysis and rapid assessment models According to Miser and Quade (1985),...
Ngày tải lên: 06/11/2012, 10:35
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... the bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural re...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
... (20 04) Unanticipated antigens: translation initiation at CUG with leucine PLoS Biol 2, e366 15 Kozak M (1986) Point mutations dene a sequence anking the AUG initiator codon that modulates translation ... an N-terminal leucine amino acid Our present study indicates that nonAUG translation initiation may be operable more often than anticipated This may have a grea...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...
Ngày tải lên: 07/03/2014, 12:20
A MODEL OF NUTRITION INFORMATION SEARCH WITH AN
... Grossman’s model of the demand for health, health is a capital good produced via time and money and thus determines the amount of time available for market and non-market activities and the amount ... A MODEL OF NUTRITION INFORMATION SEARCH WITH AN APPLICATION TO FOOD LABELS Abstract Due to the dramatic rise of several diet-related chronic diseases, nutrition info...
Ngày tải lên: 08/04/2014, 16:55
báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx
... devices to accommodate patients with different levels of impairments, 3) provides unilateral and bilateral training and 4) combines training of the hand and arm into an integrated task-based simulation ... unilaterally or bilaterally and combine proximal and distal training into a single activity or train each segment separately Additionally, it presents information regarding th...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo khoa học: "Choosing simplified mixed models for simulations when data have a complex hierarchical organization. An example with some basic properties in Sessile oak wood (Quercus petraea Liebl.)" ppsx
... are of particular importance for forest managers and forest policy-makers In these multiple regards, it seems important to maintain a sufficient degree of genetic variability in oak stands, in ... colour, spiral grain, multiseriate wood rays) on both standard small-size samples and industrial-size boards Our data have a hierarchical organization Each level of the hierarc...
Ngày tải lên: 08/08/2014, 14:20
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... (Rheumaklinik Aachen, Aachen, Germany), Prof Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany) To assess further the assay specificity, we analyzed ... studies are necessary to screen known autoantigens containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti -SmD3 peptide (SMP) assay (a)...
Ngày tải lên: 09/08/2014, 06:22
A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase domain pot
... distantly related to the AAA+ and AP/NACHT NTPases [10,11,13] All eukaryotic and several bacterial members of the KAP family contain two or four transmembrane segments inserted into the P-loop NTPase ... [10] The ASCE division includes AAA+, ABC, PilT, superfamily 1/2 (SF1/2) helicases, and RecA/F1/F0 classes of ATPases, and a large assemblage of NTPases...
Ngày tải lên: 09/08/2014, 20:20