... knowledge, the work described here and in the related publications [1,7] is the first kinetic analysis of the in vitro interactions Cyt f plastocyanin and plastocyanin Fig Comparison of ionic strength ... primitive cyanobacteria at the time of chloroplast origin had poorly defined interactions between Cyt f and plastocyanin and/ or plastocyanin and photosys...
Ngày tải lên: 21/02/2014, 01:21
Mafiaboy How I Cracked the Internet and Why It's Still Broken
... time, the police had notified the school that I was the culprit Soon the vice-principal, whom I never got along with, was out dealing with the press and explaining that they had been given the ... But I was still surprised to be sitting near an FBI agent 14 Ilafiaboy 1.0 This set my imagination off again The presence of the FBI meant that my case was an internationa...
Ngày tải lên: 22/02/2013, 17:05
Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx
... essential proximal histidine (Fig 4A,C,D) However, in all C-domains of catalase– peroxidases, there is a conserved arginine (Arg622 in HalomarCPc) in the corresponding position, indicating that these ... and discussion Conserved regions and typical motifs in the sequences of class I peroxidases Sixty heme peroxidases belonging to class I of the plant per...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... was of interest to shed some light on the changes of the molecular architecture of the two domains of vertebrate MT when Cu(I) is added to them For this task, the synthetic murine aMT-1 and bMT-1 ... increase of intensity was observed until the addition of the third and fourth Cu(I) ions to the a- and b-domain, respectively Further Cu(I) addi...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAA...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt
... examine the effect of the APOH promoter SNPs on plasma b2GPI levels; and (d) to determine the cross-species conservation of the APOH promoter sequence To identify regions of the APOH promoter that ... quantitative change at the protein level Whether the APOH promoter SNPs ()643T>C and )1219G>A) could influence the promoter activity by either the former or...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot
... wells and At the same time, the activity of the muscle was recorded with a pair of electrodes: one electrode was located in the middle, and the other at one end, of the trough Each pair of recording ... from amino-acid sequences Purification and synthesis of I -superfamily conotoxins D-Amino The excitatory peptides r11b and r11c were purified from the veno...
Ngày tải lên: 16/03/2014, 22:20
side, and Nikia finally understood the cost of eighteenthcentury warfare. Nikia drew several helpful pdf
... bodily kinesthetic intelligence in the case of Jordan and musical intelligence in that of the big tenor Gardner doesn’t limit smarts to the traditional realms of logical reasoning and the ability ... Sometimes he draws them on paper He then associated dates with the pictures, using imagery to better understand the order of events Damon is good at seeing the big pictu...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx
... (Figure 1A) This finding is in keeping with the findings of NS1/NS2 antagonism of type I IFNs [4,46,47] and suggests the possibility that type I IFN antagonism is linked to NS1/NS2 induction of ... interfere with direct TLR signaling, but instead regulate paracrine IFN signaling [7] The SOCS protein family is comprised of eight proteins (CIS, cytokine- induci...
Ngày tải lên: 20/06/2014, 01:20
Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part1 potx
... and Financial Audit of the Hawai`i Tourism Authority's Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Conducted by The Auditor State of Hawaii and Nishihama ... www.adultpdf.com The Auditor State of Hawaii OVERVIEW Management and Financial Audit of the Hawai`i Tourism Authority's...
Ngày tải lên: 20/06/2014, 02:20
Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part2 pot
... Hawai`i Tourism Authority Major contractors Section 23-13, HRS, directs the Auditor to conduct a financial and management audit of the authority’s major contractors.” A major contractor is a ... Specifically, the authority could not justify the contracts it awarded and did not adequately monitor all contracts In 1993, the office conducted a Mana...
Ngày tải lên: 20/06/2014, 02:20
Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part3 ppt
... China and Japan offices indicate varying degrees of improper management of state funds The Kaua‘i Visitor’s Bureau has a staff of four state- funded positions and an executive director who is paid ... HVCB issued a travel and entertainment policy to: provide guidance to travelers, travel arrangers, approvers, and auditors on cost-effective management of travel,...
Ngày tải lên: 20/06/2014, 02:20