Improving the protein content and composition of cereal grain

Improving the protein content and composition of cereal grain

Improving the protein content and composition of cereal grain

... from the major prolamin fraction (a-zeins) of maize accounting for the low content of this amino acid in the whole grain of this cereal The aleurone and embryo tissues of grains contain higher contents ... glutamine and asparagine) and their infrequent introduction would not lead to deleterious effects In the case of rice, the lysine content of the gra...

Ngày tải lên: 25/08/2016, 22:36

12 366 0
Báo cáo sinh học: "Genetic parameters for lactation traits of milking ewes: protein content and composition, fat, somatic cells and individual laboratory cheese yield" ppt

Báo cáo sinh học: "Genetic parameters for lactation traits of milking ewes: protein content and composition, fat, somatic cells and individual laboratory cheese yield" ppt

... date of milk sampling, number of suckled lambs, date of birth of the ewe and lambing date Lactation measures of milk composition traits (fat content, protein content, casein content, serum protein ... LSCC and yield or the composition of the milk of dairy ewes [7,17] The objective of our study was to estimate the genetic parameters for lactation measures...

Ngày tải lên: 14/08/2014, 13:21

16 316 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTT...

Ngày tải lên: 29/03/2014, 23:20

16 409 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... in Fig Within the nucleus, the protein again seemed to be localized to compartments in the interchromatin space (Fig 7) To further confirm the localization of ISP36, an inter4329 Interchromatin ... Peptidyl-prolyl-cis-trans isomerase B precursor Fragment of lamin A or C Lamin A Lamin C or lamin A fragment Fragment of lamin A or C Fragment of lami...

Ngày tải lên: 30/03/2014, 20:20

12 400 0
MANAGEMENT PRACTICES OF VOCATIONAL TRAINING PARTNERSHIPS BETWEEN SELECTED COLLEGES AND ENTERPRISES IN VINHPHUC PROVINCE: BASES FOR IMPROVING THE VOCATIONAL TRAINING AND INDUSTRY RELATIONSHIPS

MANAGEMENT PRACTICES OF VOCATIONAL TRAINING PARTNERSHIPS BETWEEN SELECTED COLLEGES AND ENTERPRISES IN VINHPHUC PROVINCE: BASES FOR IMPROVING THE VOCATIONAL TRAINING AND INDUSTRY RELATIONSHIPS

... Education and Training of Vinhphuc, Professional Training officials of Department of Education and Training of Vinhphuc; rectors of Colleges in Vinhphuc province, Head of Training Departments of Colleges, ... of Vinhphuc, Professional Training officials of Department of Education and Training of Vinhphuc; rectors of Colleges in Vinhphu...

Ngày tải lên: 13/05/2014, 14:46

121 289 0
Báo cáo lâm nghiệp: " Biomass and composition of understory vegetation and the forest floor carbon stock across Siberian larch and mountain birch chronosequences in Iceland" docx

Báo cáo lâm nghiệp: " Biomass and composition of understory vegetation and the forest floor carbon stock across Siberian larch and mountain birch chronosequences in Iceland" docx

... reduction in bryophytes and monocots was observed in the birch forests as in the larch plantations The main difference between the two forest types was the dominance of dicots in the ground flora of the ... the birch forests (Fig 4) 3.7 Carbon stocks of the forest floor 3.5 Mass of dead twigs and coarse woody debris As the forests became o...

Ngày tải lên: 08/08/2014, 00:22

8 248 0
Báo cáo y học: " The role of surfactant protein D in the colonisation of the respiratory tract and onset of bacteraemia during " doc

Báo cáo y học: " The role of surfactant protein D in the colonisation of the respiratory tract and onset of bacteraemia during " doc

... surfactant protein D plays an important role in delaying the appearance of pneumococci in the blood and in limiting their numbers in the bloodstream SP -D binds and agglutinates S pneumoniae in the presence ... timepoint This could have resulted in decreased levels of phagocytosis due to the deficiency in the binding and opsonisation of the pne...

Ngày tải lên: 12/08/2014, 18:20

12 341 0
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx

Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx

... The interval between morning and afternoon milking is denoted "day milking interval" (DMI) and that between afternoon and morning milking "night milking interval" (NMI) All values for each parameter ... the morning milkings day and day Night milking interval = the time between afternoon and morning milking Day milking interval = the time between morni...

Ngày tải lên: 12/08/2014, 18:22

10 397 0
Báo cáo y học: " Chiropractic wellness on the web: the content and quality of information related to wellness and primary prevention on the Internet" potx

Báo cáo y học: " Chiropractic wellness on the web: the content and quality of information related to wellness and primary prevention on the Internet" potx

... al.: Chiropractic wellness on the web: the content and quality of information related to wellness and primary prevention on the Internet Chiropractic & Manual Therapies 2011 19:4 Submit your ... content related to cancer prevention and one had 100 98 information on prevention of stroke or heart disease but none had information specif...

Ngày tải lên: 13/08/2014, 15:21

7 338 0
Báo cáo y học: "Distribution patterns of small-molecule ligands in the protein universe and implications for origin of life and drug discovery" doc

Báo cáo y học: "Distribution patterns of small-molecule ligands in the protein universe and implications for origin of life and drug discovery" doc

... independently of proteins [56-59], the binding of ligands with primordial proteins would also be a critical step in the origin of life Thus, it is intriguing to explore the chronology of ligand -protein ... energy release during ligand binding may meet the free energy demand during protein folding It is tempting to examine the conjecture of ligand-induced format...

Ngày tải lên: 14/08/2014, 08:20

13 359 0
Báo cáo y học: "Relationship between the tissue-specificity of mouse gene expression and the evolutionary origin and function of the protein" ppsx

Báo cáo y học: "Relationship between the tissue-specificity of mouse gene expression and the evolutionary origin and function of the protein" ppsx

... rapidly than broadly expressed ones [5-7] We have studied the relationship between the phyletic age of a protein and its expression profile, and related this to the function of the protein The ... analysis FuncFunctional File usedof of thethe proteins analysis analysis Phyletic Additionalforof of the proteins usedused used thethe The sequences the the analysi...

Ngày tải lên: 14/08/2014, 14:21

9 392 0
studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene

studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene

... CHAPTER PARTIAL PURIFICATION OF A CHITINASE-CONTAINING PROTEIN COMPLEX IN THE STRAWBERRY PLANT 2.1 Introduction Plant chitinases are pathogenesis-related (PR) proteins, which are implicated in ... demonstrated in other PR protein families, there are acidic and basic isoforms of chitinases Basic chitinases are usually in the vacuole and have antifunga...

Ngày tải lên: 13/11/2014, 09:25

119 307 0
Báo cáo y học: "MALDI-TOF MS Combined With Magnetic Beads for Detecting Serum Protein Biomarkers and Establishment of Boosting Decision Tree Model for Diagnosis of Colorectal Cancer"

Báo cáo y học: "MALDI-TOF MS Combined With Magnetic Beads for Detecting Serum Protein Biomarkers and Establishment of Boosting Decision Tree Model for Diagnosis of Colorectal Cancer"

... conclusion, MALDI-TOF MS combined with magnetic beads is one useful tool for integrating separation and analysis of complex mixtures of proteins With the panel of four selected biomarkers, we achieved ... a by serum protein profiling of patients with chronic liver diseases Hepatology 2005; 41:40-47 28 Cho WC, Yip TT, Ngan RK, Yip TT, Podust VN ProteinChip array...

Ngày tải lên: 25/10/2012, 11:18

9 530 1
Modeling the Statistical Time and Angle of Arrival Characteristics of an Indoor Multipath Channel

Modeling the Statistical Time and Angle of Arrival Characteristics of an Indoor Multipath Channel

... the performance of the available algorithms, information is needed to characterize the time delays and angles of arrival of the major multipath components in the indoor channel The angle of arrival ... indication of the statistics of the angle of arrival, but would yield no information regarding the correlation between time and angle o...

Ngày tải lên: 20/11/2012, 11:32

73 510 0
The What, Why and How of Sys Admin

The What, Why and How of Sys Admin

... skill for Systems Administrators The type of people the Systems Administrator must deal with includes users, management, software and hardware suppliers and other Systems Administrators The following ... especially with them) shows you mean business and understand how your work fits into the organisation It should cover the responsibilities of the systems administrator...

Ngày tải lên: 19/10/2013, 02:20

21 489 0
w